Table 3

Primer Pairs Used for Constructing MS11-F62 Hybrid Por Molecules Using Overlap Extension PCR

MutationPrimer sequence (5′→3′)
F625 to MS115GGGATACTATAAACTTGATGTTCGTATTCGATTTTTTTAGTG/PorI
CGAATACGAACATCAAGTTTATAGTATCCCCAGCCTGTTTGT/PorII
F626 to MS116TCACGCACTAATTGATTTTGATACAATTTGGCATCTTGTTG/PorI
TTGTATCAAAATCAATTAGTGCGTGATAATTCGCACAACTCTCAA/PorII
MS115 to F625AAACTGGGGATATTATATGCATATCCTTCCATTTTTTTAGTGCCTTCGCCG/PorI
AAAAATGGAAGGATATGCATATAATATCCCCAGTTTGTTTGTTTGTTGAAAA/PorII
MS116 to F626GCACGCCATGTTCCATACAATTTGGCATCTTGTTGTTGTG/PorI
CACAACAACAAGATGCCAAATTGTATGGAACATGGCGTGC/PorII