The Journal of Experimental Medicine
for flow cytometry > invitrogen
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents
Correction for Serafini et al., J. Exp. Med. 204 (1) 129-139.
Published online
doi:10.1084/jem.20061115060107c
The Journal of Experimental Medicine, Vol. 204, No. 7, 1729-
The Rockefeller University Press, 0022-1007 $30.00
© Serafini et al.
This Article
Right arrow Full Text (PDF, 409K)
Right arrow Alert me when this article is cited
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Serafini, M.
Right arrow Articles by Verfaillie, C. M.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Serafini, M.
Right arrow Articles by Verfaillie, C. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

CORRECTION

 Hematopoietic reconstitution by multipotent adult progenitor cells: precursors to long-term hematopoietic stem cells

Marta Serafini, Scott J. Dylla, Masayuki Oki, Yves Heremans, Jakub Tolar, Yuehua Jiang, Shannon M. Buckley, Beatriz Pelacho, Terry C. Burns, Sarah Frommer, Derrick J. Rossi, David Bryder, Angela Panoskaltsis-Mortari, Matthew J. O'Shaughnessy, Molly Nelson-Holte, Gabriel C. Fine, Irving L. Weissman, Bruce R. Blazar, and Catherine M. Verfaillie

Vol. 204, No. 1, January 22, 2007. Pages 129–139.

Please note that a typographical error appeared in Table S2 of the online supplemental material. The primer sequence for mouse Flt-1 should have been listed as follows:

Flt-1 forward: TGGCCAGAGGCATGGAGT; Flt-1 reverse: TCGCAAATCTTCACCACATTG

The corrected table can be found at: http://www.jem.org/cgi/content/full/jem.20061115/DC1/7.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?



This Article
Right arrow Full Text (PDF, 409K)
Right arrow Alert me when this article is cited
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Serafini, M.
Right arrow Articles by Verfaillie, C. M.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Serafini, M.
Right arrow Articles by Verfaillie, C. M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

  Home | Help | Feedback | Subscriptions | Archive | Search
TABLE OF CONTENTS