Mast cells derived from BM progenitors in vitro (BMCMCs) up-regulated expression of mCCRL2 over time in culture. Early mast cell progenitors were negative for mCCRL2, but after >2 mo in culture, the cells uniformly expressed detectable levels of mCCRL2, albeit with lower levels than those on peritoneal mast cells in vivo (Fig. 1 D). We confirmed RNA expression of mCCRL2 in peritoneal mast cells by real-time quantitative RT-PCR (Fig. 1 E).

CCRL2 and mast cell phenotype and function
We evaluated numbers of mast cells in CCRL2 KO mice in vivo, as well as certain basic functions of CCRL2 KO BMCMC in vitro. Our anti-mCCRL2 mAbs failed to stain peritoneal mast cells from CCRL2 KO mice, confirming the genetic ablation of the gene (Fig. 2 A). The mice are fertile, reproduce with the expected Mendelian distribution of KO/heterozygotes/WT and male/female ratios, and display no differences in basal mast cell numbers in the ear skin or in mesenteric windows (Fig. 2 B).

View larger version (35K): [in this window] [in a new window] [Download PPT slide]   Figure 2. mCCRL2 KO mice. (A) mCCRL2 KO mice are deficient in CCRL2 protein expression. Freshly isolated peritoneal leukocytes were harvested and mCCRL2 expression was evaluated on SSChighF4/80– ckit+ mast cells. A representative histogram plot of the at least three independent experiments performed, each of which gave similar results, is shown. (B) Enumeration of ear skin and mesenteric mast cells in WT and KO mice. Ear skin: KO (n = 9), WT,het (n = 4,1), 4 sections/mouse. Mesenteric window: KO (n = 18), WT,het (n = 9,2). The mean ± SEM is displayed.

View larger version (20K): [in this window] [in a new window] [Download PPT slide]   Figure 3. BMCMCs from mCCRL2 KO and WT mice display similar functional responses in vitro. (A) In vitro transwell chemotaxis to SCF. Four populations of BMCMCs were tested, with duplicate wells for each genotype. The mean ± SEM is displayed. (B–D) BMCMCs were sensitized with DNP-specific IgE and then activated by addition of DNP-HSA. The following parameters were measured: Degranulation (as quantified by β-hexosaminidase release; B), TNF and IL-6 secretion (C), and up-regulation of costimulatory molecules CD137 and CD153 (D). (E) BMCMC-stimulated T cell proliferation. Naive T cells were incubated as indicated with anti-CD3 and cocultured with mitomycin C–treated BMCMCs from WT or CCRL2 KO mice preincubated with or without DNP-specific IgE and tested in the presence or absence of DNP-HSA. Cell proliferation was measured by tritiated thymidine incorporation. For B, C, and D, n = 7 KO, n = 4 WT, mean ± SD. For E, the mean of triplicate measurements ± SD is shown for a representative dataset of three experiments (each of which gave similar results).

We next examined a mast cell–dependent model of atopic allergy, the IgE-dependent PCA reaction. Animals sensitized with 150 ng/ear DNP-specific IgE and challenged with antigen (2,4-DNP-conjugated human serum albumin [DNP-HSA]) i.v. developed strong local inflammatory responses, with no significant difference in the tissue swelling observed in WT versus CCRL2 KO mice (82 ± 9 vs. 91 ± 9 x 10^–2 mm of swelling at 30 min after antigen challenge, respectively; P > 0.05, Student's t test; Fig. S4 A, available at http://www.jem.org/cgi/content/full/jem.20080300/DC1). However, when the sensitizing dose of DNP-specific IgE was reduced to 50 ng/ear, the PCA reactions in CCRL2 KO mice were significantly impaired compared with those in WT mice (42.2 ± 2.8 vs. 24.9 ± 2.7 x 10^–2 mm of swelling at 30 min after antigen challenge, respectively; P < 0.005, Student's t test; Fig. 4 A).

View larger version (16K): [in this window] [in a new window] [Download PPT slide]   Figure 4. Mast cell–expressed mCCRL2 is required for maximal tissue swelling and numbers of dermal leukocytes in PCA. (A) WT or CCLR2 KO mice were sensitized by injection of 50 ng of anti-DNP IgE into left ear skin (with vehicle injection into right ear skin as the control). The mice were challenged by i.v. injection of DNP-HSA (200 µg/mouse) the next day, and ear swelling was measured at the indicated time points (mean ± SEM; n = 3 experiments with a total of 21 KO and 16 WT mice per group). *, P < 0.005 by ANOVA comparing swelling in WT vs. KO ears sensitized with antigen-specific IgE. (B–D) The ears of mast cell–deficient KitW-sh/Wsh mice were engrafted with BMCMCs from either WT or mCCRL2 KO mice. 6–8 wk later, the mice were sensitized (5 ng IgE/left ear, with vehicle into the right ear as the control), challenged with specific antigen (200 µg DNP-HSA i.v.), and assessed for tissue swelling (B), as described in A, and for numbers of mast cells (C) or leukocytes (D) per millimeters squared of dermis. Data are shown as mean ± SEM, n = 3 experiments, with 15 total mice per group in B, and the numbers of mice sampled for histological data are shown in C and D. *, P < 0.001 by ANOVA comparing swelling in mCCRL2 KO BMCMC- vs. WT BMCMC-engrafted ears sensitized with antigen-specific IgE. (C) Enumeration of mast cells present in the dermis of ear skin in engrafted animals from B after elicitation of PCA (IgE) or in vehicle-injected control (vehicle) ears. **, P < 0.005 by Student's t test versus values for the vehicle-injected ears in the corresponding WT BMCMC- or KO BMCMC-engrafted KitW-sh/Wsh mice. (D) Numbers of leukocytes per millimeters squared of dermis, assessed in formalin-fixed paraffin-embedded hematoxylin and eosin–stained sections of mice from B and C. ***, P < 0.0001 by the Mann Whitney U test versus corresponding values for the vehicle-injected ears in WT BMCMC- or KO BMCMC-engrafted KitW-sh/Wsh mice. The numbers over the bars for vehicle-injected mice are the mean values.

However, when the sensitizing dose of DNP-specific IgE was reduced to 5 ng/ear, there was a significant reduction in ear swelling responses in mice that had been engrafted with mCCRL2 KO BMCMCs compared with those that had been engrafted with WT BMCMCs (12.5 ± 1.2 vs. 8.4 ± 0.8 x 10^–2 mm of swelling at 30 min after antigen challenge, respectively; P < 0.01, Student's t test; Fig. 4 B). There were no significant differences in the total number of mast cells detected histologically in WT versus CCRL2 KO BMCMC-engrafted ears, thus ruling out any CCRL2-dependent effects on mast cell engraftment efficiency (Fig. 4 C). However, at 6 h after antigen challenge, IgE-dependent PCA reactions in ears that had been engrafted with CCRL2 KO mast cells contained 50% fewer leukocytes (predominantly neutrophils and mononuclear cells) than did reactions in ears that had been engrafted with WT mast cells (P < 0.03, Mann Whitney U test; Fig. 4 D and Fig. 5). IgE-dependent PCA reactions were associated with a marked reduction in the numbers of dermal mast cells that could be identified in histological sections of these sites based on the staining of the cells' cytoplasmic granules (Fig. 4 C), an effect which most likely reflected extensive mast cell degranulation at these sites (35, 36).

View larger version (70K): [in this window] [in a new window] [Download PPT slide]   Figure 5. Histological features of IgE-dependent PCA reactions in WT BMCMC- versus KO BMCMC-engrafted KitW-sh/Wsh mice. Histological sections of ear skin from WT BMCMC-engrafted KitW-sh/Wsh mice (A–C) and KO BMCMC-engrafted KitW-sh/Wsh mice (D–F) from the same group shown in Fig. 4 D analyzed 6 h after i.v. injection of DNP-HSA show no evidence of inflammation in vehicle-sensitized ears (A and D), but evidence of tissue swelling and increased numbers of leukocytes in DNP-specific IgE-sensitized ears (B, C, E, and F). Enlargements of the boxed regions in B and E are shown in C and F, respectively. The inflammatory infiltrate consists predominantly of polymorphonuclear leukocytes (some indicated by arrowheads in C and F) and occasional mononuclear cells (indicated by an arrow in C). Bars, 50 µm.

CCRL2 binds chemerin
To investigate possible functional roles for CCRL2, we set out to validate/identify CCRL2 ligands. It was reported that mCCRL2/HEK293 transfectants respond functionally to CCR2 ligands CCL2, CCL5, CCL7, and CCL8 via intracellular calcium mobilization and transwell chemotaxis (9), although this conclusion is controversial (8; for review see reference 10). These chemokines did not induce migration of mCCRL2/L1.2 transfectants in our in vitro transwell chemotaxis assays (Fig. S6, available at http://www.jem.org/cgi/content/full/jem.20080300/DC1). We also tested a panel of known chemoattractants (CCL11, CCL17, CCL22, CCL25, CCL27, CCL28, CXCL9, and CXCL13), as well as protein extracts from homogenized mouse tissues (lungs, kidney, liver, brain, and spleen), and found that none stimulated mCCRL2-dependent chemotaxis in our in vitro transwell chemotaxis assays (unpublished data). Given the aberrant DRYLAIV motif that is present in mouse and human CCRL2, we and others postulated that mCCRL2 may act as a silent receptor (for review see reference 10), which is capable of binding chemoattractants but incapable of transducing signals via classical second messengers. That hypothesis is consistent with the negative results obtained in our efforts to induce chemotaxis of mCCRL2/L1.2 transfectants in our in vitro transwell chemotaxis assays.

Although we failed to identify evidence of signaling effects of any of the tested chemoattractants, we were able to identify a high-affinity ligand for the receptor: in independent studies in which we were using our anti-CCRL2 mAbs as controls for staining, we serendipitously discovered that chemerin, a protein ligand for signaling receptor CMKLR1 (for review see reference 28), inhibited the binding of mCCRL2-specific mAbs to mouse peritoneal mast cells. In Fig. 6 A, we illustrate the potent ability of chemerin to inhibit anti-CCRL2 staining of mouse peritoneal mast cells. Increasing concentrations of chemerin blocked the binding of anti-mCCRL2 BZ5B8 (Fig. 6 A) and BZ2E3 (not depicted) in a dose-dependent manner (EC₅₀ = 21 nM). The effect was specific to anti-mCCRL2:mCCRL2 interactions because binding of IgE to FcRI was unaffected by 1,000 nM chemerin (Fig. 6 A), and 1,000 nM CCL2 had no effect on CCRL2 staining (Fig. 6 A).

View larger version (39K): [in this window] [in a new window] [Download PPT slide]   Figure 6. CCRL2 binds chemerin. (A) Chemerin blocks anti-CCRL2 mAb binding. Various concentrations of human chemerin or CCL2 were incubated with total peritoneal mast cells on ice for 5 min, followed by incubation with CCRL2-specific mAb BZ2E3 or anti-IgE and detected with secondary anti–rat PE or anti–mouse IgE PE. (B and C) Radiolabeled chemerin binding. (B) Displacement of iodinated chemerin (residues 21–148) binding to mCMKLR1, huCCRL2, and mCCRL2 by full-length chemerin. (C) Saturation binding of 125I-chemerin21-148 to mCCRL2-transfected cells. (D) Immunofluorescence-based chemerin binding. Various concentrations of untagged serum form chemerin were incubated with mCCRL2-HA, huCCRL2-HA, mCRTH2-HA, or mCMKLR1-HA L1.2 transfectants in the presence of 10 nM His8-tagged serum form chemerin. Samples were incubated on ice for 30 min. Secondary anti-His6 PE was added to detect levels of bound His8-tagged chemerin, and mean fluorescence intensity values are displayed. Mean fluorescence intensity ± range of duplicate staining wells are shown. (E) Mast cell binding. 1,000 nM of untagged chemerin isoforms were incubated with total peritoneal cells from either WT or CCRL2 KO mice in the presence or absence of 10 nM His8-tagged chemerin isoforms. Secondary anti-His6 PE was added to detect levels of bound His8-tagged chemerin. SSChigh F4/80– c-kit+ mast cells were analyzed. For B and C, the mean of quadruplicate wells ±SD is shown for individual experiments. A representative dataset of the three (for B, D, and E) or two experiments (for A and C) performed, each of which gave similar results, is shown.

We developed an immunofluorescence-based chemerin-binding assay to evaluate chemerin binding by flow cytometry. Cells were incubated with a fixed concentration of C-terminal His₈-tagged serum form human chemerin plus increasing concentrations of untagged chemerin, and anti-His₆ PE was used to detect binding. In this assay, chemerin bound specifically to mCCRL2-HA (EC₅₀ = 45 nM) and huCCRL2 (EC₅₀ = 7 nM) L1.2 transfectants (Fig. 6 D). Chemerin binding to CCRL2 was not affected by a variety of other chemoattractants (Fig. S7, available at http://www.jem.org/cgi/content/full/jem.20080300/DC1), and mCRTH2-HA/L1.2 transfectants did not bind to chemerin (Fig. 6 D), demonstrating specificity for chemerin–CCRL2 interactions. Interestingly, we were unable to detect chemerin binding to mCMKLR1-HA/L1.2 transfectants in the immunofluorescence chemerin binding assay (Fig. 6 D). This may reflect inhibition of binding by the C-terminal His₈ tag (which would be analogous to the inhibitory activity of the carboxyl-terminal residues in the chemerin proform) or, potentially, inaccessibility of the His₈ epitope to the detection mAbs when His₈-tagged chemerin is bound to CMKLR1.

In radioligand binding studies, the His₈ tag had little effect on the potency of chemerin binding to mCCRL2 (EC₅₀ = 0.8 nM); however, His₈-tagged chemerin bound with 10-fold less potency to mCMKLR1 (EC₅₀ = 26.3 nM; Fig. S8 A, available at http://www.jem.org/cgi/content/full/jem.20080300/DC1). The bioactive 9-mer carboxyl-terminal chemerin peptide (residues 149–157, YFPGQFAFS) was 10-fold less potent (EC₅₀ = 26.2 nM; see Fig. 8 A) than chemerin protein in binding to CMKLR1. In CCRL2 binding, however, the bioactive chemerin peptide was an inefficient competitor (EC₅₀ could not be determined, Fig. S8 B). Thus, the data indicate distinct binding modes for chemerin and CCRL2 versus chemerin and CMKLR1. The carboxyl-terminal domain of chemerin that is critical for binding to CMKLR1 is relatively uninvolved and unencumbered when chemerin is bound to CCRL2.

Freshly isolated mouse peritoneal mast cells also bound to chemerin (Fig. 6 E), and there was no obvious preference for binding of the proform versus the active serum form (this was also observed in radioligand binding studies using L1.2 transfectants; not depicted). Moreover, mouse peritoneal mast cells bound both human and mouse chemerin (Fig. 6 E). Finally, peritoneal mast cells from mCCRL2 KO mice did not bind to chemerin, further confirming the role of CCRL2 in the binding of chemerin to such mast cells (Fig. 6 E).

CCRL2 does not support chemerin-driven signal transduction
Despite high-affinity binding to mCCRL2, chemerin failed to trigger intracellular calcium mobilization in mCCRL2/L1.2 transfectants (Fig. 7 A). Chemerin triggered a robust calcium flux in cells expressing the chemerin signaling receptor mCMKLR1, confirming its activity (Fig. 7 A). mCCRL2-HA/L1.2 transfectants responded to CXCL12 (via endogenous CXCR4), indicating their competence for demonstrating calcium mobilization in this assay (Fig. 7 A). Furthermore, although it was reported that CCL2 triggered intracellular calcium mobilization in CCRL2/HEK293 transfectants, in our experiments neither CCL2 nor chemerin functioned as agonists for CCRL2 in the HEK293 background, either alone or in combination (Fig. S9, available at http://www.jem.org/cgi/content/full/jem.20080300/DC1).

View larger version (32K): [in this window] [in a new window] [Download PPT slide]   Figure 7. Chemerin-CCRL2 binding does not trigger intracellular calcium mobilization or chemotaxis. (A) mCCRL2 and mCMKLR1 L1.2 transfectants were loaded with Fluo-4, treated with chemerin and/or CXCL12 at the indicated times, and examined for intracellular calcium mobilization. (B) Mouse peritoneal mast cells were enriched by NycoPrep density centrifugation, loaded with Fura-2 and Fluo-4, and assayed for calcium mobilization. 1,000 nM chemerin and 100 nM ATP were added as indicated. (C) mCCRL2-HA, huCCRL2-HA, and mCMKLR1-HA L1.2 transfectants were tested for transwell chemotaxis to various concentrations of chemerin. The mean ± range of duplicate wells is shown. (D) Mouse peritoneal mast cells were assayed for in vitro chemotaxis to various concentrations of SCF and chemerin. Mast cells were identified by gating on SSChigh CD11b– c-kit+ cells. The mean ± SD of triplicate wells is shown for an individual experiment. *, P < 0.01 by Student's t-test comparing migration to 0.05 nM SCF versus (–) no chem. A representative dataset of the three experiments performed, each of which gave similar results, is shown for all parts of this figure.

CCRL2 does not internalize chemerin
Our data place CCRL2 in a class of atypical receptors that include D6, DARC, and CCX-CKR, all of which bind to chemoattractants but do not support classical ligand-driven signal transduction (for review see reference 11). These other receptors have recently been termed professional "chemokine interceptors" because they internalize and either degrade and/or transcytose chemokines (for review see references 10,11; 12). To ask whether CCRL2 might have interceptor activity, we assessed the internalization of CCRL2, and of CMKLR1 for comparison, in response to ligand binding. mCMKLR1-HA internalized rapidly (within 15 min) in response to 100 nM chemerin, and this internalization was inhibited by incubation on ice and in the presence of sodium azide (Fig. 8 A), confirming that the effect is an active process (not caused by chemerin-mediated displacement of the anti-HA mAb). In contrast, under the same conditions, CCRL2 failed to internalize. Neither mouse nor human CCRL2, expressed on L1.2 transfectants, underwent ligand-induced internalization (Fig. 8 A). Even prolonged incubation with chemerin (2 h at 37°C) failed to significantly reduce surface receptor levels (unpublished data).

View larger version (40K): [in this window] [in a new window] [Download PPT slide]   Figure 8. CCRL2 can increase local chemerin concentrations. (A) Chemerin does not trigger CCRL2 receptor internalization. mCCRL2-HA, huCCRL2-HA, and mCMKLR1-HA L1.2 transfectants were stained with anti-HA mAb and then incubated with or without 100 nM chemerin for 15 min at the indicated temperatures. (B) mCCRL2 is not rapidly constitutively internalized. mCCRL2-HA and mCMKLR1-HA L1.2 transfectants were incubated with primary anti-HA mAb, incubated for the indicated times at 37°C, and then stained with secondary anti-mIgG1 PE. mCMKLR1 cells incubated with 100 nM of serum-form chemerin served as a positive control. (C and D) Chemerin is not rapidly internalized. mCCRL2-HA L1.2 transfectants (C) or total peritoneal exudate cells (D) were incubated with 10 nM His8-tagged serum form chemerin and anti-His6 PE for 1 h on ice and then shifted to 37°C. At the indicated time points, the cells were then washed with either PBS or acid wash buffer. Mast cells were identified by gating on SSChigh F4/80– c-kit+ cells in D. (E) CCRL2 can sequester chemerin from solution. 2 nM of serum-form chemerin was incubated with the indicated transfectant lines (or media alone) for 15 min at 37°C. The cells were removed by centrifugation, and the conditioned media was tested in transwell chemotaxis using mCMKLR1HA/L1.2 responder cells. The mean ± SD of triplicate wells for an individual experiment is shown. (F) CCRL2 can increase local concentrations of bioactive chemerin. mCCRL2-HA or empty vector pcDNA3 L1.2 transfectants were preloaded with 1,000 nM of serum-form chemerin and washed with PBS. mCMKLR1/L1.2 loaded with Fluo-4 served as responder cells. The intracellular calcium mobilization in the responder cells was measured over time as loaded cells or purified chemoattractant was added. Note that different scales are used on either side of the broken-axis indicator. A representative dataset of the three experiments performed, each of which gave similar results, is shown for all parts of this figure.

Given that chemerin does not trigger mCCRL2 internalization, it is unlikely that chemerin itself is internalized in substantial amounts in CCRL2⁺ cells (in the absence of CMKLR1). To confirm this directly, we loaded mCCRL2-HA/L1.2 cells with His₈-tagged serum form chemerin and anti-His₆ PE on ice and then shifted the cells to 37°C to permit internalization. At the indicated time points, the cells were washed with either PBS or a high-salt acid wash buffer that strips bound chemerin from the surface of the cell (Fig. 8 C, zero time point). In contrast to D6 and CCX-CKR, where >70% of cell-associated CCL3 (13) and 100% of cell-associated CCL19 (19) became resistant to acid wash within 5 min, respectively, there was essentially no acid-resistant cell-associated chemerin at the 5-min time point and very little at the 60-min time point (Fig. 8 C). In contrast, there was a time-dependent increase in surface-bound chemerin (Fig. 8 C, PBS wash). Freshly isolated peritoneal mouse mast cells also did not internalize chemerin (Fig. 8 D, acid wash). In contrast to mCCRL2/L1.2 transfectants, however, at the 60-min time point there was a considerable reduction in surface-bound chemerin (Fig. 8 D, PBS wash), suggesting either eventual extracellular degradation or chemerin release. Furthermore, mCCRL2-HA/L1.2 transfectants efficiently bound chemerin from dilute aqueous solutions (Fig. 8 E). Thus, it appears that CCRL2 binds and indeed concentrates chemerin on the cell surface.

Finally, we wanted to assess whether chemerin sequestered by mCCRL2⁺ cells could trigger a response in mCMKLR1⁺ cells. We loaded empty vector pcDNA3 or mCCRL2-HA L1.2 cells with chemerin, washed with PBS, added the loaded cells to mCMKLR1/L1.2 responder cells labeled with a calcium-sensitive dye, and assessed intracellular calcium mobilization. Chemerin-loaded mCCRL2-HA/L1.2 cells, but not pcDNA3/L1.2 cells, triggered calcium flux in the responder cells (Fig. 8 F). Thus, CCRL2 can concentrate bioactive chemerin, which then is available for interaction with CMKLR1 on adjacent cells.

	DISCUSSION

Top ABSTRACT RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
The evolutionary conservation of chemerin binding to CCRL2 despite divergence in overall sequence between mouse and human receptors strongly suggests that the interaction of chemerin with CCRL2 is physiologically important. The lack of substantial chemerin internalization by CCRL2 disqualifies the receptor as a professional chemoattractant interceptor and, instead, implicates it as a physiological mediator for the concentration and presentation of bioactive chemerin. We hypothesize, therefore, that CCRL2 serves a novel role among cell surface chemoattractant receptors, regulating the bioavailability of chemerin in vivo to fine-tune immune responses mediated via the signaling receptor CMKLR1. Chemerin inhibits the binding of mAbs specific to amino-terminal epitopes of mCCRL2, implying that chemerin binds directly to the amino-terminal domain of the receptor. In this regard, it is interesting to note that the first 16 aa of human and mouse CCRL2 share 81% identity, compared with just 17% shared identity in the remaining 24 aa of the amino-terminal domain (Fig. S10, available at http://www.jem.org/cgi/content/full/jem.20080300/DC1). This short conserved amino-terminal sequence may therefore embody a critical chemerin binding domain. Furthermore, CCRL2 binds to chemerin in an orientation that permits antibody access to the short C-terminal His₈ tag, suggesting that the critical cell-signaling carboxyl terminus of chemerin would also be exposed in the untagged form of the protein. Thus, we hypothesize that CCRL2 (e.g. expressed by mast cells and activated macrophages) binds to chemerin in vivo and presents the cell-signaling carboxyl-terminal domain of the chemoattractant to CMKLR1⁺ cells such as macrophages, pDC, and NK cells (Fig. 9). In its role as a specialized molecule for concentrating extracellular chemerin, CCRL2 may operate akin to glycosaminoglycans, which are thought to bind, concentrate, and present chemokines to leukocytes and facilitate their chemotaxis (38).

View larger version (43K): [in this window] [in a new window] [Download PPT slide]   Figure 9. Proposed model of presentation of chemerin by CCRL2 to CMKLR1. (A) Chemerin binds to CCRL2 leaving the C-terminal peptide sequence free. The carboxyl-terminal domain of chemerin is critical for transducing intracellular signals and interacts directly with CMKLR1. CCRL2 may thus allow direct presentation of bound chemerin to adjacent CMKLR1-expressing cells. (B) Alternatively, CCRL2 may concentrate the ligand for proteolytic processing by activated mast cells or macrophages, enhancing the local production of the active form which could then act as a chemoattractant after release from the cell surface.

The reason why the tissue swelling associated with IgE-dependent PCA reactions in CCRL2 KO mice was less than that observed in WT mice is not yet clear. The largest differences in the tissue swelling responses of the WT versus KO mice (or in the mast cell–deficient mice that had been engrafted with WT vs. KO BMCMCs) were at 30 min after i.v. antigen challenge, an interval which is too short to observe substantial recruitment of circulating leukocytes to the site of the reaction. Perhaps mast cell–bound and then activated chemerin interacts with CMKLR1⁺ macrophages or other mononuclear cells that might be present in normal skin, and such cells in turn have effects that can enhance local vascular permeability. Alternatively, other cell types normally resident in the skin, such as vascular endothelial cells, may respond to locally activated chemerin. The reduced leukocyte numbers present in the dermis 6 h after the elicitation of IgE-dependent PCA reactions in mice whose dermal mast cells lacked CCLR2 indicates that a lack of mast cell CCLR2 also can diminish the longer term consequences of IgE-dependent cutaneous reactions, perhaps by multiple mechanisms (which are yet to be defined). Mast cells themselves are CMKLR1^– (Fig. S11). Notably, the inflammation associated with relatively strong PCA reactions was not substantially affected by the presence of absence of CCRL2, whether on all cells types (Fig. S4A) or only on skin mast cells (Fig. S4, B and C). Thus, whatever contribution mast cell–associated CCRL2 makes to the tissue swelling and leukocyte infiltrates associated with PCA responses appears to enhance tissue sensitivity to suboptimal IgE-dependent mast cell activation.

Treatment of peritoneal macrophages with proinflammatory cytokines (IFN- and TNF) or TLR ligands (LPS and poly:IC but not CpG) up-regulates CCRL2 expression (Fig. S2 A) (3). We observed synergistic effects on receptor up-regulation when TNF or IFN- treatment was combined with LPS. An analysis of transcription factor binding sites revealed an interferon-stimulated response element (ISRE) upstream of the CCRL2 promoter, which is conserved among mammals and may be responsible for the IFN-–mediated regulation of gene expression in macrophages (Fig. S2 B). LPS and IFN- did not influence CCRL2 expression on similarly treated peritoneal mast cells (unpublished data). The constitutive expression of CCRL2 on freshly isolated mast cells and the regulated expression of CCRL2 on macrophages indicates that there can be cell type–specific regulation of CCRL2 gene expression. Furthermore, it is interesting to note that CCRL2 and CMKLR1 on macrophages are reciprocally regulated (e.g., LPS causes down-regulation of CMKLR1 but up-regulation of CCRL2 (Fig. S2 A) (23). Our data indicate that at some point before 24 h after activation by TLR ligands or proinflammatory cytokines, macrophages can concurrently express both chemerin receptors CMKLR1 and CCRL2. The functional consequence of this is under investigation.

CCRL2 may play distinct physiological roles depending on the cellular context of its expression. In a general survey of mouse tissues, mCCRL2 is expressed at the RNA level in the lung, heart, and spleen, with minimal expression in the brain or thymus (Fig. S12, available at http://www.jem.org/cgi/content/full/jem.20080300/DC1). CCRL2 expression by stromal cells in the lung and heart may serve to maintain a reservoir of chemerin and to buffer tissue levels of the attractant in vivo in the same manner that erythrocyte-expressed atypical chemokine receptor DARC can serve as a buffer to maintain chemokine levels in the blood (14, 15). We are currently investigating this hypothesis by comparing chemerin protein levels in blood and tissue extracts from WT and CCRL2 KO mice.

Transfectant-expressed CCRL2 has been reported to bind CCL2 and CCL5, although this result is controversial (9). CCL2 did not interfere with anti-mCCRL2 mAb staining in our studies. In addition, using either the binding conditions published in this paper for chemerin or those published by Biber et al. (9) for CCL2, we were unable to confirm the binding of biotinylated CCL2 to CCRL2/L1.2 transfectants (unpublished data). However, it is unclear whether the biotinylated CCL2 reagent available to us is useful for identifying cognate receptor expression because we observed similar high background binding of this reagent to T cells in WT and CCR2 KO mice.

The identification of natural ligands for silent or nonsignaling receptors (such as D6, DARC, and CCX-CKR) has lagged behind the deorphaning of signaling receptors. This is likely because of an intrinsic bias toward GPCR-ligand screening methods that rely on measuring functional responses (e.g., calcium mobilization or chemotaxis), rather than binding, per se, to identify "hits". Although there are >100 orphan heptahelical GPCR sequences that have been identified via genome sequencing (41), the phylogenetic homology of CCRL2 with CC chemokine receptors, and its expression at the RNA level by LPS activated macrophages, suggested that CCRL2 may be a modulator of leukocyte trafficking. Indeed, we show herein that the expression of CCLR2 by mast cells can enhance the numbers of leukocytes in the dermis at sites of IgE-dependent cutaneous inflammation (Fig. 4 D). The identification of chemerin as a nonsignaling ligand for CCRL2 introduces a novel functionality for atypical receptors (i.e., concentration and presentation, as we have shown herein for CCRL2, as opposed to internalization/degradation). Our findings expand the possible ligand space for atypical orphan receptors to include chemoattractants beyond the chemokine family and provide a potential link between CCRL2 expression and chemerin-dependent effects on inflammation that are mediated via the cell-signaling chemerin receptor CMKLR1.

	MATERIALS AND METHODS

Top ABSTRACT RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
Antibodies and reagents.
Anti-mouse CD11b, CD14, CD19, B220, Gr1, and TCRβ dye-linked mAb were obtained from eBioscience. Anti-mouse CD11c, c-kit, CD49b, and TER119 dye-linked mAb were obtained from BD Biosciences. Anti-mouse F4/80 FITC was obtained from AbD Serotec. Anti-rat phycoerythrin (human and mouse adsorbed) was purchased from BD Biosciences, anti-His₆ phycoerythrin was purchased from R&D Systems, purified Fc block (mouse anti–mouse CD16.2/32.2) was purchased from Invitrogen, anti-mCMKLR1 (BZ194) was prepared in house, and mouse IgG, rat IgG, and goat serum were purchased from Sigma-Aldrich. CCL2-5,7-9,11,16,17,19-22,25,28; CXCL1,2,3,9,10,12,13,16; IL-4; GM-CSF; and Flt-3 ligand were purchased from R&D Systems. Mouse CCL2 biotinylated fluorokine kit was purchased from R&D Systems. CMFDA, Fluo-4-acetoxymethyl (AM), and Pluronic acid F-127 (reconstituted in DMSO) were purchased from Invitrogen. Bioactive chemerin peptide (YFPGQFAFS) was synthesized by the Stanford PAN facility. Phosphothioated CpG oligonucleotides (42) were purchased from QIAGEN. polyI:C and FMLP were purchased from Sigma-Aldrich. LPS (Escherichia coli O11:B4-derived) was purchased from List Biological Laboratories, Inc. TNF and IFN- were purchased from Roche. CFA and IFA were purchased from Sigma-Aldrich. Cytokine levels in culture supernatants were measured by using mouse TNF and IL-6 BD OptEIA ELISA Sets (BD Biosciences).

Animals.
The Veterans Affairs Palo Alto Health Care System Institutional Animal Care and Use Committee (Palo Alto, CA) and the Stanford University Administrative Panel on Laboratory Animal Care (Stanford, CA) approved all animal experiments. CCRL2 KO mice (Lexicon) were backcrossed four generations on the C57BL/6 background. Mast cell deficient Kit^W-sh/Wsh mice on the C57BL/6 background (43) were provided by P. Besmer (Memorial Sloan-Kettering Cancer Center and Cornell University Graduate School of Medical Sciences, NY, NY), and WT C57BL/6 mice were obtained from Taconic. Wistar Furth rats were obtained from Charles River Laboratories.

Mammalian expression vector construction and generation of stable cell lines.
The coding regions of mCCRL2, huCCRL2, mCRTH2, and huCCR10 were amplified from genomic DNA with or without an engineered N-terminal HA tag and cloned into pcDNA3 (Invitrogen). Transfectants were generated and stable lines selected in the mouse pre–B lymphoma cell line L1.2 or HEK293 cells as previously described (44). mCMKLR1 and empty vector L1.2 transfectants were generated as previously described (20). Transfected cells were, in some cases, treated with 5 mM n-butyric acid (Sigma-Aldrich) for 24 h before experimentation (45).

Generating the anti-mCCRL2 mAbs BZ5B8 and BZ2E3.
The immunizing amino-terminal mCCRL2 peptide with the sequence NH₂-MDNYTVAPDDEYDVLILDDYLDNSC-COOH (corresponding to residues 1–24 of mCCRL2, with a nonnative carboxyl-terminal cysteine to facilitate conjugation to keyhole limpet hemocyanin [KLH]) was synthesized by the Stanford Protein and Nucleic Acid Biotechnology Facility and conjugated to KLH according to the manufacturer's specifications (Thermo Fisher Scientific). Wistar Furth rats were immunized with the mCCRL2 peptide/KLH conjugate, first emulsified in CFA and then, subsequently, in IFA. Hybridomas producing anti-mCCRL2 mAbs were subcloned, and specificity was confirmed by reactivity with mCCRL2 but not other L1.2 receptor transfectants. An ELISA-based assay (BD Biosciences) was used to assess the IgG_2a isotypes of the resulting rat anti–mouse CCRL2 mAbs, designated BZ5B8 and BZ2E3.

Harvesting mouse leukocytes.
Mice were given a fatal overdose of anesthesia (ketamine/xylazine), as well as an i.p. injection of 100 U heparin (Sigma-Aldrich), and blood was collected by cardiac puncture. Up to 1 ml of blood was added to 5 ml of 2 mM EDTA in PBS, and 6 ml of 2% dextran T500 (GE Healthcare) was added to cross-link RBCs. The mixture was incubated for 1 h at 37°C, the supernatant was removed and pelleted, and the cells were resuspended in 5 ml of RBC lysis buffer (Sigma-Aldrich) and incubated at room temperature for 5 min. The cells were pelleted and resuspended for use in cell staining. BM cells were harvested by flushing femurs and tibias with media followed by RBC lysis. Peritoneal lavage cells were obtained by i.p. injection of 10 ml PBS, gentle massage of the peritoneal cavity, and collection of the exudate. For some experiments, 500 µl of peritoneal cells (2 x 10⁶ cells/ml) were incubated for 24 h with 1 µg/ml LPS, 10 ng/ml TNF, 100 U/ml IFN-, 20 µg/ml polyI:C, 10–100 µg/ml CpG, or 5 ng/ml TGFβ. For mast cell RNA isolation, peritoneal mast cells were enriched for by density centrifugation. Approximately 140 million peritoneal exudate cells were harvested from nine male WT mice >1 yr of age. The cells were resuspended in 10 ml PBS and underlaid with 5 ml NycoPrep 1.077A (Axis-Shield). After centrifugation, 140,000 high-density mast cells were recovered at the bottom of the tube (along with 100,000 contaminating RBCs). For functional assays using primary mast cells, peritoneal lavage was performed using Tyrode's solution, and the cells were kept at room temperature throughout harvest.

Cell sorting and Wright-Giemsa stain.
Mouse peritoneal cells were stained as described and sorted by standard flow cytometric techniques (FACSVantage; BD Biosciences; flow cytometry was performed at the Stanford University Digestive Disease Center Core Facility, VA Hospital, Palo Alto, CA). 1–5 x 10⁴ sorted cells were loaded into cytospin chambers and centrifuged onto glass slides. The slides were stained with Wright-Giemsa dye by standard automated techniques at the VA Hospital Hematology Laboratory (Palo Alto, CA) and examined by light microscopy with a 40x objective (CX-2; Olympus).

RNA expression analysis.
RNA from the indicated tissues or cells was extracted using an RNeasy kit per the supplier's instructions (QIAGEN). Gene expression was determined by quantitative PCR using a real-time PCR instrument (7900HT; Applied Biosystems) equipped with a 384-well reaction block. 0.3–1.0 µg of total RNA was used as a template for cDNA synthesis using MMLV Reverse transcription (Applied Biosystems) with oligo dT primers, according to the supplier's instructions. The cDNA was diluted and amplified by quantitative PCR in triplicate wells using 10 pmols of gene specific primers in a total volume of 10 µl with Power SYBR Green qPCR Master Mix (Applied Biosystems), according to manufacturer's instructions. CCRL2 gene expression was normalized to cyclophilin A (cycA) levels in each tissue and displayed relative to CCRL2 expression levels detected in the spleen using the 2^–CT method (46). Primers used were the following: mCCRL2 5', ttccaacatcctcctccttg; mCCRL2 3', gatgcacgcaacaataccac; cycA 5', gagctgtttgcagaccaaagttc; and cycA 3', ccctggcacatgaatcctgg. An RNA dot blot array was purchased from BD Biosciences, and hybridizations were performed according to the manufacturer's recommendation. A full-length gel-purified mCCRL2 cDNA probe was radiolabeled with ³²P using Rediprime reagents (GE Healthcare) according to the manufacturer's specifications.

Preparation of BMCMCs.
Mouse femoral BM cells were cultured in 20% WEHI-3 cell conditioned medium (containing IL-3) for 6–12 wk, at which time the cells were >98% c-kit^high FcRI^high by flow cytometry analysis.

β-Hexosaminidase release assay.
BMCMCs were sensitized with 10 µg/ml of anti-DNP IgE mAb (H1--26; reference 47) by overnight incubation at 37°C. The cells were then washed with Tyrode's buffer (10 mM Hepes, pH 7.4, 130 mM NaCl, 5 mM KCl, 1.4 mM CaCl2, 1 mM MgCl2, 0.1% glucose, and 0.1% BSA [fraction V; Sigma Aldrich]) and resuspended at 8 x 10⁶ cells/ml. 25 µl of a 2x concentration of stimuli (final: 0, 1, 10, and 100 ng/ml DNP-HSA [Sigma-Aldrich] or 0.1 µg/ml PMA [Sigma-Aldrich] + 1 µg/ml A23187 calcium ionophore [Sigma-Aldrich]) were added to the wells of a 96-well V-bottom plate (Costar; Corning), and then 25 µl of 8 x 10⁶ cells/ml IgE-sensitized BMCMCs were added and incubated at 37°C for 1 h. After centrifugation, supernatants were collected. The supernatants from nonstimulated IgE-sensitized BMCMCs treated with 50 µl of 0.5%(vol/vol) Triton X-100 (Sigma-Aldrich) were used to determine the maximal (100%) cellular β-hexosaminidase content, to which the experimental samples were normalized. β-hexosaminidase release was determined by enzyme immunoassay with p-nitrophenyl-N-acetyl-β-D-glucosamine (Sigma-Aldrich) substrate as follows: 10 µl of culture supernatant was added to the wells of a 96-well flat-bottom plate. 50 µl of 1.3 mg/ml p-nitrophenyl-N-acetyl-β-D-glucosamine solution in 100 mM sodium citrate, pH 4.5, was added, and the plate was incubated at room temperature for 15–30 min. Next, 140 µl of 200 mM glycine, pH 7, was added to stop the reaction, and the OD₄₀₅ was determined.

T cell–mast cell coculture.
For CD3⁺ T cell purification, a single cell suspension of spleen cells was prepared, and RBCs were lysed (RBC lysing buffer). Spleen cells were incubated with biotinylated anti–mouse B220, Gr-1, CD11b, CD11c, CD49b, Ter119, and c-kit for 20 min at 4°C. The cells were then washed and incubated with streptavidin-beads (Miltenyi Biotec) for 20 min at 4°C, washed again, and passed through a magnetic cell-sorting column (MACS column; Miltenyi Biotec), yielding >95% CD3⁺ T cells. T cells were cocultured with mast cells as described previously (32). BMCMCs were sensitized with 1 µg/ml of anti-DNP IgE mAb at 37°C overnight. After IgE sensitization, BMCMCs were treated with mitomycin C (50 µg/10⁷ cells; Sigma-Aldrich) for 15 min at 37°C. BMCMCs and T cells were suspended in RPMI 1640 media (Cellgro; Mediatech, Inc.) supplemented with 50 µM 2-mercaptoethanol (Sigma-Aldrich), 50 µg/ml streptomycin (Invitrogen), 50 U/ml penicillin (Invitrogen), and 10% heat inactivated FCS (Sigma-Aldrich). 0.25 x 10⁵ T cells/well were plated in a 96-well flat-bottom plate (BD Biosciences) coated with 1 µg/ml anti–mouse CD3 (clone 145-2C11; BD Biosciences) or hamster IgG (eBioscience; in some experiments, anti-CD3 (–) indicates the substitution of control IgG for anti-CD3), and mitomycin C-treated IgE-sensitized or nonsensitized BMCMCs (0.25 x 10⁵ cells/well) in the presence or absence of 5 ng/ml DNP-HSA at 37°C for 72 h. Proliferation was assessed by pulsing with 0.25 µCi ³H-thymidine (GE Healthcare) for 6 h, harvesting the cells using Harvester 96 Mach IIIM (Tomtec, Inc.) and measuring incorporated ³H-thymidine using a Micro Beta System (GE Healthcare).

PCA reaction.
Experimental PCA was performed as previously described (48), with minor modifications. Mice were injected intradermally with 20 µl of either anti-DNP IgE mAb (H1--26; 5, 50, or 150 ng) in the left ear skin or vehicle alone (Pipes-HMEM buffer) in the right ear skin. The next day, mice received 200 µl of 1 mg/ml DNP-HSA (200 µg/mouse) i.v. Ear thickness was measured before and at multiple intervals after DNP-HSA injection with an engineer's microcaliper (Ozaki). For BMCMC engraftment experiments, BMCMCs were generated from either WT or LCCR KO mice, and 10⁶ cells in 40 µl DMEM were injected into the ear skin of mast cell–deficient Kit^W-sh/Wsh mice. 6–8 wk later, the mice were subjected to experimental PCA. After the assay, the mast cells in the ear skin were enumerated in formalin-fixed paraffin-embedded toluidine blue–stained sections to evaluate the extent of engraftment. In some experiments, formalin-fixed paraffin-embedded hematoxylin and eosin–stained sections were examined to enumerate numbers of leukocytes present in the dermis. In all histological studies, examination of the slides was performed by an observer who was not aware of the identity of individual sections.

FITC-induced contact hypersensitivity (CHS).
FITC-induced CHS was performed as described previously (34) with minor modifications. Mice were shaved on abdomen 2 d before FITC sensitization. Mice were then treated with 200 µl of 2.0% (wt/vol) FITC isomer I (Sigma-Aldrich) suspension in acetone-dibutyl phthalate (1:1). 5 d after sensitization with 2.0% FITC, mice were challenged with 40 µl of vehicle alone to the right ear (20 µl to each side) and 0.5% (wt/vol) FITC solution to the left ear (20 µl to each side). Each mouse was housed in a separate cage to prevent contact with each other after FITC challenge. Ear thickness was measured before and at multiple intervals after FITC challenge with an engineer's microcaliper (Ozaki).

Chemerin expression and purification using baculovirus.
The following carboxyl-terminal His₈-tagged proteins were expressed using baculovirus-infected insect cells as previously described (27): "serum form" human chemerin (NH₂-ADPELTE...FAPHHHHHHHH-COOH), "proform" human chemerin (NH₂-ADPELTE...LPRSPHHHHHH-COOH), and serum form mouse chemerin (NH₂-ADPTEPE...FAPHHHHHHHH-COOH). Because certain experiments required nontagged proteins, the His₈ tag was proteolytically removed by treatment with carboxypeptidase A (Sigma-Aldrich), generating the respective proteins NH₂-ADPELTE...FAPH-COOH, NH₂-ADPELTE...RSPH-COOH, and NH₂-ADPTEPE...FAPH-COOH, where the underlined residues are nonnative. The proteins were lyophilized and checked for purity using electrospray mass spectrometry.

Chemerin binding assays.
For chemerin binding/anti-mCCRL2 mAbs displacement assays, total peritoneal exudate cells were incubated with various concentrations of chemerin or CCL2 for 5 min on ice in binding buffer, washed with PBS, and stained with primary antibodies (either anti-mCCRL BZ2E3 or IgE, + Fc block) for 45 min on ice. The cells were washed in PBS and stained with secondary anti-rat IgG PE or anti-mouse IgE PE (+ goat IgG) for 30 min on ice, washed with PBS, stained with directly conjugated F4/80 and c-kit mAbs, and analyzed by flow cytometry. For radioligand binding assays, radioiodinated chemerin (residues 21–148; R&D Systems; custom radiolabeling performed by PerkinElmer) was provided as a gift from J. Jaen (ChemoCentryx, Mountain View, CA). The specific activity of the ¹²⁵I-labeled chemerin was 97 Ci/g. For competition binding assays, L1.2 cells transfected with huCCRL2, mCCRL2, or mCMKLR1 were plated into 96-well plates at 0.5 x 10⁶ cells/well. Cells were incubated in binding buffer (Hanks + 0.5% BSA) for 3 h at 4°C shaking with 1 nM ¹²⁵I-chemerin and increasing concentrations of chemerin, His₈-tagged chemerin, or peptide (9-aa YFPGQFAFS, corresponding to chemerin residues 149–157) as competitors. For saturation binding assays, mCCRL2/L1.2 cells were plated at 0.5 x 10⁶ cells/well. Nonspecific binding was measured in the presence of 100 nM cold chemerin. Binding was terminated by washing the cells in saline buffer, and bound radioactivity was measured. Data were analyzed using Prism (GraphPad Software, Inc.). Binding data (triplicate or quadruplicate wells) were fitted to one-site binding hyperbola for saturation assays or to a one-site competition curve for competition assays. For direct chemerin binding immunofluorescence assays, mCCRL2-HA, huCCRL2-HA, mCMKLR1-HA, and mCRTH2-HA L1.2 transfectants were incubated for 30 min on ice with 10 nM His₈-tagged serum form human chemerin and the indicated concentration of untagged chemerin in binding buffer (PBS with 0.5% BSA and 0.02% azide). The cells were then washed with PBS and incubated with anti-His₆ PE (+ 2% goat serum) for 30 min on ice, washed, and analyzed by flow cytometry. Similar binding experiments were performed on total WT or CCRL2 KO peritoneal exudate cells with the indicated combinations and concentrations of proform or serum form His₈-tagged or untagged chemerin. After chemerin binding, the cells were stained with directly conjugated F4/80 and c-kit mAbs and analyzed by flow cytometry.

In vitro transwell chemotaxis.
For migration experiments using cell lines, 2.5 x 10⁵ cells/100 µl chemotaxis media (RPMI + 10% FCS) were added to the top wells of 5-µm pore transwell inserts (Costar; Corning), and test samples in 600 µl media were added to the bottom wells. After incubating the transwell plates for 1.5 h at 37°C, the bottom wells were harvested and flow cytometry was used to assess migration. For primary cell chemotaxis, 10⁶ cells/100 µl were added to the top well and, after a 2-h incubation at 37°C, polystyrene beads (15.0 µm diameter; Polysciences, Inc.) were added to each well to facilitate normalization of the cell count. The cells were then stained for c-kit, F4/80, and/or CD11b expression and analyzed by flow cytometry. A ratio was generated and percent input migration was calculated.

Intracellular calcium mobilization.
Chemoattractant-stimulated Ca²⁺ mobilization was performed according to Alliance for Cell Signaling protocol ID PP00000210. Cells (3 x 10⁶/ml) were loaded with 4 µM Fluo4-AM and 0.16% Pluronic acid F-127 (Invitrogen) in modified Iscove's medium (Iscove's medium with 1% heat-inactivated bovine calf serum and 2 mM L-glutamine; Invitrogen) for 30 min at 37°C. The samples were mixed every 10 min during loading, washed once, resuspended at up to 2 x 10⁶/ml in the same buffer, and allowed to rest in the dark for 30 min at room temperature. Chemoattractant-stimulated change in Ca²⁺-sensitive fluorescence of Fluo-4 was measured over real-time with a FACScan flow cytometer and CellQuest software (BD Biosciences) at room temperature under constant stirring at 500 rpm. Fluorescent data were acquired continuously up to 1,024 s at 1-s intervals. The samples were analyzed for 45 s to establish basal state, removed from the nozzle to add the stimuli, and then returned to the nozzle. Mean channel fluorescence over time was analyzed with FlowJo software (Tree Star, Inc.). In some experiments, to identify mast cells, mixed peritoneal leukocytes were preincubated with c-kit-PerCP mAb for 3 min immediately before the start of each sample. In other experiments, mCCRL2HA/L1.2 or empty vector pcDNA3/L1.2 cells were loaded for 30 min with 1,000 nM of serum form chemerin (incubated in binding buffer on ice), washed two times with PBS, and resuspended in Iscove's media at 2 x 10⁶/ml. 500 µl of these chemerin-loaded cells were added to mCMKLR1/L1.2 cells loaded with Fluo4-AM, and calcium mobilization was evaluated.

Receptor internalization assay.
mCMKLR1-HA, huCCRL2-HA, and mCCRL2-HA L1.2 transfectants were incubated for 15 min with 100 nM serum form chemerin at the indicated temperature in cell culture media. The cells were then washed with 200 µl PBS and stained with mouse anti-HA (Covance) or mIgG1 isotype control, followed by staining with secondary anti–mouse IgG1 PE, fixed, and analyzed by flow cytometry.

Ligand-independent receptor internalization assay.
mCMKLR1-HA and mCCRL2-HA L1.2 transfectants were loaded for 30 min on ice with primary antibody (anti-HA or mIgG1 isotype control). The cells were washed with 200 µl PBS, incubated for the indicated times at 37°C to allow for receptor internalization, and then placed on ice. The cells were then incubated with secondary anti–mouse IgG₁ PE, and analyzed by flow cytometry.

Chemerin internalization assay.
mCCRL2-HA L1.2 transfectants or total peritoneal exudate cells were incubated with 10 nM His₈-tagged serum form chemerin for 30 min on ice. The primary cells were also stained with F4/80 and c-kit mAbs. Secondary anti-His₆ PE was added to the cells and incubated for 30 min on ice. The cells were then incubated for the indicated times at 37°C to allow for chemerin internalization. The cells were incubated for 5 min on ice with either PBS or acid wash buffer (0.2 M acetic acid and 0.5 M NaCl) and then analyzed by flow cytometry. Mast cells were identified by gating on SSC^highF4/80^–c-kit⁺ cells.

Chemerin sequestration assay.
2 nM of serum form chemerin was incubated with 40 million cells of the indicated transfectant lines (or media alone) for 15 min at 37°C. The cells were removed by centrifugation, and a volume of the conditioned media equivalent to 0.2 nM chemerin (barring any sequestration or degradation) was tested in transwell chemotaxis using mCMKLR1-HA/L1.2 cells.

Statistics.
The unpaired Student's t test (two-tailed), Mann Whitney U test (two-tailed), or analysis of variance (ANOVA) was used for statistical evaluation of the results, as indicated.

Online supplemental material.
Fig. S1 shows that blood lymphocytes, BM neutrophils, and peritoneal macrophages are negative for mCCRL2 expression. Fig. S2 shows that mCCRL2 is up-regulated on macrophages activated by specific cytokines and/or TLR ligands. Fig. S3 shows that mCCRL2 KO mice display a normal contact hypersensitivity response to FITC. Figs. S4 and S5 (histology of skin) show that mCCRL2 is dispensable for maximal tissue swelling and leukocyte infiltration in the dermis in high dose IgE-mediated PCA. Fig. S6 shows that mCCRL2/L1.2 transfectants do not migrate to CCL2, CCL5, CCL7, or CCL8 in in vitro transwell chemotaxis. Fig. S7 shows the lack of heterologous displacement of chemerin by other chemoattractants. Fig. S8 shows the displacement of iodinated chemerin (residues 21–148) binding to CCRL2 and CMKLR1 by His₈-chemerin and bioactive chemerin peptide (YFPGQFAFS). Fig. S9 shows the lack of intracellular calcium mobilization by CCL2 and/or chemerin in CCRL2/HEK293 transfectants. Fig. S10 shows an alignment of human and mouse CCRL2 amino-terminal sequences. Fig. S11 shows the lack of mCMKLR1 expression on peritoneal mast cells. Fig. S12 shows the mRNA expression profile of mCCRL2 using a RNA dot blot. Online supplemental material is available at http://www.jem.org/cgi/content/full/jem.20080300/DC1.

Related Article

Chemerin reveals its chimeric nature

Teizo Yoshimura and Joost J. Oppenheim
J. Exp. Med. 2008 205: 2187-2190. [Abstract] [Full Text] [PDF]