The Journal of Experimental Medicine
Avanti Polar Lipids, Inc.
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

A correction to this article has been published: Dorsett et al., J. Exp. Med. 204 (10) 2491
Published online August 27, 2007
doi:10.1084/jem.20070884
The Journal of Experimental Medicine, Vol. 204, No. 9, 2225-2232
The Rockefeller University Press, 0022-1007 $30.00
© 2007 Dorsett et al.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 2613K)
Right arrow PPT slides of all figures
Right arrow Correction (v204,p2491)
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dorsett, Y.
Right arrow Articles by Nussenzweig, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dorsett, Y.
Right arrow Articles by Nussenzweig, M. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

ARTICLE

A role for AID in chromosome translocations between c-myc and the IgH variable region

Yair Dorsett1, Davide F. Robbiani1, Mila Jankovic1, Bernardo Reina-San-Martin3, Thomas R. Eisenreich1, and Michel C. Nussenzweig1,2

1 Laboratory of Molecular Immunology and 2 Howard Hughes Medical Institute, The Rockefeller University, New York, NY 10021
3 Institut de Génétique et Biologie Moléculaire et Cellulaire, CNRS-INSERM-ULP, Illkirch, 67404 Strasbourg, France

CORRESPONDENCE Michel C. Nussenzweig: nussen{at}rockefeller.edu

 Top
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Chromosome translocations between oncogenes and the region spanning the immunoglobulin (Ig) heavy chain (IgH) variable (V), diversity (D), and joining (J) gene segments (Ig V-JH region) are found in several mature B cell lymphomas in humans and mice. The breakpoints are frequently adjacent to the recombination signal sequences targeted by recombination activating genes 1 and 2 during antigen receptor assembly in pre–B cells, suggesting that these translocations might be the result of aberrant V(D)J recombination. However, in mature B cells undergoing activation-induced cytidine deaminase (AID)-dependent somatic hypermutation (SHM), duplications or deletions that would necessitate a double-strand break make up 6% of all the Ig V-JH region–associated somatic mutations. Furthermore, DNA breaks can be detected at this locus in B cells undergoing SHM. To determine whether SHM might induce c-myc to Ig V-JH translocations, we searched for such events in both interleukin (IL) 6 transgenic (IL-6 tg) and AID–/– IL-6 tg mice. Here, we report that AID is required for c-myc to Ig V-JH translocations induced by IL-6.

Chromosome translocations are products of unresolved double-strand DNA breaks (14) and therefore occur frequently at Ig genes because these loci undergo programmed DNA damage during antigen receptor gene diversification. In developing T and B cells, RAG1 and RAG2 proteins produce double-strand breaks at recombination signal sequences (RSS) found adjacent to variable, diversity, and joining (V(D)J) gene segments (5, 6). These RSS are found in close proximity or within translocation breakpoints in numerous B cell lymphomas (for review see references 7 and 8).

In mature B cells, expression of activation-induced cytidine deaminase (AID) (911) leads to deamination of cytidine residues in Ig V-JH and Ig switch regions resulting in U:G mismatches that are processed to produce somatic hypermutations (SHMs) and initiate class switch recombination (for review see references 1214). Double-strand breaks are obligate intermediates in the class switch reaction, and translocations involving switch regions are frequently found in sporadic Burkitt's lymphoma, diffuse large B cell lymphoma, and multiple myeloma, suggesting that AID is responsible for the lesions that lead to such translocations (1522). Consistent with this idea, AID-induced breaks in the switch region activate the cellular DNA damage response machinery (23), and AID is essential for c-myc translocations to the Ig switch region in IL-6 transgenic (tg) (24, 25). In addition, AID appears to target several oncogenes that are frequently mutated and often translocated to antibody genes in mature B cell malignancies (2630). In agreement with these observations, deregulated expression of AID is associated with malignancy (3134).

Double-strand breaks are not obligate intermediates in SHM of the Ig V-JH (35). Nevertheless, duplications or deletions that would necessitate a double-strand break make up 6% of all the Ig V-JH region–associated somatic mutations, and DNA breaks can be detected in this region in B cells undergoing mutation (3642). In addition, endemic Burkitt's lymphoma, multiple myeloma, follicular lymphoma, and diffuse large B cell lymphoma contain mutated V genes as well as translocations to the Ig V-JH or Ig V-JL regions (for review see references 7, 8, and 43). This suggests that translocations in these malignancies may have occurred in mature B cells that express AID but not RAG1/2 (44), and that some Ig V-JH region–associated translocations are byproducts of lesions induced by AID during hypermutation. To ascertain the extent to which AID contributes to genomic instability at the IgH locus, we tested if AID is required for translocations between c-myc and the Ig V-JH region in IL-6 tg mice.


    RESULTS
 Top
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
IL-6 tg mice develop hyperplastic lymph nodes that contain large numbers of class-switched plasmacytes, a portion of which express GL7 and CD138 (24, 45, 46). Plasmacytosis is believed to develop in these mice because IL-6 attenuates apoptosis and promotes proliferation and differentiation of late-stage B cells, allowing for the accumulation of translocations between IgH and c-myc (45). Although a majority of the c-myc translocation breakpoints are at the Ig switch region, a small fraction occur at the V-JH region (46) and therefore resemble the translocations found in endemic Burkitt's lymphoma (for review see references 7 and 8). To determine whether AID is required for translocations between the Ig V-JH region and c-myc, we generated AID-deficient IL-6 tg mice (AID–/–IL-6 tg) by breeding (24). AID–/–IL-6 tg mice developed lymph node hyperplasia and plasmacytosis with a slightly delayed onset compared with IL-6 tg mice, and there was no detectable class switching in the AID–/–IL-6 tg mice (Fig. 1, A and B) (24).


Figure 1
View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Characterization of IL-6 tg and AID–/– IL-6 tg mice. (A) Flow cytometry analysis of cells from hyperplastic lymph nodes from IL-6 tg and AID–/–IL-6 tg mice. Numbers indicate percentages of cells in a given quadrant. (B) AID accelerates the development of disease in IL-6 tg mice. IL-6 tg mice and AID–/–IL-6 tg mice were killed when they developed enlarged lymph nodes. The average time of death for IL-6 tg was 5.5 mo (n = 8) and 9.2 mo for AID–/–IL-6 tg mice (n = 8; P = 0.0001476 using a two-tailed Student's t test assuming unequal variance). Each point represents one mouse, and the black bars indicate the average time of death.

 
To document translocations between the Ig V-JH region and c-myc, we developed PCR assays for these events and examined cells from hyperplastic lymph nodes from IL-6 tg and AID–/– IL-6 tg mice (Fig. 2 A). Southern blotting and DNA sequencing were used to verify candidate translocations (Figs. 2 and Figs.3). Assaying four different lymph node pools per mouse for derivative 12 and derivative 15 translocations (Fig. 2 A), we identified 37 unique translocations in 14 IL-6 tg mice, but none in 12 AID–/–IL-6 tg mice (P = 0.0025) (Fig. 2 C). Derivative 12 and 15 translocations were similar in both the number of translocations identified (21 and 16, respectively) as well as in their breakpoint distribution along the chromosome (Fig. 3), providing strong evidence that variable region translocations are reciprocal. As expected, c-myc to Ig switch region translocations were far more frequent (Fig. 2 B) (24, 46). We conclude that translocations between c-myc and the Ig V-JH region are AID dependent in IL-6 tg mice.


Figure 2
View larger version (58K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. C-myc to Ig V-JH region. (A) Diagram of translocation assay for detecting derivative 12 and 15 chromosomal translocations from c-myc to the Ig V-JH region. Primer set 1 is indicated in the diagram for derivative 12 (see Materials and methods). The circles at the end of each chromosome represent the centromere. (B) Comparison of c-myc translocations to the IgH V-JH versus switch region. Representative PCRs from three IL-6 tg and one AID–/–IL-6 tg mouse. Primer set 1 was used to detect translocations to the variable region. Each lane represents amplification products from 105 cells. The ethidium bromide–stained gels at the top were probed for c-myc, stripped, and then probed for IgH to verify translocations. (C) Graph shows the number of unique c-myc to Ig V-JH region translocations identified in 14 IL-6 tg mice. No translocations were identified in the same analysis of 12 AID–/–IL-6 tg mice (P = 0.00284 using a two-tailed Student's t test assuming unequal variance.).

 
To gain further insight into the etiology of the identified translocations, we analyzed and mapped the breakpoints. Sequence analysis revealed that the majority of the breakpoints were in or around JH segments, as commonly seen for oncogenic translocations in B cell non-Hodgkin's (Fig. 3) (for review see references 7 and 8). Junction sequences resembled those previously characterized for c-myc to Ig switch region translocations from IL-6 tg mice (24) in that they involved either blunt ends or 1–3 nucleotide stretches of micro-homology or nucleotide insertions (Tables I and II), implying that nonhomologous end joining resolves these breaks. Finally, the translocation breakpoints in c-myc were all in the first intron, which differs from those to the Ig switch region in IL-6 tg mice, where a majority of the breakpoints are in the first exon of c-myc (Fig. 3) (24).


Figure 3
View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Translocation breakpoints. Diagram of translocation breakpoints from c-myc to the Ig V-JH region. Only primer set 1 is indicated for derivative 12 (see Materials and methods). The translocations are annotated as the mouse number followed by the translocation number for that mouse. For example, "2 #2" is mouse 2 translocation number two amplified from that mouse.

 

View this table:
[in this window]
[in a new window]

 
Table I. Derivative 12

 

View this table:
[in this window]
[in a new window]

 
Table II. Derivative 15

 
Although there was no correlation between the position of the breakpoints and the RGYW motifs, which are the preferred targets of AID, the translocated Ig V-JH region was somatically mutated at a frequency of ~0.6 x 10–3 mutations per basepair (Fig. 4). This rate of mutation is similar to that reported for the Ig V-JH region in B cells undergoing hypermutation (47). Derivative 12 and 15 IgH sequences had a similar frequency of hypermutation, suggesting that SHM must have occurred before or during translocation. Interestingly, the overall position of the mutations mirrored the positions of the translocation breakpoints (compare Figs. 3 and Figs.4), supporting the idea that regions prone to SHM are susceptible to translocations. Excluding nucleotide insertions at the breakpoint, the rate of mutation within 20 bp of either side of the translocation breakpoints was almost 10-fold higher (5.4 x 10–3) than that seen overall for IgH in our translocations. This implies that c-myc/IgH translocations are resolved through error-prone repair, or that translocation breakpoints occur at or immediately adjacent to hypermutated sequences. Discounting mutations within 20 bp of the breakpoint, we identified three mutations in c-myc, resulting in a mutation rate that is above background (~0.2 x 10–3) but approximately threefold lower than the rate observed for IgH (Fig. 4). These results suggest that c-myc translocations to the Ig V-JH region in IL-6 tg mice occur during or after Ig V-JH region SHM (28, 47, 48).


Figure 4
View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Somatic mutations in translocated IgH. Analysis of 32,654 bp of IgH sequence from c-myc/IgH translocations identified 20 different mutations (mutation frequency = 0.61 x 10–3), excluding the two mutations found within 4 nts of breakpoints. Excluding the three mutations within 3 nts of the breakpoint, analysis of 16,960 bp of c-myc identified three different mutations (mutation frequency = 0.18 x 10–3). The overall mutation rate within 20 nts of a breakpoint on either side of the translocation was 5.4 x 10–3. Asterisks indicate mutations within 20 nts of a breakpoint.

 

    DISCUSSION
 Top
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Molecular characterization of translocations found in lymphomas showed that in addition to Ig switch regions, many breakpoints are near RSS, suggesting a role for aberrant V(D)J recombination in their etiology. This idea is supported by experiments in mice deficient in DNA damage response and apoptosis pathways that develop spontaneous lymphomas harboring oncogenic translocations involving the TCR or IgH locus (1, 2, 4953). For example, ataxia telangectasia mutated mice (ATM–/–) develop thymic lymphomas with TCR gene translocations (5458). These translocations can be ascribed to V(D)J recombination because they fail to occur in the absence of RAG expression (51, 53). Similarly, mice deficient in p53 and nonhomologous end joining factors or histone H2AX develop RAG-dependent translocations that lead to pro–B cell lymphomas (1, 2, 49, 50, 52, 5963).

However, some translocation breakpoints in proximity of RSS are found in mature B cell tumors, such as endemic Burkitt's lymphoma, diffuse large B cell lymphoma, and multiple myeloma (for review see references 7, 8, and 43). These translocations are believed to arise during or after the germinal center reaction because the Ig genes involved in the translocations are usually somatically mutated (7). Nevertheless, they could be mediated by V(D)J recombination if RAG1/2 were reexpressed in the germinal center. An alternative possibility is that the translocations to the Ig V-JH region in mature B cells are byproducts of double-strand DNA breaks created by AID during SHM.

Although double-strand breaks are not obligate intermediates in SHM, a measurable fraction of all Ig hypermutations involve deletions or insertions that require repair of double-strand breaks (36, 37). A region spanning 1–2 kbp downstream of Ig VH genes undergoes somatic mutation at a rate of 10–3 per basepair per generation in germinal center B cells (for review see reference 12) (47). Given the large numbers of B cells in the germinal center and their rapid rates of division, AID-induced double-strand breaks in the Ig V-JH region are not infrequent events (3639). However, to date there has been no direct evidence for the role of AID-dependent Ig V-JH region breaks in chromosome rearrangement.

AID induces c-myc translocations to the Ig switch region by a mechanism that resembles class switching in that formation of the initial lesion requires cytidine deamination and uracil removal from DNA (25). However, resolution of the lesion proceeds by distinct pathways for switching and translocation (25). Factors that act in cis to promote switch region synapsis, such as 53BP1 and H2AX, have no impact on c-myc to Ig switch translocations despite their effects on genomic stability (25, 64). In contrast, factors that transmit damage signals to the nucleus, such as p53, do not appear to affect switching but are essential in suppressing Ig switch translocations, possibly by promoting the death of cells that overexpress c-myc (65, 66).

We have shown that mature B cells in IL-6 tg mice develop translocations involving c-myc and the Ig V-JH region and that they are AID dependent. These rearrangements closely resemble those found in endemic Burkitt's lymphoma, multiple myeloma, and diffuse large B cell lymphoma in that both of the translocated genes are hypermutated (for review see references 7 and 8). Ig V-JH regions are direct targets of AID, which is likely to produce the DNA double-strand break intermediates in the translocation reaction. Although translocated c-myc was also mutated, germline c-myc is not thought to be a target for AID (28), and c-myc mutation was substantially lower than the Ig partner. We speculate that c-myc mutation may have occurred after the translocation when it was under the control of Ig regulatory elements (28, 48, 67, 68).

The higher level of mutation we found proximal to the translocation breakpoints is analogous to what is observed for switch region junctions (69). However, the mutation breakpoints proximal to the c-myc to Ig V-JH region translocations are not RGYW hotspot biased and differ from breakpoint distal mutations in that they are not enriched for transitions. This suggests that the higher mutation frequency within 20 nts of the junction is the result of error-prone repair by nonhomologous end joining, whereas many of the mutations further away from the breakpoint are AID induced.

We conclude that translocations involving the Ig V-JH region of the Ig locus can be attributed to lesions produced by AID.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
DNA preparation and PCR.
Hyperplastic lymph nodes from individual male and female IL-6 tg (14) and AID/IL-6 tg (12) mice were combined into four pools. Total DNA was prepared from 2 x 107 cells for each pool. 0.5 x 106 cells from each of the four pools for 12 different mice was assayed for derivative 12 translocations by PCR using primer set 1 and 2.5 x 106 cells using primer set 2 (see below). For derivative 15 translocations, 0.5 x 106 cells from each of the four pools from 12 different mice was amplified using set 3 (see below).

For derivative 12 translocations from c-myc to the IgH variable region, we performed nested PCR (Long Expand PCR system; Roche) using the following primers: primer set 1: first round with 5-GCAATGACTGAAGACTCAGTCCCTCTTAAG-3 (IgH) and ACTTAGCCCTGCAGACGCCCAGGAATCGCC (c-myc), followed by nested PCR with TACCATTTGCGGTGCCTGGTTTCGGAGAGG (IgH) and TTGGCTTCAGAGGCTGAGGGAGGCGACTG (c-myc); primer set 2: first round with GTGCCCCACTCCACTCTTTGTCCCTATGC (IgH) and GAAATAAAAGGGGAGGGGGTGTCAAATAATAAGAG (c-myc), followed by nested PCR with ATCATCCAGGGACTCCACCAACACCATCAC (IgH) and CCTCCCTTCTACACTCTAAACCGCGACGCCAC (c-myc). 500 ng DNA (105 cells) was amplified in each 20 µl first-round PCR reaction; 1 µl of the first reaction was template for the nested PCR reaction. PCR conditions for the first round were 94°C for the first 2 min, followed by 10 cycles of 94°C for 30 s, 61°C for 30 s, and 68°C for 7 min, followed by 19 cycles of 94°C for 30 s, 61°C for 30 s, 68°C for 7min plus 20 s/cycle. The conditions for the nested PCR were as follows: 94°C for 15 s, 61°C for 30 s, 68°C for 4 min, followed by 15 cycles of 94°C for 30 s, 61°C for 30 s, 68°C for 4 min plus 20 s/cycle. The combined total number of cycles of amplification was 45.

Conditions for amplification of derivative 15 translocations from c-myc to the IgH variable region were the same as those for derivative 12, with the exception of a 2-min extension time in the first-round PCR and a 1-min extension time in the nested PCR. Amplification of derivative 15 translocations was performed using the following primers: primer set 3: GTTGAGACATGGGTCTGGGTCAGGGAC (IgH) and ATCAGCGGCCGCAACCCTCGCCGCCGC (c-myc), followed by a nested PCR reaction with CTCTGCCTGCTGGTCTGTGGTGACATTAG (IgH) and GAAGGCTGGATTTCCTTTGGGCGTTGG (cmyc).

For amplification of derivative 12 c-myc to switch region translocations, primers described previously (24) were used following the PCR conditions described above for primer set 1.

All animal experiments were performed in accordance with the rules and regulations of The Rockefeller University Institutional Laboratory of Animal Care and Use committee.

Southern blot analysis.
PCR products from primer set 1 were separated on 0.8% agarose gels and denatured for 15 min in 0.4 M NaOH before transfer to nylon membranes and probing with P32 radiolabeled primers. The IgH probe sequence is GGTGGCAGAAGCCACAACCATACATTCCCA, and the c-myc probe sequence is GCGCCTCGGCTCTTAGCAGACTGTAT.

Sequencing.
The PCR reactions were separated on 0.8% agarose gels, and the bands were gel extracted using the QIAGEN gel extraction kit according to the manufacturer's instructions and sent for direct sequencing. Translocations were sequenced with the nested PCR primers. If the translocation breakpoint was not identified with the first round of sequencing, we designed new primers for sequencing to walk along the translocation until we reached the breakpoint.

Sequence analysis.
PCR products were sent directly for sequencing without cloning so that we could discount the error rate of the polymerase in our analysis. Mutations that arose during early PCR cycles could be identified by chromatogram analysis by the presence of more than one base signal for the same nucleotide. Such nucleotides were discounted from our analysis. All sequenced translocations were aligned using both SeqMan from DNA Star and the Codon Code Aligner software. Overlapping traces from all the translocation sequences allowed for distinction between real mutations and single nucleotide polymorphisms. In the case of c-myc, we also amplified and sequenced the first intron from the IL-6 tg mouse to verify that the c-myc mutations identified were not single nucleotide polymorphisms.

FACS analysis.
FACS analysis was conducted as described previously (24). All antibodies were from BD Biosciences.


    Acknowledgments
 
The authors are grateful to Dr. Eva Besmer, Dr. Nina Papavasiliou, Dr. Andre Nussenzweig, and members of the Nussenzweig laboratory for suggestions.

D.F. Robbiani is a Fellow of the Leukemia and Lymphoma Society, and Y. Dorsett is a CRI predoctoral fellow. This work was supported in part by National Institutes of Health grants to M.C. Nussenzweig. M.C. Nussenzweig is a Howard Hughes Medical Institute Investigator.

The authors have no conflicting financial interests.

Submitted: 3 May 2007
Accepted: 26 July 2007


Abbreviations used: AID, activation-induced cytidine deaminase; IgH, Ig heavy chain; Ig V-JH, genomic region spanning the heavy chain V(D)J; RSS, recombination signal sequences; SHM, somatic hypermutation; tg, transgenic; V(D)J, variable, diversity, and joining.


    REFERENCES
 Top
 ABSTRACT
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

1 Zhu, C., K.D. Mills, D.O. Ferguson, C. Lee, J. Manis, J. Fleming, Y. Gao, C.C. Morton, and F.W. Alt. 2002. Unrepaired DNA breaks in p53-deficient cells lead to oncogenic gene amplification subsequent to translocations. Cell. 109:811–821.[CrossRef][Medline]

2 Difilippantonio, M.J., S. Petersen, H.T. Chen, R. Johnson, M. Jasin, R. Kanaar, T. Ried, and A. Nussenzweig. 2002. Evidence for replicative repair of DNA double-strand breaks leading to oncogenic translocation and gene amplification. J. Exp. Med. 196:469–480.[Abstract/Free Full Text]

3 Richardson, C., and M. Jasin. 2000. Frequent chromosomal translocations induced by DNA double-strand breaks. Nature. 405:697–700.[CrossRef][Medline]

4 Franco, S., F.W. Alt, and J.P. Manis. 2006. Pathways that suppress programmed DNA breaks from progressing to chromosomal breaks and translocations. DNA Repair (Amst.). 5:1030–1041.[CrossRef][Medline]

5 Schatz, D.G., M.A. Oettinger, and D. Baltimore. 1989. The V(D)J recombination activating gene, RAG-1. Cell. 59:1035–1048.[CrossRef][Medline]

6 Oettinger, M.A., D.G. Schatz, C. Gorka, and D. Baltimore. 1990. RAG-1 and RAG-2, adjacent genes that synergistically activate V(D)J recombination. Science. 248:1517–1523.[Abstract/Free Full Text]

7 Shaffer, A.L., A. Rosenwald, and L.M. Staudt. 2002. Lymphoid malignancies: the dark side of B-cell differentiation. Nat. Rev. Immunol. 2:920–932.[CrossRef][Medline]

8 Kuppers, R., and R. Dalla-Favera. 2001. Mechanisms of chromosomal translocations in B cell lymphomas. Oncogene. 20:5580–5594.[CrossRef][Medline]

9 Muramatsu, M., K. Kinoshita, S. Fagarasan, S. Yamada, Y. Shinkai, and T. Honjo. 2000. Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell. 102:553–563.[CrossRef][Medline]

10 Revy, P., T. Muto, Y. Levy, F. Geissmann, A. Plebani, O. Sanal, N. Catalan, M. Forveille, R. Dufourcq-Labelouse, A. Gennery, et al. 2000. Activation-induced cytidine deaminase (AID) deficiency causes the autosomal recessive form of the Hyper-IgM syndrome (HIGM2). Cell. 102:565–575.[CrossRef][Medline]

11 Muramatsu, M., V.S. Sankaranand, S. Anant, M. Sugai, K. Kinoshita, N.O. Davidson, and T. Honjo. 1999. Specific expression of activation-induced cytidine deaminase (AID), a novel member of the RNA-editing deaminase family in germinal center B cells. J. Biol. Chem. 274:18470–18476.[Abstract/Free Full Text]

12 Barreto, V.M., A.R. Ramiro, and M.C. Nussenzweig. 2005. Activation-induced deaminase: controversies and open questions. Trends Immunol. 26:90–96.[CrossRef][Medline]

13 Neuberger, M.S., R.S. Harris, J. Di Noia, and S.K. Petersen-Mahrt. 2003. Immunity through DNA deamination. Trends Biochem. Sci. 28:305–312.[CrossRef][Medline]

14 Honjo, T., H. Nagaoka, R. Shinkura, and M. Muramatsu. 2005. AID to overcome the limitations of genomic information. Nat. Immunol. 6:655–661.[CrossRef][Medline]

15 Adams, J.M., S. Gerondakis, E. Webb, J. Mitchell, O. Bernard, and S. Cory. 1982. Transcriptionally active DNA region that rearranges frequently in murine lymphoid tumors. Proc. Natl. Acad. Sci. USA. 79:6966–6970.[Abstract/Free Full Text]

16 Crews, S., R. Barth, L. Hood, J. Prehn, and K. Calame. 1982. Mouse c-myc oncogene is located on chromosome 15 and translocated to chromosome 12 in plasmacytomas. Science. 218:1319–1321.[Abstract/Free Full Text]

17 Dalla-Favera, R., S. Martinotti, R.C. Gallo, J. Erikson, and C.M. Croce. 1983. Translocation and rearrangements of the c-myc oncogene locus in human undifferentiated B-cell lymphomas. Science. 219:963–967.[Abstract/Free Full Text]

18 Erikson, J., A. ar-Rushdi, H.L. Drwinga, P.C. Nowell, and C.M. Croce. 1983. Transcriptional activation of the translocated c-myc oncogene in burkitt lymphoma. Proc. Natl. Acad. Sci. USA. 80:820–824.[Abstract/Free Full Text]

19 Hamlyn, P.H., and T.H. Rabbitts. 1983. Translocation joins c-myc and immunoglobulin gamma 1 genes in a Burkitt lymphoma revealing a third exon in the c-myc oncogene. Nature. 304:135–139.[CrossRef][Medline]

20 Marcu, K.B., L.J. Harris, L.W. Stanton, J. Erikson, R. Watt, and C.M. Croce. 1983. Transcriptionally active c-myc oncogene is contained within NIARD, a DNA sequence associated with chromosome translocations in B-cell neoplasia. Proc. Natl. Acad. Sci. USA. 80:519–523.[Abstract/Free Full Text]

21 Stanton, L.W., R. Watt, and K.B. Marcu. 1983. Translocation, breakage and truncated transcripts of c-myc oncogene in murine plasmacytomas. Nature. 303:401–406.[CrossRef][Medline]

22 Taub, R., I. Kirsch, C. Morton, G. Lenoir, D. Swan, S. Tronick, S. Aaronson, and P. Leder. 1982. Translocation of the c-myc gene into the immunoglobulin heavy chain locus in human Burkitt lymphoma and murine plasmacytoma cells. Proc. Natl. Acad. Sci. USA. 79:7837–7841.[Abstract/Free Full Text]

23 Petersen, S., R. Casellas, B. Reina-San-Martin, H.T. Chen, M.J. Difilippantonio, P.C. Wilson, L. Hanitsch, A. Celeste, M. Muramatsu, D.R. Pilch, et al. 2001. AID is required to initiate Nbs1/gamma-H2AX focus formation and mutations at sites of class switching. Nature. 414:660–665.[CrossRef][Medline]

24 Ramiro, A.R., M. Jankovic, T. Eisenreich, S. Difilippantonio, S. Chen-Kiang, M. Muramatsu, T. Honjo, A. Nussenzweig, and M.C. Nussenzweig. 2004. AID is required for c-myc/IgH chromosome translocations in vivo. Cell. 118:431–438.[CrossRef][Medline]

25 Ramiro, A.R., M. Jankovic, E. Callen, S. Difilippantonio, H.T. Chen, K.M. McBride, T.R. Eisenreich, J. Chen, R.A. Dickins, S.W. Lowe, et al. 2006. Role of genomic instability and p53 in AID-induced c-myc-Igh translocations. Nature. 440:105–109.[CrossRef][Medline]

26 Pasqualucci, L., P. Neumeister, T. Goossens, G. Nanjangud, R.S. Chaganti, R. Kuppers, and R. Dalla-Favera. 2001. Hypermutation of multiple proto-oncogenes in B-cell diffuse large-cell lymphomas. Nature. 412:341–346.[CrossRef][Medline]

27 Pasqualucci, L., A. Migliazza, N. Fracchiolla, C. William, A. Neri, L. Baldini, R.S. Chaganti, U. Klein, R. Kuppers, K. Rajewsky, and R. Dalla-Favera. 1998. BCL-6 mutations in normal germinal center B cells: evidence of somatic hypermutation acting outside Ig loci. Proc. Natl. Acad. Sci. USA. 95:11816–11821.[Abstract/Free Full Text]

28 Shen, H.M., A. Peters, B. Baron, X. Zhu, and U. Storb. 1998. Mutation of BCL-6 gene in normal B cells by the process of somatic hypermutation of Ig genes. Science. 280:1750–1752.[Abstract/Free Full Text]

29 Gordon, M.S., C.M. Kanegai, J.R. Doerr, and R. Wall. 2003. Somatic hypermutation of the B cell receptor genes B29 (Igbeta, CD79b) and mb1 (Igalpha, CD79a). Proc. Natl. Acad. Sci. USA. 100:4126–4131.[Abstract/Free Full Text]

30 Muschen, M., D. Re, B. Jungnickel, V. Diehl, K. Rajewsky, and R. Kuppers. 2000. Somatic mutation of the CD95 gene in human B cells as a side-effect of the germinal center reaction. J. Exp. Med. 192:1833–1840.[Abstract/Free Full Text]

31 Kotani, A., N. Kakazu, T. Tsuruyama, I.M. Okazaki, M. Muramatsu, K. Kinoshita, H. Nagaoka, D. Yabe, and T. Honjo. 2007. Activation-induced cytidine deaminase (AID) promotes B cell lymphomagenesis in Emu-cmyc transgenic mice. Proc. Natl. Acad. Sci. USA. 104:1616–1620.[Abstract/Free Full Text]

32 Okazaki, I.M., H. Hiai, N. Kakazu, S. Yamada, M. Muramatsu, K. Kinoshita, and T. Honjo. 2003. Constitutive expression of AID leads to tumorigenesis. J. Exp. Med. 197:1173–1181.[Abstract/Free Full Text]

33 Matsumoto, Y., H. Marusawa, K. Kinoshita, Y. Endo, T. Kou, T. Morisawa, T. Azuma, I.M. Okazaki, T. Honjo, and T. Chiba. 2007. Helicobacter pylori infection triggers aberrant expression of activation-induced cytidine deaminase in gastric epithelium. Nat. Med. 13:470–476.[CrossRef][Medline]

34 Endo, Y., H. Marusawa, K. Kinoshita, T. Morisawa, T. Sakurai, I.M. Okazaki, K. Watashi, K. Shimotohno, T. Honjo, and T. Chiba. 2007. Expression of activation-induced cytidine deaminase in human hepatocytes via NF-kappaB signaling. Oncogene. In press.

35 Petersen-Mahrt, S.K., R.S. Harris, and M.S. Neuberger. 2002. AID mutates E. coli suggesting a DNA deamination mechanism for antibody diversification. Nature. 418:99–103.[Medline]

36 Goossens, T., U. Klein, and R. Kuppers. 1998. Frequent occurrence of deletions and duplications during somatic hypermutation: implications for oncogene translocations and heavy chain disease. Proc. Natl. Acad. Sci. USA. 95:2463–2468.[Abstract/Free Full Text]

37 Wilson, P.C., O. de Bouteiller, Y.J. Liu, K. Potter, J. Banchereau, J.D. Capra, and V. Pascual. 1998. Somatic hypermutation introduces insertions and deletions into immunoglobulin V genes. J. Exp. Med. 187:59–70.[Abstract/Free Full Text]

38 Sale, J.E., and M.S. Neuberger. 1998. TdT-accessible breaks are scattered over the immunoglobulin V domain in a constitutively hypermutating B cell line. Immunity. 9:859–869.[CrossRef][Medline]

39 Papavasiliou, F.N., and D.G. Schatz. 2000. Cell-cycle-regulated DNA double-stranded breaks in somatic hypermutation of immunoglobulin genes. Nature. 408:216–221.[CrossRef][Medline]

40 Bross, L., M. Muramatsu, K. Kinoshita, T. Honjo, and H. Jacobs. 2002. DNA double-strand breaks: prior to but not sufficient in targeting hypermutation. J. Exp. Med. 195:1187–1192.[Abstract/Free Full Text]

41 Papavasiliou, F.N., and D.G. Schatz. 2002. The activation-induced deaminase functions in a postcleavage step of the somatic hypermutation process. J. Exp. Med. 195:1193–1198.[Abstract/Free Full Text]

42 Bross, L., and H. Jacobs. 2003. DNA double strand breaks occur independent of AID in hypermutating Ig genes. Clin. Dev. Immunol. 10:83–89.[CrossRef][Medline]

43 Bergsagel, P.L., and W.M. Kuehl. 2001. Chromosome translocations in multiple myeloma. Oncogene. 20:5611–5622.[CrossRef][Medline]

44 Yu, W., H. Nagaoka, M. Jankovic, Z. Misulovin, H. Suh, A. Rolink, F. Melchers, E. Meffre, and M.C. Nussenzweig. 1999. Continued RAG expression in late stages of B cell development and no apparent re-induction after immunization. Nature. 400:682–687.[CrossRef][Medline]

45 Suematsu, S., T. Matsusaka, T. Matsuda, S. Ohno, J. Miyazaki, K. Yamamura, T. Hirano, and T. Kishimoto. 1992. Generation of plasmacytomas with the chromosomal translocation t(12;15) in interleukin 6 transgenic mice. Proc. Natl. Acad. Sci. USA. 89:232–235.[Abstract/Free Full Text]

46 Kovalchuk, A.L., J.S. Kim, S.S. Park, A.E. Coleman, J.M. Ward, H.C. Morse III, T. Kishimoto, M. Potter, and S. Janz. 2002. IL-6 transgenic mouse model for extraosseous plasmacytoma. Proc. Natl. Acad. Sci. USA. 99:1509–1514.[Abstract/Free Full Text]

47 McKean, D., K. Huppi, M. Bell, L. Staudt, W. Gerhard, and M. Weigert. 1984. Generation of antibody diversity in the immune response of BALB/c mice to influenza virus hemagglutinin. Proc. Natl. Acad. Sci. USA. 81:3180–3184.[Abstract/Free Full Text]

48 Bemark, M., and M.S. Neuberger. 2000. The c-MYC allele that is translocated into the IgH locus undergoes constitutive hypermutation in a Burkitt's lymphoma line. Oncogene. 19:3404–3410.[CrossRef][Medline]

49 Difilippantonio, M.J., J. Zhu, H.T. Chen, E. Meffre, M.C. Nussenzweig, E.E. Max, T. Ried, and A. Nussenzweig. 2000. DNA repair protein Ku80 suppresses chromosomal aberrations and malignant transformation. Nature. 404:510–514.[CrossRef][Medline]

50 Gao, Y., D.O. Ferguson, W. Xie, J.P. Manis, J. Sekiguchi, K.M. Frank, J. Chaudhuri, J. Horner, R.A. DePinho, and F.W. Alt. 2000. Interplay of p53 and DNA-repair protein XRCC4 in tumorigenesis, genomic stability and development. Nature. 404:897–900.[CrossRef][Medline]

51 Liao, M.J., and T. Van Dyke. 1999. Critical role for Atm in suppressing V(D)J recombination-driven thymic lymphoma. Genes Dev. 13:1246–1250.[Abstract/Free Full Text]

52 Gladdy, R.A., M.D. Taylor, C.J. Williams, I. Grandal, J. Karaskova, J.A. Squire, J.T. Rutka, C.J. Guidos, and J.S. Danska. 2003. The RAG-1/2 endonuclease causes genomic instability and controls CNS complications of lymphoblastic leukemia in p53/Prkdc-deficient mice. Cancer Cell. 3:37–50.[CrossRef][Medline]

53 Petiniot, L.K., Z. Weaver, M. Vacchio, R. Shen, D. Wangsa, C. Barlow, M. Eckhaus, S.M. Steinberg, A. Wynshaw-Boris, T. Ried, and R.J. Hodes. 2002. RAG-mediated V(D)J recombination is not essential for tumorigenesis in Atm-deficient mice. Mol. Cell. Biol. 22:3174–3177.[Abstract/Free Full Text]

54 Borghesani, P.R., F.W. Alt, A. Bottaro, L. Davidson, S. Aksoy, G.A. Rathbun, T.M. Roberts, W. Swat, R.A. Segal, and Y. Gu. 2000. Abnormal development of Purkinje cells and lymphocytes in Atm mutant mice. Proc. Natl. Acad. Sci. USA. 97:3336–3341.[Abstract/Free Full Text]

55 Elson, A., Y. Wang, C.J. Daugherty, C.C. Morton, F. Zhou, J. Campos-Torres, and P. Leder. 1996. Pleiotropic defects in ataxia-telangiectasia protein-deficient mice. Proc. Natl. Acad. Sci. USA. 93:13084–13089.[Abstract/Free Full Text]

56 Xu, Y., T. Ashley, E.E. Brainerd, R.T. Bronson, M.S. Meyn, and D. Baltimore. 1996. Targeted disruption of ATM leads to growth retardation, chromosomal fragmentation during meiosis, immune defects, and thymic lymphoma. Genes Dev. 10:2411–2422.[Abstract/Free Full Text]

57 Barlow, C., S. Hirotsune, R. Paylor, M. Liyanage, M. Eckhaus, F. Collins, Y. Shiloh, J.N. Crawley, T. Ried, D. Tagle, and A. Wynshaw-Boris. 1996. Atm-deficient mice: a paradigm of ataxia telangiectasia. Cell. 86:159–171.[CrossRef][Medline]

58 Liyanage, M., Z. Weaver, C. Barlow, A. Coleman, D.G. Pankratz, S. Anderson, A. Wynshaw-Boris, and T. Ried. 2000. Abnormal rearrangement within the alpha/delta T-cell receptor locus in lymphomas from Atm-deficient mice. Blood. 96:1940–1946.[Abstract/Free Full Text]

59 Guidos, C.J., C.J. Williams, I. Grandal, G. Knowles, M.T. Huang, and J.S. Danska. 1996. V(D)J recombination activates a p53-dependent DNA damage checkpoint in scid lymphocyte precursors. Genes Dev. 10:2038–2054.[Abstract/Free Full Text]

60 Nacht, M., A. Strasser, Y.R. Chan, A.W. Harris, M. Schlissel, R.T. Bronson, and T. Jacks. 1996. Mutations in the p53 and SCID genes cooperate in tumorigenesis. Genes Dev. 10:2055–2066.[Abstract/Free Full Text]

61 Vanasse, G.J., J. Halbrook, S. Thomas, A. Burgess, M.F. Hoekstra, C.M. Disteche, and D.M. Willerford. 1999. Genetic pathway to recurrent chromosome translocations in murine lymphoma involves V(D)J recombinase. J. Clin. Invest. 103:1669–1675.[Medline]

62 Celeste, A., S. Petersen, P.J. Romanienko, O. Fernandez-Capetillo, H.T. Chen, O.A. Sedelnikova, B. Reina-San-Martin, V. Coppola, E. Meffre, M.J. Difilippantonio, et al. 2002. Genomic instability in mice lacking histone H2AX. Science. 296:922–927.[Abstract/Free Full Text]

63 Bassing, C.H., H. Suh, D.O. Ferguson, K.F. Chua, J. Manis, M. Eckersdorff, M. Gleason, R. Bronson, C. Lee, and F.W. Alt. 2003. Histone H2AX: a dosage-dependent suppressor of oncogenic translocations and tumors. Cell. 114:359–370.[CrossRef][Medline]

64 Franco, S., M. Gostissa, S. Zha, D.B. Lombard, M.M. Murphy, A.A. Zarrin, C. Yan, S. Tepsuporn, J.C. Morales, M.M. Adams, et al. 2006. H2AX prevents DNA breaks from progressing to chromosome breaks and translocations. Mol. Cell. 21:201–214.[CrossRef][Medline]

65 Bartkova, J., N. Rezaei, M. Liontos, P. Karakaidos, D. Kletsas, N. Issaeva, L.V. Vassiliou, E. Kolettas, K. Niforou, V.C. Zoumpourlis, et al. 2006. Oncogene-induced senescence is part of the tumorigenesis barrier imposed by DNA damage checkpoints. Nature. 444:633–637.[CrossRef][Medline]

66 Christophorou, M.A., I. Ringshausen, A.J. Finch, L.B. Swigart, and G.I. Evan. 2006. The pathological response to DNA damage does not contribute to p53-mediated tumour suppression. Nature. 443:214–217.[CrossRef][Medline]

67 Rabbitts, T.H., A. Forster, P. Hamlyn, and R. Baer. 1984. Effect of somatic mutation within translocated c-myc genes in Burkitt's lymphoma. Nature. 309:592–597.[CrossRef][Medline]

68 Taub, R., C. Moulding, J. Battey, W. Murphy, T. Vasicek, G.M. Lenoir, and P. Leder. 1984. Activation and somatic mutation of the translocated c-myc gene in burkitt lymphoma cells. Cell. 36:339–348.[CrossRef][Medline]

69 Schrader, C.E., S.P. Bradley, J. Vardo, S.N. Mochegova, E. Flanagan, and J. Stavnezer. 2003. Mutations occur in the Ig Smu region but rarely in Sgamma regions prior to class switch recombination. EMBO J. 22:5893–5903.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 2613K)
Right arrow PPT slides of all figures
Right arrow Correction (v204,p2491)
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dorsett, Y.
Right arrow Articles by Nussenzweig, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dorsett, Y.
Right arrow Articles by Nussenzweig, M. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


  Home | Help | Feedback | Subscriptions | Archive | Search
TABLE OF CONTENTS