Table 1. Gene-specific primers used for quantitative PCR
GeneForward primer (5′-3′)Reverse primer (5′-3′)
Ifna            TGACCTCAAAGCCTGTGTGATG            AAGTATTTCCTCACAGCCAGCAG
Ifnb            AGCTCCAAGAAAGGACGAACAT            GCCCTGTAGGTGAGGTTGATCT
Irf7            CAGCGAGTGCTGTTTGGAGAC            AAGTTCGTACACCTTATGCGG
Irf1            CCCACAGAAGAGCATAGCAC            AGCAGTTCTTTGGGAATAGG
Actin            CGTGAAAAGATGACCCAGATCA            CACAGCCTGGATGGCTACGT
Ifi202b            CCGGGAAACACCATTGCTTT            GGCTCTTCACCTCAGACACG
Slfn8            CCCAGATTTCTCACGCCAGT            GGATGCTGCATGGAGGGTTA
Oas2            TTTACCCCCAAAGTACGCCC            ATGCAGAGCTGCCGGTATTT
Oas3            CCTCAGGAGTCCTTGTGCAG            GAACAGCAAGGTGGCCTTTG
Il10            CCAGAGCCACATGCTCCTAGA            GGTCCTTTGTTTGAAAGAAAGTCTTC
Il6            TGAACAACGATGATGCACTTGC            GCTATGGTACTCCAGAAGACC
Tnf            CATCTTCTCAAAATTCGAGTGACAA            CCAGCTGCTCCTCCACTTG
Il23a            CGTATCCAGTGTGAAGATGGTT            CTATCAGGGAGTAGAGCAGGCT
Il12a            ACTAGAGAGACTTCTTCCACAACAA            CACAGGGTCATCATCAAAGAC
Il12b            GGAGACACCAGCAAAACGAT            TCCAGATTCAGACTCCAGGG
Il1b            AAGCCTCGTGCTGTCGGACC            TGAGGCCCAAGGCCACAGGT