Table 1

Sequences of PCR Primers

RT-PCR primers
TLRForward primersReverse primers
1CGTAAAACTGGAAGCTTTGCAAGACCTTGGGCCATTCCAAATAAGTCC
2GGCCAGCAAATTACCTGTGTGCCAGGTAGGTCTTGGTGTTCA
3ATTGGGTCTGGGAACATTTCTCTTCGTGAGATTTAAACATTCCTCTTCGC
4CTGCAATGGATCAAGGACCATCCCACTCCAGGTAAGTGTT
5CATTGTATGCACTGTCACTCCCACCACCATGATGAGAGCA
6TAGGTCTCATGACGAAGGATGGCCACTGCAAATAACTCCG
7AGTGTCTAAAGAACCTGGCTTGGCCTTACAGAAATG
8CAGAATAGCAGGCGTAACACATCAAATGTCACAGGTGCATTCAAAGGG
9TTATGGACTTCCTGCTGGAGGTGCCTGCGTTTTGTCGAAGACCA
10CAATCTAGAGAAGGAAGATGGTTCGCCCTTATAAACTTGTGAAGGTGT
β-actinATCTGGCACCACACCTTCTACAATGAGCTGCGCGTCATACTCCTGCTTGCTGATCCACATCTGC
Real-time PCR primers
TLRForward primersReverse primers
2GGCCAGCAAATTACCTGTGTGAGGCGGACATCCTGAACCT
4CTGCAATGGATCAAGGACCATTATCTGAAGGTGTTGCACATTCC
7TTACCTGGATGGAAACCAGCTACTTCAAGGCTGAGAAGCTGTAAGCTA
9TGAAGACTTCAGGCCCAACTGTGCACGGTCACCAGGTTGT