Table 3

Insertions and Deletions into Somatically mutated V Genes Reported in the Literature

NameSourceIns/Del (position)Relation to surrounding sequenceReferences
Selected populations or coding regions:
 L4-leHuman VH4–34 (4.21)ACC insert (within CDR2)4-34:AGC ACC     AAC (RT)38
L4-1e:AGg ACCACC AAC (RT)
 3B62Murine VH 186.2GTT deletion (CDR2)VH186.2:AGT GGT GGT ACT (RT)39
3B62:AGT     GGT ACT
Unselected populations or untranslated regions:
 3B62Murine VH 186.2/D/JH2 to JH4ACT deletion (3′ untranslated)GL:GTG ACTACT TTG (RT)40
3B62:GTG     ACT TTG
 3B44Murine VH 186.24 single-base deletions (leader intron)VH186.2:GGC,    GGT (RT)39, 40
3B62:G C,    G T
Other 2 events unrelated
 M167Murine VH107/DFL16.1/JH12 single-base insertions (leader intron)GL:ATAGAAGATTAGTAG (RT)41
M167ATAGTAAGATTAGTAG
(3′ untranslated)GL:TTTCAGGTCATGAAGGA (RT)29, 41*
M167:TTTgAAGGTCATGAAGGA
5 single-base deletionsGL:GCTTTTCTGTA...CCCAGGAAAAGA
M167GCTTTTCTGTA...CCCAGAAAAGA (IR)
(all in 3′ untranslated region)GL:CTTTTTTCTT (RT)41
M167CTTTTTCTT
GL:AGATTTTAC (RT)
M167AGAccT AC
GL:TCATTGG (RT)
M167TCAT GG
GL:GTGACTACTTTGACTACTG (RT)
M167GTACTACTTTGACTACTG
TA deletion (3′)None found (possible hotspot)
GTGT deletion (leader intron)GL:TCTGTGTGTGTGTAT (RT)
M167:TCTGTGT    GTAT
 M603Murine VHS10 7/DFL16.1/JH1TC Deletion (leader intron)GL:TTTTCCTTGTCCTTGTTTT (RT)42, 41
M603:TTTTCCTTG  CTTGTTTT
AAAT deletion (3′ Ei/MAR)GL:GCATTTCTAAAATAAGTTGAGGA (IR)
M603GCATTTCTA    AAGTTGAGGA
 MC101Murine VHQ52/D/JH3GG deletion (3′ untranslated)GL:AAACGGGAATC (RT)42, 43
MC101:AAAC  GAATC
 M511Murine Vκ167/Jκ5GAA deletion (3′ untranslated)GL:TTTGAAGATAAA (RT)42, 44
m511:TTT   GATAAA
 H37-65Murine Vκ Vκ21E/Jκ1-Jκ211 base deletion (Jκ1/Jκ2 intron)GL:AGGGACACCAGTGTGTGTACAC (IL)45
H37:AGGGc           GTACAC
 296.4C11, 253.12D3Murine JκC intron7 base deletion and a 154 base deletionNo good relationship to surrounding sequence46
 2G7Murine transgenesingle base deletion, and a 49CTTTGAAGAT . . (N30) . . CAGATCAAAG47
 nucleotide deletion(Repeats form ends of deleted “loop”) (IL)
 85κHuman myeloma Vκ genessingle-base (T) insertions into theNo relation, however, event followed the proposed48
 CDR1/FW2 junction rendering  genes out-of-frame hotspot motif TAC
 HF-1‡ clone A6:Human lymphoma (JH untranslated)AG insertion into VH3′Consensus‡:GGGGCAG  GGC (RT)49
 several untranslated regionclone A6:GGGGCAGAGGGC
30 base deletionNo association
  • Continued RT, repetitive tract; IR, inverted repeat (loop with local DNA); IL, internal loop.  

  • *  Secondary structure reported by Golding et al. (29).  

  •  This study is difficult to interpret in the context of the current report as the genomic JH locus was not available. The 10 clones were only 80% homologous to the closest JH locus reported in the literature with most alterations being similar between all of the isolates. Therefore, only 2 of the 26 proposed insertions/deletions can be attributed to somatic mutation with certainty, as they were unique to the consensus of the individual clones.