Table I.
Primer nameSequence (5′–3′)S/A
AJ56doTCAAAACGTACCTGGTATAACACTCAGAACA
AJ40TCTTTCTGCTTAACCTGTCCCTCATGA
AJ33doTTAGCTTGGTCCCAGAGCCCCA
AJ33CATGCATTATTCAGCCAGTGCCTTCTA
AJ16CTTGCTTCCCGTGATGTCTGGATGAA
AJ9doACCGAAAGCCACAGGTAACTCCTTATCTCCA
AJ2TACCGGGTTGCAAATGGTGCCACTTA
X6.5 (P53)ACAGCGTGGTGGTACCTTATS
X7 (P53)CACATGTACTTGTAGTGGATGGA
Probe name
AJ40pTCTTGCTTGTACTACTTACGT
AJ16pACCCCACTAACATGTCTAAAAG
AJ9p2GTAATTTAAATCAAGTTTCTCATTGCACTC
AJ2p2GGGGTAACTCACCAGATATTACCGTCACT
  • S, primer in transcription orientation; A, primer in reverse of transcription orientation.