Table I

New Polymorphic Markers Mapped to the Lps Region

LocusProbeRepeat unit*Primers 5′ → 3′Allele sizePolymorphism‡
bp
P1-5227D4Mcg5[CT]23 [GT]23F: GGGAGGATGTAAAGCTTGAT141H>B=D>S
R: CCAACATCCTCTTACCTCCA
P1-5226D4Mcg6[GT]24F: GCATAGGAACAGCTTCTGTGT122H=D>B
R: TTCTATAAATAAGTACCT
Bac243o20D4Mcg10[CA]4TA[CA]25F: TCCTCAGTCACACTAGATTG120B=D>H>S
R: TAGCCTGTGGTGTGATTAGTT
Yac89a3D4Mcg21[GT]19N22[AT]11F: CAGGGAGGCATATTCATA168H=D<B<S
R: TCTAATTGCCTTTCAATC
Yac89a3D4Mcg24[GT]16F: GGTACCTCTATTAGGTGAATC113S>H>B=D
R: ACAGTCTGACCTAGGTAGAGG
Yac89a3D4Mcg25[CA]24F: CCATGCTGGGAATCTCACAAC164D<H=B<S
R: CTATTCTAGAGCCAGTCATTTC
Yac89a3D4Mcg27[GT]25F: CTTTCATTAGACAGATTATAT140H>B=D>S
R: CAGACAGTATGAACTCCTG
  • *  The base composition of each simple sequence repeat is indicated. A, adenine; C, cytosine; G, guanine; T, thymidine. Numeric subscripts denote the length of each dinucleotide repeat shown in brackets. N22 = 22-bp nonrepetitive sequence.  

  •  Relative allele sizes among inbred mouse strains as generated by PCR using flanking forward (F) and reverse (R) primers. B, C57BL/6J; D, DBA/ 2J; H, C3H/HeJ; S, M. spretus.