Table I.

Sequences used in this study

GeneSense (5′–3′)Antisense (5′–3′)Primer bank ID
IL-13GCAACATCACACAAGACCAGAGTCAGGGAATCCAGGGCTAC6680403a2
IL-17Aactttcagggtcgagaagattctgaatctgcctctgaat
IL-17FTGCTACTGTTGATGTTGGGACAATGCCCTGGTTTTGGTTGAA22003916a1
IL-22GTGAGAAGCTAACGTCCATCGTCTACCTCTGGTCTCATGG
IL-23RTTCAGATGGGCATGAATGTTTCTCCAAATCCGAGCTGTTGTTCTAT21362353a1
IFNγtgaacgctacacactgcatctcgactccttttccgcttcctg
RORγtAGCTTTGTGCAGATCTAAGGTGTCCTCCTCAGTAGGGTAG
CCL7GCTGCTTTCAGCATCCAAGTGCCAGGGACACCGACTACTG7305463a1
CCL11GAATCACCAACAACAGATGCACATCCTGGACCCACTTCTTCTT6755418a1
CCL20GCCTCTCGTACATACAGACGCCCAGTTCTGCTTTGGATCAGC8394248a1
CCL22AGGTCCCTATGGTGCCAATGTCGGCAGGATTTTGAGGTCCA6677879a1
CXCL1CTGGGATTCACCTCAAGAACATCCAGGGTCAAGGCAAGCCTC6680109a1
β-actinAGAGGGAAATCGTGCGTGACCAATAGTGATGACCTGGCCGT