|
||
ARTICLE |
CORRESPONDENCE Brad Jones: brad.jones{at}utoronto.ca; OR Mario Ostrowski: mario.ostrowski{at}gmail.com
|
|
|---|
R.B. Jones and L.C. Ndhlovu contributed equally to this paper.
© 2008 Jones et al. This article is distributed under the terms of an Attribution–Noncommercial–Share Alike–No Mirror Sites license for the first six months after the publication date (see http://www.jem.org/misc/terms.shtml). After six months it is available under a Creative Commons License (Attribution–Noncommercial–Share Alike 3.0 Unported license, as described at http://creativecommons.org/licenses/by-nc-sa/3.0/).
It is clear from many studies that HIV-1– or SIV-specific CD8+ and CD4+ T cell responses have an important role in containing viral replication (1–5). However, in most cases cellular immunity to HIV-1 proves incapable of long-term control of viremia and, without antiretroviral therapy, progression to AIDS occurs. The failure of the host immune system to contain HIV-1 is related to the functional impairment of HIV-1–specific CD8+ and CD4+ T cells that accompanies progressive HIV-1 infection, a phenomenon which is referred to as T cell exhaustion (6–17). In HIV-1 infection, the deterioration of the T cell response follows a characteristic pattern: proliferative capacity, cytotoxic potential, and the ability to produce IL-2 are lost early, whereas the production of IFN-
Tim-3 (T cell immunoglobulin and mucin domain–containing molecule 3) is an Ig superfamily member that was identified as a specific cell surface marker of mouse Th1 CD4+ T cells (26). Interaction of mouse Tim-3 with its ligand, galectin-9, regulates Th1 responses by promoting the death of IFN-
is more enduring. Ultimately, the majority of T cells chronically exposed to HIV-1 antigens enter into a state of dysfunction and, as disease advances, even the ability to produce IFN-
is progressively impaired (7, 8, 18–22). The causal relationship between this progressive T cell exhaustion and high levels of HIV-1 replication in progressive infection remains unclear. Recently, signaling through PD-1 was shown to play an important role in T cell exhaustion in three models of chronic viral infection: LCMV in mice, SIV in rhesus macaques, and HIV-1 in humans (12, 13, 15, 23–25). Blockade of the PD-1–PD-L1 signaling pathway results in enhanced T cell responses and viral control in mouse LCMV infection, as well as in enhanced survival and proliferation of HIV-1–specific CD8+ T cells in vitro. Increased levels of total cytokine production and increased frequencies of cells producing cytokine in response to antigen are also induced in 6-d in vitro cultures treated with anti–PD-L1 (12, 15). However, it has been demonstrated that there is no direct relationship between the level of PD-1 expression of an HIV-1– or SIV-specific CD8+ T cell and the ability of that cell to produce cytokine upon ex vivo stimulation (13, 25). This has lead to the suggestion that the enhanced levels of total cytokine production observed in vitro with the addition of anti–PD-L1 is the result of greater survival and expansion of antigen-specific CD8+ T cells rather than improved functionality on a per-cell basis. These data suggest that PD-1 expression marks a population exhibiting features of relatively early T cell exhaustion, where cell survival and proliferation are impaired but cytokine production remains intact. Thus, the mechanisms leading to advanced stages of T cell exhaustion, where cytokine production becomes impaired, remain largely undefined.
–producing Th1 cells (27). In mice, blocking the interaction of Tim-3 with its ligands prevents the acquisition of transplantation tolerance induced by costimulatory blockade (27, 28). Furthermore, Tim-3–deficient mice are refractory to the induction of high-dose tolerance in an experimental autoimmune encephalomyelitis model, and anti–Tim-3 monoclonal antibody treatment of SJL/J mice exacerbated experimental autoimmune encephalomyelitis (26, 29). These results indicate that Tim-3 plays a role in suppressing Th1-mediated immune responses, at least partially through the termination of effector Th1 cells. In humans, a defect in up-regulation of Tim-3 on IFN-
–producing CD4+ T cells has been implicated as a contributing factor to the pathology associated with multiple sclerosis (30, 31). No study has yet examined the role of Tim-3 in chronic viral infection.
![]()
RESULTS
Top
ABSTRACT
RESULTS
DISCUSSION
MATERIALS AND METHODS
REFERENCES
Tim-3 expression on T cells correlates with clinical parameters of progression in HIV-1–infected individuals
We profiled Tim-3 expression by flow cytometry on PBMC from 9 HIV-1–uninfected individuals and 31 treatment-naive, acute/early, and chronically HIV-1–infected subjects (Canadian Immunodeficiency Research Collaborative [CIRC] cohort) that included both viral controllers (nonprogressors) and progressors using a polyclonal anti–Tim-3 antibody. We observed elevated frequencies of Tim-3–expressing CD8+ T cells in acute/early and chronic progressive HIV-1–infected individuals, but not in viral controllers, relative to uninfected individuals (mean 28.5 ± SD 6.8% for HIV-1–uninfected versus 52.2 ± 19.0% for acutely/early infected individuals [P = 0.0015], 49.4 ± 12.9% for chronic progressors [P = 0.0003], and 31.6 ± 7.3% for viral controllers [P = 0.48]; Fig. 1, a and b).
Tim-3 expression was also elevated on CD4+ T cells from acutely/early infected individuals and chronic progressors, as compared with both viral controllers and HIV-1–uninfected individuals (Fig. 1, a and b). The frequency of Tim-3+ CD8+ T cells correlated positively with HIV-1 viral load (P < 0.0001; Fig. 1 d) and inversely with absolute CD4+ T cell counts (P < 0.0001; Fig. 1 d). Similarly, the frequencies of Tim-3+ CD4+ T cells were significantly correlated with viral load (P = 0.0087) and absolute CD4+ T cell counts (P = 0.0273; Fig. 1 d). T cell activation, as reported by CD38 expression, is an additional predictor of disease progression (32). CD38 expression on CD8+ T cells correlated with the frequency of Tim-3+ CD8+ T cells (P < 0.0001; Fig. 1 d), and CD38 expression on CD4+ T cells correlated with the frequency of Tim-3+ CD4+ T cells (P < 0.05; Fig. 1 d). In acute/early and chronic progressive HIV-1 infection, increased expression of both Tim-3 and CD38 manifested as a frequent dual Tim-3+ CD38+ population of CD8+ T cells (Fig. S1, available at http://www.jem.org/cgi/content/full/jem.20081398/DC1). In a separate cohort of 60 treatment-naive acutely/early HIV-1–infected individuals (OPTIONS cohort), we observed an analogous increase in the frequency of Tim-3+ CD8+ and CD4+ T cells as assessed with a monoclonal anti–Tim-3 antibody (Fig. 1 c and Fig. S2 a). Similar positive correlations between HIV-1 viremia, CD38, and Tim-3 expression on T cells were also observed in this acute/early infection cohort (Fig. 1 e).
|
|
|
(Th1) messenger RNA (mRNA) by quantitative PCR. For both CD8+ and CD4+ T cell populations, GATA-3 was expressed at higher levels in the Tim-3– fraction than in the Tim-3+ fraction, whereas T-bet was more highly expressed in the Tim-3+ population (Fig. 4).
Despite the Th1/Tc1 character of Tim-3+ cells, we detected the majority of IFN-
mRNA in the Tim-3– CD8+ population. We then examined IFN-
and TNF-
production in response to stimulation with pooled HIV-1–Gag peptides, CMV/EBV/Influenza (CEF) peptides, or staphylococcus enterotoxin B (SEB) in PBMC from 10 acutely/early HIV-1–infected individuals, 10 chronic progressors, 10 viral controllers, and 5 HIV-1–uninfected individuals. In both HIV-1–infected and –uninfected subjects, IFN-
production from CD4+ and CD8+ T cells in response to stimulation was observed predominately from the Tim-3– population, with minimal cytokine production observed in either the Tim-3lo or Tim-3hi populations (Fig. 5, a and b).
Analogous patterns of cytokine production were observed for acutely/early infected individuals, chronic progressors, viral controllers, and HIV-1–uninfected subjects (Fig. S4, available at http://www.jem.org/cgi/content/full/jem.20081398/DC1). TNF-
and CD107a expression in response to antigen were similarly restricted to Tim-3– cells (Figs. S4 and S5). As a corollary, we identified HIV-1–specific CD8+ T cells by staining with MHC-I tetramers and observed that, in response to cognate peptide, IFN-
was produced only by the Tim-3–/lo fraction, with no IFN-
production from tetramer+ Tim-3hi cells (Fig. 5 c). Thus, the lack of cytokine secretion from the Tim-3hi population cannot be attributed to an absence of antigen-specific cells. Tim-3hi CD8+ T cells were subsequently sorted from Tim-3–/lo CD8+ T cells using ex vivo PBMC from untreated chronic progressors. Both subsets were stimulated with anti-CD3/anti-CD28, and proliferation was assessed by CFSE dilution. Proliferation of the Tim-3–/lo cells was observed, whereas minimal proliferation was detected in the Tim-3hi population (Fig. 5 d).
|
|
Blocking the Tim-3–Tim-3L pathway enhances the functionality of HIV-1–specific T cells
To delineate the causal relationship between Tim-3 expression and T cell dysfunction, we tested whether blocking the interaction of Tim-3 with its ligands would restore function in Tim-3–expressing cells. We used a recombinant soluble Tim-3 (sTim-3) glycoprotein to compete for Tim-3 ligands. Addition of sTim-3 enhanced the expansion of CD8+ T cells specific for the HLA-A*0201 restricted HIV-1–Gag epitope SLYNTVATL (SL9) in HIV-1–infected chronic progressors in a dose-dependent manner up to 2 µg/ml (Fig. 6 a).
Enhanced proliferation of both CD8+ and CD4+ T cells was also observed when PBMCs from chronic progressors were stimulated with pooled Gag and Nef peptides (Fig. 6, b and c). We corroborated these data by using a blocking anti–Tim-3 mAb clone (2E2) to disrupt the Tim-3 pathway in an analogous proliferation assay experiment. Addition of 10 µg/ml of mAb 2E2 resulted in a profound rescue of HIV-1–Gag T cell proliferative responses (Fig. 6 d).
|
production and high levels of Tim-3 expression, there is an important distinction to make. Cells expressing Tim-3 ex vivo have been subjected to chronic stimulation in vivo and are dysfunctional to further in vitro stimulation. In contrast, when Tim-3– cultured cells are stimulated in vitro they perform effector functions, such as producing IFN-
, and then up-regulate Tim-3 to dampen these responses. Thus, depending on when one observes these cultures, high levels of Tim-3 and IFN-
could be observed in association. This model predicts that in addition to restoring functions of exhausted HIV-1–specific T cells, in vitro treatment with sTim-3 should prolong effector function in response to other antigens. This is supported by examining the level of IFN-
production at day 5 of in vitro stimulation with anti-CD3/CD28. Under these conditions, all cells that have undergone division express high levels of Tim-3 (unpublished data). In the presence of sTim-3, these cells consistently express higher levels of IFN-
than in the presence of a control (Fig. S7, available at http://www.jem.org/cgi/content/full/jem.20081398/DC1).
The Tim-3–expressing T cell population is distinct from the PD-1–expressing population.
Because PD-1 has been identified as a marker of exhausted T cells in HIV-1 infection, we determined whether Tim-3 expression defines the same or a distinct population. PBMC from 10 individuals with chronic progressive HIV-1 infection were costained for Tim-3 and PD-1. Expression was analyzed by flow cytometry after gating on CD8+ or CD4+ T cells (Fig. 7).
In 9/10 subjects, Tim-3 and PD-1 were primarily expressed by distinct populations of CD8+ T cells. One subject, OM513, displayed a frequent Tim-3+PD-1+ population (23.6%) but retained both Tim-3+PD-1– and Tim-3–PD-1+ populations (23 and 16.7%, respectively). Similarly, 9/10 subjects showed primarily divergent staining for PD-1 and Tim-3 on CD4+ T cells (Fig. 7, c and d). In HIV-1–specific CD8+ T cells, we observed two patterns of expression: tetramer+ populations were predominantly Tim-3+PD-1– (Fig. 7 e) or they were predominantly Tim-3– and PD-1+ (Fig. 7 f). In both patterns, a minority population coexpressed both Tim-3 and PD-1 (Fig. 7, e and f). Thus, Tim-3 and PD-1 expression define primarily distinct populations.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
We observed that the initiation of HAART in chronic progressive HIV-1 infection frequently resulted in a decline in Tim-3 expression (four out of seven individuals). However, we observed that a subset of chronically HIV-1–infected individuals on HAART therapy (three out of seven) retained high levels of Tim-3 expression despite suppression of HIV-1 viral load to undetectable levels. Maintenance of Tim-3 expression in the context of HAART was associated with sustained high levels of T cell activation (CD38 expression). Persistence of CD38 expression on T cells during HAART is predictive of disease (32, 48–50). In cases where HAART has failed to result in a reduction in CD38 expression, it has been demonstrated that intensification of HAART by eradicating persistent low-level replication can have a positive impact on immunological parameters, including diminishment of CD38 expression (51).
Our demonstration that blockade of the Tim-3 pathway can enhance HIV-1–specific T cell responses ex vivo clearly demonstrates that the Tim-3 pathway plays a critical role in suppressing the overall T cell response to HIV-1. It should be noted, however, that although T cell exhaustion is associated with increased viral replication, it is unclear whether this phenotype leads to loss of viral control in vivo or whether this loss results primarily from other factors, such as viral escape from CTL epitopes or the persistence of viral replication in sanctuaries inaccessible to CTL. The identification of Tim-3 as a novel mechanism of T cell exhaustion constitutes an important prerequisite for designing studies aimed at delineating the relative contributions of T cell exhaustion versus other factors in the overall inability of the cellular immune response to maintain control of HIV-1 replication.
An important implication of the present study is the possibility that pharmacological agents that block Tim-3 signaling may be of benefit in HIV-1 infection and potentially in other chronic viral diseases. However, it is unclear whether the high level of Tim-3 expressed in HIV-1 infection is the result of a pathological mechanism on the part of the virus to incapacitate the host immune system or if it is a physiological response to chronic immune activation necessary to hold immunopathology in check. With regard to the latter, recent data supporting that a dysregulation of the Tim-3 pathway may contribute to the pathology of multiple sclerosis highlights the importance of Tim-3 in regulating potentially harmful immune responses (30, 31). This situation is analogous to the considerations required in pursuing PD-1 as a therapeutic target. An important distinction of Tim-3 as a therapeutic target is its unique association with T cells that are impaired not only in their survival and proliferative potential but also in their ability to produce cytokine. Thus, blockade of the Tim-3 pathway carries the novel potential to enhance not only the numbers of T cells in HIV-1 infection but also to improve the functionality of both CD8+ and CD4+ T cells in HIV-1–infected individuals. Because a subset of subjects maintain high levels of Tim-3 expression despite seemingly effective HAART regimens, Tim-3 therapeutics may also play a role in reversing immune defects that persist with HAART.
The data presented in the present study clearly demonstrate that Tim-3 expression defines a distinct population of exhausted T cells from that of the recently identified PD-1–expressing population. This corroborates a recent study that reported that PD-1–expressing cells comprise only a subpopulation of dysfunctional HIV-1–specific CD8+ T cells in chronic progressors (52). The mechanisms leading to T cell exhaustion in the context of HIV-1 infection are clearly complex and cannot be attributed to a single pathway. It will be intriguing in future studies to explore the possibility of an additive or a synergistic effect of simultaneously blocking both the Tim-3 and PD-1 pathways. Such strategies may allow for a more comprehensive reversal of T cell exhaustion, potentially leading to potent combination therapies.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Peptides and stimulation reagents.
Overlapping HIV-1 Clade B Gag and Nef pooled peptides were obtained from the National Institutes of Health AIDS Research and Reference Reagent Program. CEF pooled peptides (AnaSpec), SEB (Sigma-Aldrich), and purified anti-CD3 and anti-CD28 monoclonal antibodies (BD) were used as additional reagents. Stimulations were performed with final concentrations of 10 µg/ml peptide.
Multicolor cytokine flow cytometry.
PBMCs from healthy HIV-1–uninfected and HIV-1–infected individuals were stained with fluorophore-conjugated monoclonal antibodies to CD4, CD8, CD57, CCR7, CD27, CD45RA, CD25, Ki67 (BD), CD28, PD-1 (BioLegend), CD3 (Beckman Coulter), and TIM-3 (R&D Systems) to determine phenotype assessment. An Aqua amine dye (Invitrogen) was used as a discriminating marker for live and dead cells. In some experiments, cells were stimulated after thawing with an HIV-1–Gag and –Nef peptide pool, a CEF peptide pool, or SEB followed by a fixation and permeabilization step. Intracellular staining for cytokines was performed using anti–TNF-
and IFN-
(BD). Cells were fixed in PBS + 2% paraformaldehyde. Cells were acquired with a modified FACSAria, modified LSRII system, or FACSCalibur (BD). A total of >100,000 events were collected and analyzed with FlowJo software (Tree Star, Inc.). SPICE software (version 3.0; M. Roederer, Vaccine Research Center, National Institute of Allergy and Infectious Diseases, National Institutes of Health) was used to assist in the organization and presentation of multicolor flow data.
Pentamer/tetramer analyses.
All pentamers were obtained from ProImmune Ltd and all tetramers were obtained from Beckman Coulter. Pentamers were used for the experiment displayed in Fig. 2, whereas tetramers were used for the experiment summarized in Fig. 7. Cryopreserved PBMC samples from chronically HIV-1–infected individuals were thawed and washed with 2 x 10 ml of 1% FBS PBS with 2 mM EDTA. Staining was performed immediately after thawing with fluorophore-conjugated antibodies against CD8 (BD), Tim-3 (R&D Systems), CD3 (BD), and the indicated pentamers (unlabeled), followed by a secondary staining step with APC-labeled pentamer fluorotags. Cells were washed two times with 1% FBS PBS and then fixed in 2% paraformaldehyde. Analysis was performed using a FACSCalibur instrument (BD).
Synthesis of recombinant Tim-3.
The expression vector pPA-TEV was previously derived from pIRESpuro3 (Clontech Laboratories, Inc.) and modified to incorporate the transin leader sequence and N-terminal protein A tag. The Tim-3 insert was obtained from PCR using the following primers : Tim-3 external forward, 5'-TTCGGCCGGCCCTCAGAAGTGGAATACAGAGCGG-3'; and Tim-3 external reverse, 5'-TGAGCGGCCGCTCATCATCTGATGGTTGCTCCAGAGTC-3'. For each primer, the underlined bases represent the template annealing sequence. Additional 5' sequences comprise restriction sites and stop codons. The region amplified by these primers constitutes only the IgV and mucin domains of Tim-3. The resultant Tim-3 amplicon was cloned into the FseI–NotI cloning site of pPA-TEV. 10 µg of circular DNA plasmid was then transfected into HEK293T cells using the calcium phosphate method (Invitrogen). Expression of Tim-3 was confirmed by Western blot using a 1/5,000 dilution of a polyclonal anti–Tim-3 antibody (R&D Systems) and a 1/5,000 dilution of horseradish peroxidase–conjugated streptavidin (Thermo Fisher Scientific). Transfection was then repeated with linearized pPA–TEV–Tim-3 plasmid to generate stable cell lines. A parallel transfection was performed with empty linearized pPA-TEV. 3 d after transfection, puromycin drug selection was initiated by replacing the media with fresh media supplemented with 1–5 µg/ml puromycin. The media was exchanged with fresh puromycin-containing media every 2 d. 10 d later, six colonies from the pPA–TEV–Tim-3 transfection and six from the pPA-TEV transfection were isolated and expanded into 6-well tissue culture plates. Secreted proteins were detected by Western blot analysis using an anti–Tim-3 antibody for pPA–TEV–Tim-3 and an anti–protein-A antibody for pPA-TEV. A Tim-3–secreting clone (pPA–TEV–Tim-3 transfected) and a control protein A–secreting clone (pPA-TEV transfected) were selected and grown up in 2 liters each of CHO-SFM-II media supplemented with 2% FBS, penicillin, streptomycin, Hepes, L-glutamine, and 1 µg/liter apoprotinin (Sigma-Aldrich) in six T175 tissue culture flasks. Cells were plated at 50% confluency, and protein secretion was allowed to continue for 5 d. Supernatants were concentrated from 2 liters to 10 ml using Centricon Plus-70 centrifugal filter units (Millipore). Proteins were purified using IgG Sepharose 6 Fast Flow beads (GE Healthcare) as per the manufacturer's instructions. 200 µl of 0.33 mg/ml His-tagged TEV protease was then added to the beads, and cleavage was allowed to proceed overnight at 4°C. Supernatants were removed from beads, the beads were washed three times with 1 ml Tris-saline Tween, pH 7.2, and supernatants were pooled with wash eluates. This combined eluate was passed through a 1-ml nickel column (B-PER 6x His fusion protein purification kit; Thermo Fisher Scientific) to remove TEV protease and washed with 3 x 2 ml of wash buffer 2 from the same kit. The eluates were subsequently passed through Detoxi-Gel endotoxin removal columns (Thermo FIsher Scientific), according to the manufacturer's instructions, and then concentrated to 0.5 ml using Centricon plus-20 centrifugal filter units (Millipore). Volumes were then adjusted to 15 ml using sterile PBS and reconcentrated to 0.5 ml. The purity and identity of products were confirmed by SDS-PAGE and Western blot analysis. Protein concentration was determined by a Bradford assay. As expected, only small amounts of residual protein were detectable in the protein A control purification. This sample serves as a control for any effect of contaminant proteins or reagents from the purification process on proliferation or cytokine production.
Proliferation assay.
To track cell division, PBMCs from chronically HIV-1–infected individuals were labeled with 1 mM of the fluorescent intracellular dye CFSE (5-[and -6] carboxyfluorescein diacetate succinimidyl ester; Invitrogen) in PBS and mixed periodically for 10 min at room temperature. Labeling was quenched by addition of an equal volume of complete media (15% FBS in RPMI) for 2 min. The labeled cells were then washed twice, counted, and resuspended in cell culture media. CFSE-labeled cells were stimulated for 5–6 d with either DMSO alone, SLYNTVATL peptide, pooled HIV-1–derived Gag and Nef peptides, or CEF pooled peptides in the presence or absence of sTim-3, an equal volume of expression control, a monoclonal Tim-3–blocking antibody 2E2 (provided by V. Kuchroo, Center for Neurologic Diseases, Brigham and Women's Hospital, Boston, MA 02115), or an IgG1 isotype control. At the end of the culture period, cells were washed and incubated with a combination of the following conjugated anti–human monoclonal antibodies: CD4, CD8 (BD), and Tim-3 (R&D Systems). Intracellular staining for IFN-
, IL-2 (BD), and CD3 (Beckman Coulter) was performed after cells were fixed and permeabilized. Cells were then washed in PBC with 2 mM EDTA and 1% BSA and fixed in 1% paraformaldehyde before being run on an LSRII flow cytometer (BD). Data were analyzed by using FlowJo Software (version 6.4; Tree Star, Inc.).
Signaling analyses.
Before analyses of cellular signaling, archived PBMCs that had been viably frozen were thawed in 15 ml RPMI cell culture medium (Mediatech, Inc.) containing 5% FBS (RPMI+; Thermo Fisher Scientific), washed in PBS containing 2% FBS (PBS+), and then rested at 5 x 106 cells/ml in RPMI+ at 37°C in 5% CO2 overnight. The next day, cells were washed with ice-cold PBS+, transferred to a 96-well V-bottom plate, and stained for cell surface markers with fluorophore-conjugated monoclonal antibodies against CD3, CD8, CD27, CD45RA, and Tim-3 on ice for 40 min. An amine-reactive dye (Invitrogen) was used to stain dead cells. After washing, cells were transferred to PBS containing IL-2 (final concentration, 100 ng/ml; Sigma-Aldrich) or P+I (final concentration, 100 ng/ml and 1 µg/ml, respectively; Sigma-Aldrich) at 37°C to induce signaling. Signaling was arrested after 15, 30, and 45 min by immediate fixation, adding 4% paraformaldehyde (final concentration, 2%). After 20-min fixation and subsequent washing, cells were permeabilized in 70% ice-cold methanol for 20 min on ice. Cells were washed and stained with an antibody cocktail containing the phosphospecific antibodies p-Erk1/2(pT202/pY204), p-p38(pT180/pY182), and p-Stat5(pY694) (BD) for 60 min on ice. Before analysis, cells were washed and resuspended in PBS+ with 0.05% formaldehyde. The unstimulated control cells underwent the same manipulations. Cells were analyzed on a customized LSR II Flow Cytometer (BD). Analysis of data was performed using FlowJo. Fold changes in phosphorylation were calculated as the ratio of MFI of stimulated cells over unstimulated cells.
Quantitative PCR.
Primer sequences were used as follows: TBP forward, GGGCATTATTTGTGCACTGAGA, and TBP reverse, TAGCAGCACGGTATGAGCAACT; GATA-3 forward, TGCATGACTCACTGGAGGAC, and GATA-3 reverse, TCAGGGAGGACATGTGTCTG; T-bet forward, GAGGCTGAGTTTCGAGCAGT, and T-bet reverse, CTGGCCTCGGTAGTAGGACA; and IFN-
forward, TCCAAGTGATGGCTGAACTG, and IFN-
reverse, CTTCGACCTCGAAACAGCAT. Manufacturer's protocols were followed where applicable, unless otherwise noted. RNA was isolated from samples with Trizol (Invitrogen), resuspended in 44 µl diethylpyrocarbonate water, and treated with DNase using DNA-Free (Applied Biosystems). RNA concentrations were determined by spectrophotometry and matched to the sample with the lowest concentration by dilution with diethylpyrocarbonate-treated water. 4 µl RNA were used for each Superscript III First-Strand Synthesis SuperMix (Invitrogen) RT reaction with 1 µl of 50 µM oligodT20. Parallel reactions lacking the RT enzyme were performed and consistently displayed no amplification in subsequent steps. Real-time PCRs were performed using the Prism 7900HT (Applied Biosystems) in 384-microwell plates. All samples, including the external standards, nontemplate control, and RT controls, were run in triplicate. Each 10-µl reaction contained PCR buffer (Invitrogen), 3 mM MgCl2, 0.2 mM dNTP (Applied Biosystems), 1 nM each of forward and reverse primers (Invitrogen), a 1/50 dilution of ROX reference dye (Sigma-Aldrich), a 3/100,000 dilution of SYBR Green I (Sigma-Aldrich), 0.05 U of Platinum Taq polymerase (Invitrogen), and template DNA. Template was a sevenfold serial dilution of genomic DNA for generation of standard curves, 5 µl of complementary DNA synthesis reactions, or 5 µl of matching RT control. Reaction conditions were 95°C for 3 min, followed by 36 cycles of 95°C for 15 s, 64°C for 15 s, and 72°C for 20 s. A final dissociation stage was run to generate a melting curve for verification of amplification product specificity. Real-time PCR was monitored and analyzed by the Sequence Detection System (version 2.0; Applied Biosystems).
Statistical analyses.
We used mixed effects longitudinal analyses to determine if CD8+ T cell activation levels independently associated with Tim-3 on CD8+ T cells during antiretroviral therapy. We specified a random effect for time and the individual. The models were run in the SAS System 9.2 under Proc Mixed. Other statistical tests used are identified in corresponding figure legends.
Online supplemental material.
Fig. S1 shows coexpression profiles of Tim-3 and CD38 in an HIV-1–uninfected individual, an HIV-1–infected chronic progressor with a moderate viral load, and an HIV-1–infected chronic progressor with advanced disease and a high viral load. Fig. S2 shows comparisons of alternative flow cytometry methodologies, including mAb versus polyclonal antibody Tim-3 staining, percentage of CD38 versus CD38 MFI, and percentage of Tim-3 versus Tim-3 MFI. Fig. S3 shows individual subject profiles for the effect of HAART on Tim-3 expression levels (as summarized in Fig. 3 a). Fig. S4 shows the relationship between Tim-3 expression and cytokine (TNF-
and IFN-
) production in HIV-1–infected and uninfected subjects. Fig. S5 shows the relationship between Tim-3 expression and degranulation (CD107a staining) in HIV-1–infected and –uninfected subjects. Fig. S6 shows Tim-3 expression by CFSE diminution after 5 d of in vitro stimulation. Fig. S7 shows the effect of soluble on IFN-
production after 6 d of in vitro stimulation with anti-CD28. Online supplemental material is available at http://www.jem.org/cgi/content/full/jem.20081398/DC1.
| Acknowledgments |
|---|
This research was supported by funds from the Canadian Institutes for Health Research (CIHR), UCSF Gladstone Institute of Virology & Immunology Center for AIDS Research (P30 AI027763), the UCSF AIDS Biology Program of the AIDS Research Institute (ARI), and the National Institutes of Health (AI60379, AI68498, AI64520, and AI066917). L.C. Ndhlovu was supported by the Irvington Institute/Dana Foundation Fellowship from the Cancer Research Institute. M.A. Ostrowski received salary support from the Ontario HIV Treatment Network (OHTN) and the CIHR. R.B. Jones receives a studentship from the OHTN. M.P. Sheth was supported by a grant from the University-wide AIDS Research Program (F05-GI-219). J.M. McCune was supported in part by National Institutes of Health grant U01 AI43641, by the Burroughs Wellcome Fund Clinical Scientist Award in Translational Research, and by the National Institutes of Health Director's Pioneer Award Program, which is part of the National Institutes of Health Roadmap for Medical Research (DPI OD00329). R. Kaul receives salary support from the Canada Research Chair Program and grant support from a CIHR Operating Grant (HOP-81735) and an OHTN Operating Grant. Biosafety level 3 laboratory space and equipment was provided by the Canadian Foundation for HIV Research (CANFAR) in partnership with the Canadian Foundation for Innovation and the Ontario Innovation Trust.
The authors state that they have no other conflicting financial interests.
Submitted: 30 June 2008
Accepted: 9 October 2008
| REFERENCES |
|---|
|
|
|---|
1 Schmitz, J.E., M.J. Kuroda, S. Santra, V.G. Sasseville, M.A. Simon, M.A. Lifton, P. Racz, K. Tenner-Racz, M. Dalesandro, B.J. Scallon, et al. 1999. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science. 283:857–860.
2 Metzner, K.J., X. Jin, F.V. Lee, A. Gettie, D.E. Bauer, M. Di Mascio, A.S. Perelson, P.A. Marx, D.D. Ho, L.G. Kostrikis, and R.I. Connor. 2000. Effects of in vivo CD8+ T cell depletion on virus replication in rhesus macaques immunized with a live, attenuated simian immunodeficiency virus vaccine. J. Exp. Med. 191:1921–1931.[CrossRef][Medline]
3 Ogg, G.S., X. Jin, S. Bonhoeffer, P.R. Dunbar, M.A. Nowak, S. Monard, J.P. Segal, Y. Cao, S.L. Rowland-Jones, V. Cerundolo, et al. 1998. Quantitation of HIV-1-specific cytotoxic T lymphocytes and plasma load of viral RNA. Science. 279:2103–2106.
4 Price, D.A., P.J. Goulder, P. Klenerman, A.K. Sewell, P.J. Easterbrook, M. Troop, C.R. Bangham, and R.E. Phillips. 1997. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proc. Natl. Acad. Sci. USA. 94:1890–1895.
5 Rosenberg, E.S., J.M. Billingsley, A.M. Caliendo, S.L. Boswell, P.E. Sax, S.A. Kalams, and B.D. Walker. 1997. Vigorous HIV-1-specific CD4+ T cell responses associated with control of viremia. Science. 278:1447–1450.
6 Shacklett, B.L., C.A. Cox, M.F. Quigley, C. Kreis, N.H. Stollman, M.A. Jacobson, J. Andersson, J.K. Sandberg, and D.F. Nixon. 2004. Abundant expression of granzyme A, but not perforin, in granules of CD8+ T cells in GALT: implications for immune control of HIV-1 infection. J. Immunol. 173:641–648.
7 Trimble, L.A., and J. Lieberman. 1998. Circulating CD8 T lymphocytes in human immunodeficiency virus-infected individuals have impaired function and downmodulate CD3 zeta, the signaling chain of the T-cell receptor complex. Blood. 91:585–594.
8 Appay, V., D.F. Nixon, S.M. Donahoe, G.M. Gillespie, T. Dong, A. King, G.S. Ogg, H.M. Spiegel, C. Conlon, C.A. Spina, et al. 2000. HIV-specific CD8+ T cells produce antiviral cytokines but are impaired in cytolytic function. J. Exp. Med. 192:63–75.
9 Andersson, J., H. Behbahani, J. Lieberman, E. Connick, A. Landay, B. Patterson, A. Sonnerborg, K. Lore, S. Uccini, and T.E. Fehniger. 1999. Perforin is not co-expressed with granzyme A within cytotoxic granules in CD8 T lymphocytes present in lymphoid tissue during chronic HIV infection. AIDS. 13:1295–1303.[CrossRef][Medline]
10 Brenchley, J.M., N.J. Karandikar, M.R. Betts, D.R. Ambrozak, B.J. Hill, L.E. Crotty, J.P. Casazza, J. Kuruppu, S.A. Migueles, M. Connors, et al. 2003. Expression of CD57 defines replicative senescence and antigen-induced apoptotic death of CD8+ T cells. Blood. 101:2711–2720.
11 Zhang, D., P. Shankar, Z. Xu, B. Harnisch, G. Chen, C. Lange, S.J. Lee, H. Valdez, M.M. Lederman, and J. Lieberman. 2003. Most antiviral CD8 T cells during chronic viral infection do not express high levels of perforin and are not directly cytotoxic. Blood. 101:226–235.
12 Day, C.L., D.E. Kaufmann, P. Kiepiela, J.A. Brown, E.S. Moodley, S. Reddy, E.W. Mackey, J.D. Miller, A.J. Leslie, C. DePierres, et al. 2006. PD-1 expression on HIV-specific T cells is associated with T-cell exhaustion and disease progression. Nature. 443:350–354.[CrossRef][Medline]
13 Petrovas, C., J.P. Casazza, J.M. Brenchley, D.A. Price, E. Gostick, W.C. Adams, M.L. Precopio, T. Schacker, M. Roederer, D.C. Douek, and R.A. Koup. 2006. PD-1 is a regulator of virus-specific CD8+ T cell survival in HIV infection. J. Exp. Med. 203:2281–2292.
14 Pitcher, C.J., C. Quittner, D.M. Peterson, M. Connors, R.A. Koup, V.C. Maino, and L.J. Picker. 1999. HIV-1-specific CD4+ T cells are detectable in most individuals with active HIV-1 infection, but decline with prolonged viral suppression. Nat. Med. 5:518–525.[CrossRef][Medline]
15 Trautmann, L., L. Janbazian, N. Chomont, E.A. Said, S. Gimmig, B. Bessette, M.R. Boulassel, E. Delwart, H. Sepulveda, R.S. Balderas, et al. 2006. Upregulation of PD-1 expression on HIV-specific CD8+ T cells leads to reversible immune dysfunction. Nat. Med. 12:1198–1202.[CrossRef][Medline]
16 Hess, C., M. Altfeld, S.Y. Thomas, M.M. Addo, E.S. Rosenberg, T.M. Allen, R. Draenert, R.L. Eldrige, J. van Lunzen, H.J. Stellbrink, et al. 2004. HIV-1 specific CD8+ T cells with an effector phenotype and control of viral replication. Lancet. 363:863–866.[CrossRef][Medline]
17 Shankar, P., M. Russo, B. Harnisch, M. Patterson, P. Skolnik, and J. Lieberman. 2000. Impaired function of circulating HIV-specific CD8(+) T cells in chronic human immunodeficiency virus infection. Blood. 96:3094–3101.
18 Kostense, S., K. Vandenberghe, J. Joling, D. Van Baarle, N. Nanlohy, E. Manting, and F. Miedema. 2002. Persistent numbers of tetramer+ CD8(+) T cells, but loss of interferon-gamma+ HIV-specific T cells during progression to AIDS. Blood. 99:2505–2511.
19 Deeths, M.J., R.M. Kedl, and M.F. Mescher. 1999. CD8+ T cells become nonresponsive (anergic) following activation in the presence of costimulation. J. Immunol. 163:102–110.
20 Roos, M.T., R.A. van Lier, D. Hamann, G.J. Knol, I. Verhoofstad, D. van Baarle, F. Miedema, and P.T. Schellekens. 2000. Changes in the composition of circulating CD8+ T cell subsets during acute epstein-barr and human immunodeficiency virus infections in humans. J. Infect. Dis. 182:451–458.[CrossRef][Medline]
21 Gamadia, L.E., I.J. ten Berge, L.J. Picker, and R.A. van Lier. 2002. Skewed maturation of virus-specific CTLs? Nat. Immunol. 3:203.[CrossRef][Medline]
22 Ostrowski, M.A., S.J. Justement, L. Ehler, S.B. Mizell, S. Lui, J. Mican, B.D. Walker, E.K. Thomas, R. Seder, and A.S. Fauci. 2000. The role of CD4+ T cell help and CD40 ligand in the in vitro expansion of HIV-1-specific memory cytotoxic CD8+ T cell responses. J. Immunol. 165:6133–6141.
23 Barber, D.L., E.J. Wherry, D. Masopust, B. Zhu, J.P. Allison, A.H. Sharpe, G.J. Freeman, and R. Ahmed. 2006. Restoring function in exhausted CD8 T cells during chronic viral infection. Nature. 439:682–687.[CrossRef][Medline]
24 Freeman, G.J., E.J. Wherry, R. Ahmed, and A.H. Sharpe. 2006. Reinvigorating exhausted HIV-specific T cells via PD-1–PD-1 ligand blockade. J. Exp. Med. 203:2223–2227.
25 Petrovas, C., D.A. Price, J. Mattapallil, D.R. Ambrozak, C. Geldmacher, V. Cecchinato, M. Vaccari, E. Tryniszewska, E. Gostick, M. Roederer, et al. 2007. SIV-specific CD8+ T cells express high levels of PD1 and cytokines but have impaired proliferative capacity in acute and chronic SIVmac251 infection. Blood. 110:928–936.
26 Monney, L., C.A. Sabatos, J.L. Gaglia, A. Ryu, H. Waldner, T. Chernova, S. Manning, E.A. Greenfield, A.J. Coyle, R.A. Sobel, et al. 2002. Th1-specific cell surface protein Tim-3 regulates macrophage activation and severity of an autoimmune disease. Nature. 415:536–541.[CrossRef][Medline]
27 Zhu, C., A.C. Anderson, A. Schubart, H. Xiong, J. Imitola, S.J. Khoury, X.X. Zheng, T.B. Strom, and V.K. Kuchroo. 2005. The Tim-3 ligand galectin-9 negatively regulates T helper type 1 immunity. Nat. Immunol. 6:1245–1252.[CrossRef][Medline]
28 Sanchez-Fueyo, A., J. Tian, D. Picarella, C. Domenig, X.X. Zheng, C.A. Sabatos, N. Manlongat, O. Bender, T. Kamradt, V.K. Kuchroo, et al. 2003. Tim-3 inhibits T helper type 1-mediated auto- and alloimmune responses and promotes immunological tolerance. Nat. Immunol. 4:1093–1101.[CrossRef][Medline]
29 Sabatos, C.A., S. Chakravarti, E. Cha, A. Schubart, A. Sanchez-Fueyo, X.X. Zheng, A.J. Coyle, T.B. Strom, G.J. Freeman, and V.K. Kuchroo. 2003. Interaction of Tim-3 and Tim-3 ligand regulates T helper type 1 responses and induction of peripheral tolerance. Nat. Immunol. 4:1102–1110.[CrossRef][Medline]
30 Anderson, A.C., D.E. Anderson, L. Bregoli, W.D. Hastings, N. Kassam, C. Lei, R. Chandwaskar, J. Karman, E.W. Su, M. Hirashima, et al. 2007. Promotion of tissue inflammation by the immune receptor Tim-3 expressed on innate immune cells. Science. 318:1141–1143.
31 Koguchi, K., D.E. Anderson, L. Yang, K.C. O'Connor, V.K. Kuchroo, and D.A. Hafler. 2006. Dysregulated T cell expression of TIM3 in multiple sclerosis. J. Exp. Med. 203:1413–1418.
32 Giorgi, J.V., Z. Liu, L.E. Hultin, W.G. Cumberland, K. Hennessey, and R. Detels. 1993. Elevated levels of CD38+ CD8+ T cells in HIV infection add to the prognostic value of low CD4+ T cell levels: results of 6 years of follow-up. The Los Angeles Center, Multicenter AIDS Cohort Study. J. Acquir. Immune Defic. Syndr. 6:904–912.[Medline]
33 Gerdes, J., H. Lemke, H. Baisch, H.H. Wacker, U. Schwab, and H. Stein. 1984. Cell cycle analysis of a cell proliferation-associated human nuclear antigen defined by the monoclonal antibody Ki-67. J. Immunol. 133:1710–1715.[Abstract]
34 Combadiere, B., C. Blanc, T. Li, G. Carcelain, C. Delaugerre, V. Calvez, R. Tubiana, P. Debre, C. Katlama, and B. Autran. 2000. CD4+Ki67+ lymphocytes in HIV-infected patients are effector T cells accumulated in the G1 phase of the cell cycle. Eur. J. Immunol. 30:3598–3603.[CrossRef][Medline]
35 van Oijen, M.G., R.H. Medema, P.J. Slootweg, and G. Rijksen. 1998. Positivity of the proliferation marker Ki-67 in noncycling cells. Am. J. Clin. Pathol. 110:24–31.[Medline]
36 Grossman, Z., and W.E. Paul. 2000. The impact of HIV on naive T-cell homeostasis. Nat. Med. 6:976–977.[CrossRef][Medline]
37 Grossman, Z., M.B. Feinberg, and W.E. Paul. 1998. Multiple modes of cellular activation and virus transmission in HIV infection: a role for chronically and latently infected cells in sustaining viral replication. Proc. Natl. Acad. Sci. USA. 95:6314–6319.
38 Sachsenberg, N., A.S. Perelson, S. Yerly, G.A. Schockmel, D. Leduc, B. Hirschel, and L. Perrin. 1998. Turnover of CD4+ and CD8+ T lymphocytes in HIV-1 infection as measured by Ki-67 antigen. J. Exp. Med. 187:1295–1303.
39 Emu, B., E. Sinclair, D. Favre, W.J. Moretto, P. Hsue, R. Hoh, J.N. Martin, D.F. Nixon, J.M. McCune, and S.G. Deeks. 2005. Phenotypic, functional, and kinetic parameters associated with apparent T-cell control of human immunodeficiency virus replication in individuals with and without antiretroviral treatment. J. Virol. 79:14169–14178.
40 Appay, V., P.R. Dunbar, M. Callan, P. Klenerman, G.M. Gillespie, L. Papagno, G.S. Ogg, A. King, F. Lechner, C.A. Spina, et al. 2002. Memory CD8+ T cells vary in differentiation phenotype in different persistent virus infections. Nat. Med. 8:379–385.[CrossRef][Medline]
41 Champagne, P., G.S. Ogg, A.S. King, C. Knabenhans, K. Ellefsen, M. Nobile, V. Appay, G.P. Rizzardi, S. Fleury, M. Lipp, et al. 2001. Skewed maturation of memory HIV-specific CD8 T lymphocytes. Nature. 410:106–111.[CrossRef][Medline]
42 Garrison, K.E., R.B. Jones, D.A. Meiklejohn, N. Anwar, L.C. Ndhlovu, J.M. Chapman, A.L. Erickson, A. Agrawal, G. Spotts, F.M. Hecht, et al. 2007. T cell responses to human endogenous retroviruses in HIV-1 infection. PLoS Pathog. 3:e165.[CrossRef][Medline]
43 Schweneker, M., D. Favre, J.N. Martin, S.G. Deeks, and J.M. McCune. 2008. HIV-induced changes in T cell signaling pathways. J. Immunol. 180:6490–6500.
44 Yang, L., D.E. Anderson, J. Kuchroo, and D.A. Hafler. 2008. Lack of TIM-3 immunoregulation in multiple sclerosis. J. Immunol. 180:4409–4414.
45 Anderson, A.C., and D.E. Anderson. 2006. TIM-3 in autoimmunity. Curr. Opin. Immunol. 18:665–669.[CrossRef][Medline]
46 Lane, H.C., J.M. Depper, W.C. Greene, G. Whalen, T.A. Waldmann, and A.S. Fauci. 1985. Qualitative analysis of immune function in patients with the acquired immunodeficiency syndrome. Evidence for a selective defect in soluble antigen recognition. N. Engl. J. Med. 313:79–84.[Abstract]
47 Streeck, H., Z.L. Brumme, M. Anastario, K.W. Cohen, J.S. Jolin, A. Meier, C.J. Brumme, E.S. Rosenberg, G. Alter, T.M. Allen, et al. 2008. Antigen load and viral sequence diversification determine the functional profile of HIV-1-specific CD8+ T cells. PLoS Med. 5:e100.[CrossRef][Medline]
48 Liu, Z., W.G. Cumberland, L.E. Hultin, H.E. Prince, R. Detels, and J.V. Giorgi. 1997. Elevated CD38 antigen expression on CD8+ T cells is a stronger marker for the risk of chronic HIV disease progression to AIDS and death in the Multicenter AIDS Cohort Study than CD4+ cell count, soluble immune activation markers, or combinations of HLA-DR and CD38 expression. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 16:83–92.[Medline]
49 Hunt, P.W., J.N. Martin, E. Sinclair, B. Bredt, E. Hagos, H. Lampiris, and S.G. Deeks. 2003. T cell activation is associated with lower CD4+ T cell gains in human immunodeficiency virus-infected patients with sustained viral suppression during antiretroviral therapy. J. Infect. Dis. 187:1534–1543.[CrossRef][Medline]
50 Hunt, P.W., J. Brenchley, E. Sinclair, J.M. McCune, M. Roland, K. Page-Shafer, P. Hsue, B. Emu, M. Krone, H. Lampiris, et al. 2008. Relationship between T cell activation and CD4+ T cell count in HIV-seropositive individuals with undetectable plasma HIV RNA levels in the absence of therapy. J. Infect. Dis. 197:126–133.[CrossRef][Medline]
51 Kolber, M.A., M.O. Saenz, T.J. Tanner, K.L. Arheart, S. Pahwa, and H. Liu. 2008. Intensification of a suppressive HAART regimen increases CD4 counts and decreases CD8+ T-cell activation. Clin. Immunol. 126:315–321.[CrossRef][Medline]
52 Wang, C., T. Wen, J.P. Routy, N.F. Bernard, R.P. Sekaly, and T.H. Watts. 2007. 4-1BBL induces TNF receptor-associated factor 1-dependent Bim modulation in human T cells and is a critical component in the costimulation-dependent rescue of functionally impaired HIV-specific CD8 T cells. J. Immunol. 179:8252–8263.
Related Article
Related In this Issue article
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|