Table I.

Primer Sequences for Mouse TLR RT-PCR Used in This Study

Nucleic sequencesaTpb
TLR-1TCTCTGAAGGCTTTGTCGATACA56
GACAGAGCCTGTAAGCATATTCG
TLR-2TCTAAAGTCGATCCGCGACAT58
TACCCAGCTCGCTCACTACGT
TLR-3TTGTCTTCTGCACGAACCTG58
CGCAACGCAAGGATTTTATT
TLR-4CAAGAACATAGATCTGAGCTTCAACCC62
GCTGTCCAATAGGGAAGCTTTCTAGAG
TLR-5ACTGAATTCCTTAAGCGACGTA56
AGAAGATAAAGCCGTGCGAAA
TLR-6AACAGGATACGGAGCCTTGA58
CCAGGAAAGTCAGCTTCGTC
TLR-7TTCCGATACGATGAATATGCACG56
TGAGTTTGTCCAGAAGCCGTAAT
TLR-8GGCACAACTCCCTTGTGATT58
CATTTGGGTGCTGTTGTTTG
TLR-9cCCGCAAGACTCTATTTGTGCTGG62
TGTCCCTAGTCAGGGCTGTACTCAG
  • a Sequences are written 5′ to 3′, sense and antisense primers successively.

  • b Annealing temperature in °C.

  • c Reference 48.