|
||
Article |
CORRESPONDENCE Michel C. Nussenzweig: nussen{at}rockefeller.edu
|
|
|---|
Chromosome translocations are products of unresolved double-strand DNA breaks (1–4) and therefore occur frequently at Ig genes because these loci undergo programmed DNA damage during antigen receptor gene diversification. In developing T and B cells, RAG1 and RAG2 proteins produce double-strand breaks at recombination signal sequences (RSS) found adjacent to variable, diversity, and joining (V(D)J) gene segments (5, 6). These RSS are found in close proximity or within translocation breakpoints in numerous B cell lymphomas (for review see references 7 and 8).
In mature B cells, expression of activation-induced cytidine deaminase (AID) (9–11) leads to deamination of cytidine residues in Ig V-JH and Ig switch regions resulting in U:G mismatches that are processed to produce somatic hypermutations (SHMs) and initiate class switch recombination (for review see references 12–14). Double-strand breaks are obligate intermediates in the class switch reaction, and translocations involving switch regions are frequently found in sporadic Burkitt's lymphoma, diffuse large B cell lymphoma, and multiple myeloma, suggesting that AID is responsible for the lesions that lead to such translocations (15–22). Consistent with this idea, AID-induced breaks in the switch region activate the cellular DNA damage response machinery (23), and AID is essential for c-myc translocations to the Ig switch region in IL-6 transgenic (tg) (24, 25). In addition, AID appears to target several oncogenes that are frequently mutated and often translocated to antibody genes in mature B cell malignancies (26–30). In agreement with these observations, deregulated expression of AID is associated with malignancy (31–34).
Double-strand breaks are not obligate intermediates in SHM of the Ig V-JH (35). Nevertheless, duplications or deletions that would necessitate a double-strand break make up 6% of all the Ig V-JH region–associated somatic mutations, and DNA breaks can be detected in this region in B cells undergoing mutation (36–42). In addition, endemic Burkitt's lymphoma, multiple myeloma, follicular lymphoma, and diffuse large B cell lymphoma contain mutated V genes as well as translocations to the Ig V-JH or Ig V-JL regions (for review see references 7, 8, and 43). This suggests that translocations in these malignancies may have occurred in mature B cells that express AID but not RAG1/2 (44), and that some Ig V-JH region–associated translocations are byproducts of lesions induced by AID during hypermutation. To ascertain the extent to which AID contributes to genomic instability at the IgH locus, we tested if AID is required for translocations between c-myc and the Ig V-JH region in IL-6 tg mice.
![]()
RESULTS
Top
ABSTRACT
RESULTS
DISCUSSION
MATERIALS AND METHODS
REFERENCES
IL-6 tg mice develop hyperplastic lymph nodes that contain large numbers of class-switched plasmacytes, a portion of which express GL7 and CD138 (24, 45, 46). Plasmacytosis is believed to develop in these mice because IL-6 attenuates apoptosis and promotes proliferation and differentiation of late-stage B cells, allowing for the accumulation of translocations between IgH and c-myc (45). Although a majority of the c-myc translocation breakpoints are at the Ig switch region, a small fraction occur at the V-JH region (46) and therefore resemble the translocations found in endemic Burkitt's lymphoma (for review see references 7 and 8). To determine whether AID is required for translocations between the Ig V-JH region and c-myc, we generated AID-deficient IL-6 tg mice (AID–/–IL-6 tg) by breeding (24). AID–/–IL-6 tg mice developed lymph node hyperplasia and plasmacytosis with a slightly delayed onset compared with IL-6 tg mice, and there was no detectable class switching in the AID–/–IL-6 tg mice (Fig. 1, A and B) (24).
|
|
|
|
|
0.6 x 10–3 mutations per basepair (Fig. 4).
This rate of mutation is similar to that reported for the Ig V-JH region in B cells undergoing hypermutation (47). Derivative 12 and 15 IgH sequences had a similar frequency of hypermutation, suggesting that SHM must have occurred before or during translocation. Interestingly, the overall position of the mutations mirrored the positions of the translocation breakpoints (compare Figs. 3 and Figs.4), supporting the idea that regions prone to SHM are susceptible to translocations. Excluding nucleotide insertions at the breakpoint, the rate of mutation within 20 bp of either side of the translocation breakpoints was almost 10-fold higher (5.4 x 10–3) than that seen overall for IgH in our translocations. This implies that c-myc/IgH translocations are resolved through error-prone repair, or that translocation breakpoints occur at or immediately adjacent to hypermutated sequences. Discounting mutations within 20 bp of the breakpoint, we identified three mutations in c-myc, resulting in a mutation rate that is above background (
0.2 x 10–3) but approximately threefold lower than the rate observed for IgH (Fig. 4). These results suggest that c-myc translocations to the Ig V-JH region in IL-6 tg mice occur during or after Ig V-JH region SHM (28, 47, 48).
|
| DISCUSSION |
|---|
|
|
|---|
However, some translocation breakpoints in proximity of RSS are found in mature B cell tumors, such as endemic Burkitt's lymphoma, diffuse large B cell lymphoma, and multiple myeloma (for review see references 7, 8, and 43). These translocations are believed to arise during or after the germinal center reaction because the Ig genes involved in the translocations are usually somatically mutated (7). Nevertheless, they could be mediated by V(D)J recombination if RAG1/2 were reexpressed in the germinal center. An alternative possibility is that the translocations to the Ig V-JH region in mature B cells are byproducts of double-strand DNA breaks created by AID during SHM.
Although double-strand breaks are not obligate intermediates in SHM, a measurable fraction of all Ig hypermutations involve deletions or insertions that require repair of double-strand breaks (36, 37). A region spanning 1–2 kbp downstream of Ig VH genes undergoes somatic mutation at a rate of 10–3 per basepair per generation in germinal center B cells (for review see reference 12) (47). Given the large numbers of B cells in the germinal center and their rapid rates of division, AID-induced double-strand breaks in the Ig V-JH region are not infrequent events (36–39). However, to date there has been no direct evidence for the role of AID-dependent Ig V-JH region breaks in chromosome rearrangement.
AID induces c-myc translocations to the Ig switch region by a mechanism that resembles class switching in that formation of the initial lesion requires cytidine deamination and uracil removal from DNA (25). However, resolution of the lesion proceeds by distinct pathways for switching and translocation (25). Factors that act in cis to promote switch region synapsis, such as 53BP1 and H2AX, have no impact on c-myc to Ig switch translocations despite their effects on genomic stability (25, 64). In contrast, factors that transmit damage signals to the nucleus, such as p53, do not appear to affect switching but are essential in suppressing Ig switch translocations, possibly by promoting the death of cells that overexpress c-myc (65, 66).
We have shown that mature B cells in IL-6 tg mice develop translocations involving c-myc and the Ig V-JH region and that they are AID dependent. These rearrangements closely resemble those found in endemic Burkitt's lymphoma, multiple myeloma, and diffuse large B cell lymphoma in that both of the translocated genes are hypermutated (for review see references 7 and 8). Ig V-JH regions are direct targets of AID, which is likely to produce the DNA double-strand break intermediates in the translocation reaction. Although translocated c-myc was also mutated, germline c-myc is not thought to be a target for AID (28), and c-myc mutation was substantially lower than the Ig partner. We speculate that c-myc mutation may have occurred after the translocation when it was under the control of Ig regulatory elements (28, 48, 67, 68).
The higher level of mutation we found proximal to the translocation breakpoints is analogous to what is observed for switch region junctions (69). However, the mutation breakpoints proximal to the c-myc to Ig V-JH region translocations are not RGYW hotspot biased and differ from breakpoint distal mutations in that they are not enriched for transitions. This suggests that the higher mutation frequency within 20 nts of the junction is the result of error-prone repair by nonhomologous end joining, whereas many of the mutations further away from the breakpoint are AID induced.
We conclude that translocations involving the Ig V-JH region of the Ig locus can be attributed to lesions produced by AID.
| MATERIALS AND METHODS |
|---|
|
|
|---|
For derivative 12 translocations from c-myc to the IgH variable region, we performed nested PCR (Long Expand PCR system; Roche) using the following primers: primer set 1: first round with 5-GCAATGACTGAAGACTCAGTCCCTCTTAAG-3 (IgH) and ACTTAGCCCTGCAGACGCCCAGGAATCGCC (c-myc), followed by nested PCR with TACCATTTGCGGTGCCTGGTTTCGGAGAGG (IgH) and TTGGCTTCAGAGGCTGAGGGAGGCGACTG (c-myc); primer set 2: first round with GTGCCCCACTCCACTCTTTGTCCCTATGC (IgH) and GAAATAAAAGGGGAGGGGGTGTCAAATAATAAGAG (c-myc), followed by nested PCR with ATCATCCAGGGACTCCACCAACACCATCAC (IgH) and CCTCCCTTCTACACTCTAAACCGCGACGCCAC (c-myc). 500 ng DNA (105 cells) was amplified in each 20 µl first-round PCR reaction; 1 µl of the first reaction was template for the nested PCR reaction. PCR conditions for the first round were 94°C for the first 2 min, followed by 10 cycles of 94°C for 30 s, 61°C for 30 s, and 68°C for 7 min, followed by 19 cycles of 94°C for 30 s, 61°C for 30 s, 68°C for 7min plus 20 s/cycle. The conditions for the nested PCR were as follows: 94°C for 15 s, 61°C for 30 s, 68°C for 4 min, followed by 15 cycles of 94°C for 30 s, 61°C for 30 s, 68°C for 4 min plus 20 s/cycle. The combined total number of cycles of amplification was 45.
Conditions for amplification of derivative 15 translocations from c-myc to the IgH variable region were the same as those for derivative 12, with the exception of a 2-min extension time in the first-round PCR and a 1-min extension time in the nested PCR. Amplification of derivative 15 translocations was performed using the following primers: primer set 3: GTTGAGACATGGGTCTGGGTCAGGGAC (IgH) and ATCAGCGGCCGCAACCCTCGCCGCCGC (c-myc), followed by a nested PCR reaction with CTCTGCCTGCTGGTCTGTGGTGACATTAG (IgH) and GAAGGCTGGATTTCCTTTGGGCGTTGG (cmyc).
For amplification of derivative 12 c-myc to switch region translocations, primers described previously (24) were used following the PCR conditions described above for primer set 1.
All animal experiments were performed in accordance with the rules and regulations of The Rockefeller University Institutional Laboratory of Animal Care and Use committee.
Southern blot analysis.
PCR products from primer set 1 were separated on 0.8% agarose gels and denatured for 15 min in 0.4 M NaOH before transfer to nylon membranes and probing with P32 radiolabeled primers. The IgH probe sequence is GGTGGCAGAAGCCACAACCATACATTCCCA, and the c-myc probe sequence is GCGCCTCGGCTCTTAGCAGACTGTAT.
Sequencing.
The PCR reactions were separated on 0.8% agarose gels, and the bands were gel extracted using the QIAGEN gel extraction kit according to the manufacturer's instructions and sent for direct sequencing. Translocations were sequenced with the nested PCR primers. If the translocation breakpoint was not identified with the first round of sequencing, we designed new primers for sequencing to walk along the translocation until we reached the breakpoint.
Sequence analysis.
PCR products were sent directly for sequencing without cloning so that we could discount the error rate of the polymerase in our analysis. Mutations that arose during early PCR cycles could be identified by chromatogram analysis by the presence of more than one base signal for the same nucleotide. Such nucleotides were discounted from our analysis. All sequenced translocations were aligned using both SeqMan from DNA Star and the Codon Code Aligner software. Overlapping traces from all the translocation sequences allowed for distinction between real mutations and single nucleotide polymorphisms. In the case of c-myc, we also amplified and sequenced the first intron from the IL-6 tg mouse to verify that the c-myc mutations identified were not single nucleotide polymorphisms.
FACS analysis.
FACS analysis was conducted as described previously (24). All antibodies were from BD Biosciences.
| Acknowledgments |
|---|
D.F. Robbiani is a Fellow of the Leukemia and Lymphoma Society, and Y. Dorsett is a CRI predoctoral fellow. This work was supported in part by National Institutes of Health grants to M.C. Nussenzweig. M.C. Nussenzweig is a Howard Hughes Medical Institute Investigator.
The authors have no conflicting financial interests.
Submitted: 3 May 2007
Accepted: 26 July 2007
| REFERENCES |
|---|
|
|
|---|
1 Zhu, C., K.D. Mills, D.O. Ferguson, C. Lee, J. Manis, J. Fleming, Y. Gao, C.C. Morton, and F.W. Alt. 2002. Unrepaired DNA breaks in p53-deficient cells lead to oncogenic gene amplification subsequent to translocations. Cell. 109:811–821.[CrossRef][Medline]
2 Difilippantonio, M.J., S. Petersen, H.T. Chen, R. Johnson, M. Jasin, R. Kanaar, T. Ried, and A. Nussenzweig. 2002. Evidence for replicative repair of DNA double-strand breaks leading to oncogenic translocation and gene amplification. J. Exp. Med. 196:469–480.
3 Richardson, C., and M. Jasin. 2000. Frequent chromosomal translocations induced by DNA double-strand breaks. Nature. 405:697–700.[CrossRef][Medline]
4 Franco, S., F.W. Alt, and J.P. Manis. 2006. Pathways that suppress programmed DNA breaks from progressing to chromosomal breaks and translocations. DNA Repair (Amst.). 5:1030–1041.[CrossRef][Medline]
5 Schatz, D.G., M.A. Oettinger, and D. Baltimore. 1989. The V(D)J recombination activating gene, RAG-1. Cell. 59:1035–1048.[CrossRef][Medline]
6 Oettinger, M.A., D.G. Schatz, C. Gorka, and D. Baltimore. 1990. RAG-1 and RAG-2, adjacent genes that synergistically activate V(D)J recombination. Science. 248:1517–1523.
7 Shaffer, A.L., A. Rosenwald, and L.M. Staudt. 2002. Lymphoid malignancies: the dark side of B-cell differentiation. Nat. Rev. Immunol. 2:920–932.[CrossRef][Medline]
8 Kuppers, R., and R. Dalla-Favera. 2001. Mechanisms of chromosomal translocations in B cell lymphomas. Oncogene. 20:5580–5594.[CrossRef][Medline]
9 Muramatsu, M., K. Kinoshita, S. Fagarasan, S. Yamada, Y. Shinkai, and T. Honjo. 2000. Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell. 102:553–563.[CrossRef][Medline]
10 Revy, P., T. Muto, Y. Levy, F. Geissmann, A. Plebani, O. Sanal, N. Catalan, M. Forveille, R. Dufourcq-Labelouse, A. Gennery, et al. 2000. Activation-induced cytidine deaminase (AID) deficiency causes the autosomal recessive form of the Hyper-IgM syndrome (HIGM2). Cell. 102:565–575.[CrossRef][Medline]
11 Muramatsu, M., V.S. Sankaranand, S. Anant, M. Sugai, K. Kinoshita, N.O. Davidson, and T. Honjo. 1999. Specific expression of activation-induced cytidine deaminase (AID), a novel member of the RNA-editing deaminase family in germinal center B cells. J. Biol. Chem. 274:18470–18476.
12 Barreto, V.M., A.R. Ramiro, and M.C. Nussenzweig. 2005. Activation-induced deaminase: controversies and open questions. Trends Immunol. 26:90–96.[CrossRef][Medline]
13 Neuberger, M.S., R.S. Harris, J. Di Noia, and S.K. Petersen-Mahrt. 2003. Immunity through DNA deamination. Trends Biochem. Sci. 28:305–312.[CrossRef][Medline]
14 Honjo, T., H. Nagaoka, R. Shinkura, and M. Muramatsu. 2005. AID to overcome the limitations of genomic information. Nat. Immunol. 6:655–661.[CrossRef][Medline]
15 Adams, J.M., S. Gerondakis, E. Webb, J. Mitchell, O. Bernard, and S. Cory. 1982. Transcriptionally active DNA region that rearranges frequently in murine lymphoid tumors. Proc. Natl. Acad. Sci. USA. 79:6966–6970.
16 Crews, S., R. Barth, L. Hood, J. Prehn, and K. Calame. 1982. Mouse c-myc oncogene is located on chromosome 15 and translocated to chromosome 12 in plasmacytomas. Science. 218:1319–1321.
17 Dalla-Favera, R., S. Martinotti, R.C. Gallo, J. Erikson, and C.M. Croce. 1983. Translocation and rearrangements of the c-myc oncogene locus in human undifferentiated B-cell lymphomas. Science. 219:963–967.
18 Erikson, J., A. ar-Rushdi, H.L. Drwinga, P.C. Nowell, and C.M. Croce. 1983. Transcriptional activation of the translocated c-myc oncogene in burkitt lymphoma. Proc. Natl. Acad. Sci. USA. 80:820–824.
19 Hamlyn, P.H., and T.H. Rabbitts. 1983. Translocation joins c-myc and immunoglobulin gamma 1 genes in a Burkitt lymphoma revealing a third exon in the c-myc oncogene. Nature. 304:135–139.[CrossRef][Medline]
20 Marcu, K.B., L.J. Harris, L.W. Stanton, J. Erikson, R. Watt, and C.M. Croce. 1983. Transcriptionally active c-myc oncogene is contained within NIARD, a DNA sequence associated with chromosome translocations in B-cell neoplasia. Proc. Natl. Acad. Sci. USA. 80:519–523.
21 Stanton, L.W., R. Watt, and K.B. Marcu. 1983. Translocation, breakage and truncated transcripts of c-myc oncogene in murine plasmacytomas. Nature. 303:401–406.[CrossRef][Medline]
22 Taub, R., I. Kirsch, C. Morton, G. Lenoir, D. Swan, S. Tronick, S. Aaronson, and P. Leder. 1982. Translocation of the c-myc gene into the immunoglobulin heavy chain locus in human Burkitt lymphoma and murine plasmacytoma cells. Proc. Natl. Acad. Sci. USA. 79:7837–7841.
23 Petersen, S., R. Casellas, B. Reina-San-Martin, H.T. Chen, M.J. Difilippantonio, P.C. Wilson, L. Hanitsch, A. Celeste, M. Muramatsu, D.R. Pilch, et al. 2001. AID is required to initiate Nbs1/gamma-H2AX focus formation and mutations at sites of class switching. Nature. 414:660–665.[CrossRef][Medline]
24 Ramiro, A.R., M. Jankovic, T. Eisenreich, S. Difilippantonio, S. Chen-Kiang, M. Muramatsu, T. Honjo, A. Nussenzweig, and M.C. Nussenzweig. 2004. AID is required for c-myc/IgH chromosome translocations in vivo. Cell. 118:431–438.[CrossRef][Medline]
25 Ramiro, A.R., M. Jankovic, E. Callen, S. Difilippantonio, H.T. Chen, K.M. McBride, T.R. Eisenreich, J. Chen, R.A. Dickins, S.W. Lowe, et al. 2006. Role of genomic instability and p53 in AID-induced c-myc-Igh translocations. Nature. 440:105–109.[CrossRef][Medline]
26 Pasqualucci, L., P. Neumeister, T. Goossens, G. Nanjangud, R.S. Chaganti, R. Kuppers, and R. Dalla-Favera. 2001. Hypermutation of multiple proto-oncogenes in B-cell diffuse large-cell lymphomas. Nature. 412:341–346.[CrossRef][Medline]
27 Pasqualucci, L., A. Migliazza, N. Fracchiolla, C. William, A. Neri, L. Baldini, R.S. Chaganti, U. Klein, R. Kuppers, K. Rajewsky, and R. Dalla-Favera. 1998. BCL-6 mutations in normal germinal center B cells: evidence of somatic hypermutation acting outside Ig loci. Proc. Natl. Acad. Sci. USA. 95:11816–11821.
28 Shen, H.M., A. Peters, B. Baron, X. Zhu, and U. Storb. 1998. Mutation of BCL-6 gene in normal B cells by the process of somatic hypermutation of Ig genes. Science. 280:1750–1752.
29 Gordon, M.S., C.M. Kanegai, J.R. Doerr, and R. Wall. 2003. Somatic hypermutation of the B cell receptor genes B29 (Igbeta, CD79b) and mb1 (Igalpha, CD79a). Proc. Natl. Acad. Sci. USA. 100:4126–4131.
30 Muschen, M., D. Re, B. Jungnickel, V. Diehl, K. Rajewsky, and R. Kuppers. 2000. Somatic mutation of the CD95 gene in human B cells as a side-effect of the germinal center reaction. J. Exp. Med. 192:1833–1840.
31 Kotani, A., N. Kakazu, T. Tsuruyama, I.M. Okazaki, M. Muramatsu, K. Kinoshita, H. Nagaoka, D. Yabe, and T. Honjo. 2007. Activation-induced cytidine deaminase (AID) promotes B cell lymphomagenesis in Emu-cmyc transgenic mice. Proc. Natl. Acad. Sci. USA. 104:1616–1620.
32 Okazaki, I.M., H. Hiai, N. Kakazu, S. Yamada, M. Muramatsu, K. Kinoshita, and T. Honjo. 2003. Constitutive expression of AID leads to tumorigenesis. J. Exp. Med. 197:1173–1181.
33 Matsumoto, Y., H. Marusawa, K. Kinoshita, Y. Endo, T. Kou, T. Morisawa, T. Azuma, I.M. Okazaki, T. Honjo, and T. Chiba. 2007. Helicobacter pylori infection triggers aberrant expression of activation-induced cytidine deaminase in gastric epithelium. Nat. Med. 13:470–476.[CrossRef][Medline]
34 Endo, Y., H. Marusawa, K. Kinoshita, T. Morisawa, T. Sakurai, I.M. Okazaki, K. Watashi, K. Shimotohno, T. Honjo, and T. Chiba. 2007. Expression of activation-induced cytidine deaminase in human hepatocytes via NF-kappaB signaling. Oncogene. In press.
35 Petersen-Mahrt, S.K., R.S. Harris, and M.S. Neuberger. 2002. AID mutates E. coli suggesting a DNA deamination mechanism for antibody diversification. Nature. 418:99–103.[Medline]
36 Goossens, T., U. Klein, and R. Kuppers. 1998. Frequent occurrence of deletions and duplications during somatic hypermutation: implications for oncogene translocations and heavy chain disease. Proc. Natl. Acad. Sci. USA. 95:2463–2468.
37 Wilson, P.C., O. de Bouteiller, Y.J. Liu, K. Potter, J. Banchereau, J.D. Capra, and V. Pascual. 1998. Somatic hypermutation introduces insertions and deletions into immunoglobulin V genes. J. Exp. Med. 187:59–70.
38 Sale, J.E., and M.S. Neuberger. 1998. TdT-accessible breaks are scattered over the immunoglobulin V domain in a constitutively hypermutating B cell line. Immunity. 9:859–869.[CrossRef][Medline]
39 Papavasiliou, F.N., and D.G. Schatz. 2000. Cell-cycle-regulated DNA double-stranded breaks in somatic hypermutation of immunoglobulin genes. Nature. 408:216–221.[CrossRef][Medline]
40 Bross, L., M. Muramatsu, K. Kinoshita, T. Honjo, and H. Jacobs. 2002. DNA double-strand breaks: prior to but not sufficient in targeting hypermutation. J. Exp. Med. 195:1187–1192.
41 Papavasiliou, F.N., and D.G. Schatz. 2002. The activation-induced deaminase functions in a postcleavage step of the somatic hypermutation process. J. Exp. Med. 195:1193–1198.
42 Bross, L., and H. Jacobs. 2003. DNA double strand breaks occur independent of AID in hypermutating Ig genes. Clin. Dev. Immunol. 10:83–89.[CrossRef][Medline]
43 Bergsagel, P.L., and W.M. Kuehl. 2001. Chromosome translocations in multiple myeloma. Oncogene. 20:5611–5622.[CrossRef][Medline]
44 Yu, W., H. Nagaoka, M. Jankovic, Z. Misulovin, H. Suh, A. Rolink, F. Melchers, E. Meffre, and M.C. Nussenzweig. 1999. Continued RAG expression in late stages of B cell development and no apparent re-induction after immunization. Nature. 400:682–687.[CrossRef][Medline]
45 Suematsu, S., T. Matsusaka, T. Matsuda, S. Ohno, J. Miyazaki, K. Yamamura, T. Hirano, and T. Kishimoto. 1992. Generation of plasmacytomas with the chromosomal translocation t(12;15) in interleukin 6 transgenic mice. Proc. Natl. Acad. Sci. USA. 89:232–235.
46 Kovalchuk, A.L., J.S. Kim, S.S. Park, A.E. Coleman, J.M. Ward, H.C. Morse III, T. Kishimoto, M. Potter, and S. Janz. 2002. IL-6 transgenic mouse model for extraosseous plasmacytoma. Proc. Natl. Acad. Sci. USA. 99:1509–1514.
47 McKean, D., K. Huppi, M. Bell, L. Staudt, W. Gerhard, and M. Weigert. 1984. Generation of antibody diversity in the immune response of BALB/c mice to influenza virus hemagglutinin. Proc. Natl. Acad. Sci. USA. 81:3180–3184.
48 Bemark, M., and M.S. Neuberger. 2000. The c-MYC allele that is translocated into the IgH locus undergoes constitutive hypermutation in a Burkitt's lymphoma line. Oncogene. 19:3404–3410.[CrossRef][Medline]
49 Difilippantonio, M.J., J. Zhu, H.T. Chen, E. Meffre, M.C. Nussenzweig, E.E. Max, T. Ried, and A. Nussenzweig. 2000. DNA repair protein Ku80 suppresses chromosomal aberrations and malignant transformation. Nature. 404:510–514.[CrossRef][Medline]
50 Gao, Y., D.O. Ferguson, W. Xie, J.P. Manis, J. Sekiguchi, K.M. Frank, J. Chaudhuri, J. Horner, R.A. DePinho, and F.W. Alt. 2000. Interplay of p53 and DNA-repair protein XRCC4 in tumorigenesis, genomic stability and development. Nature. 404:897–900.[CrossRef][Medline]
51 Liao, M.J., and T. Van Dyke. 1999. Critical role for Atm in suppressing V(D)J recombination-driven thymic lymphoma. Genes Dev. 13:1246–1250.
52 Gladdy, R.A., M.D. Taylor, C.J. Williams, I. Grandal, J. Karaskova, J.A. Squire, J.T. Rutka, C.J. Guidos, and J.S. Danska. 2003. The RAG-1/2 endonuclease causes genomic instability and controls CNS complications of lymphoblastic leukemia in p53/Prkdc-deficient mice. Cancer Cell. 3:37–50.[CrossRef][Medline]
53 Petiniot, L.K., Z. Weaver, M. Vacchio, R. Shen, D. Wangsa, C. Barlow, M. Eckhaus, S.M. Steinberg, A. Wynshaw-Boris, T. Ried, and R.J. Hodes. 2002. RAG-mediated V(D)J recombination is not essential for tumorigenesis in Atm-deficient mice. Mol. Cell. Biol. 22:3174–3177.
54 Borghesani, P.R., F.W. Alt, A. Bottaro, L. Davidson, S. Aksoy, G.A. Rathbun, T.M. Roberts, W. Swat, R.A. Segal, and Y. Gu. 2000. Abnormal development of Purkinje cells and lymphocytes in Atm mutant mice. Proc. Natl. Acad. Sci. USA. 97:3336–3341.
55 Elson, A., Y. Wang, C.J. Daugherty, C.C. Morton, F. Zhou, J. Campos-Torres, and P. Leder. 1996. Pleiotropic defects in ataxia-telangiectasia protein-deficient mice. Proc. Natl. Acad. Sci. USA. 93:13084–13089.
56 Xu, Y., T. Ashley, E.E. Brainerd, R.T. Bronson, M.S. Meyn, and D. Baltimore. 1996. Targeted disruption of ATM leads to growth retardation, chromosomal fragmentation during meiosis, immune defects, and thymic lymphoma. Genes Dev. 10:2411–2422.
57 Barlow, C., S. Hirotsune, R. Paylor, M. Liyanage, M. Eckhaus, F. Collins, Y. Shiloh, J.N. Crawley, T. Ried, D. Tagle, and A. Wynshaw-Boris. 1996. Atm-deficient mice: a paradigm of ataxia telangiectasia. Cell. 86:159–171.[CrossRef][Medline]
58 Liyanage, M., Z. Weaver, C. Barlow, A. Coleman, D.G. Pankratz, S. Anderson, A. Wynshaw-Boris, and T. Ried. 2000. Abnormal rearrangement within the alpha/delta T-cell receptor locus in lymphomas from Atm-deficient mice. Blood. 96:1940–1946.
59 Guidos, C.J., C.J. Williams, I. Grandal, G. Knowles, M.T. Huang, and J.S. Danska. 1996. V(D)J recombination activates a p53-dependent DNA damage checkpoint in scid lymphocyte precursors. Genes Dev. 10:2038–2054.
60 Nacht, M., A. Strasser, Y.R. Chan, A.W. Harris, M. Schlissel, R.T. Bronson, and T. Jacks. 1996. Mutations in the p53 and SCID genes cooperate in tumorigenesis. Genes Dev. 10:2055–2066.
61 Vanasse, G.J., J. Halbrook, S. Thomas, A. Burgess, M.F. Hoekstra, C.M. Disteche, and D.M. Willerford. 1999. Genetic pathway to recurrent chromosome translocations in murine lymphoma involves V(D)J recombinase. J. Clin. Invest. 103:1669–1675.[Medline]
62 Celeste, A., S. Petersen, P.J. Romanienko, O. Fernandez-Capetillo, H.T. Chen, O.A. Sedelnikova, B. Reina-San-Martin, V. Coppola, E. Meffre, M.J. Difilippantonio, et al. 2002. Genomic instability in mice lacking histone H2AX. Science. 296:922–927.
63 Bassing, C.H., H. Suh, D.O. Ferguson, K.F. Chua, J. Manis, M. Eckersdorff, M. Gleason, R. Bronson, C. Lee, and F.W. Alt. 2003. Histone H2AX: a dosage-dependent suppressor of oncogenic translocations and tumors. Cell. 114:359–370.[CrossRef][Medline]
64 Franco, S., M. Gostissa, S. Zha, D.B. Lombard, M.M. Murphy, A.A. Zarrin, C. Yan, S. Tepsuporn, J.C. Morales, M.M. Adams, et al. 2006. H2AX prevents DNA breaks from progressing to chromosome breaks and translocations. Mol. Cell. 21:201–214.[CrossRef][Medline]
65 Bartkova, J., N. Rezaei, M. Liontos, P. Karakaidos, D. Kletsas, N. Issaeva, L.V. Vassiliou, E. Kolettas, K. Niforou, V.C. Zoumpourlis, et al. 2006. Oncogene-induced senescence is part of the tumorigenesis barrier imposed by DNA damage checkpoints. Nature. 444:633–637.[CrossRef][Medline]
66 Christophorou, M.A., I. Ringshausen, A.J. Finch, L.B. Swigart, and G.I. Evan. 2006. The pathological response to DNA damage does not contribute to p53-mediated tumour suppression. Nature. 443:214–217.[CrossRef][Medline]
67 Rabbitts, T.H., A. Forster, P. Hamlyn, and R. Baer. 1984. Effect of somatic mutation within translocated c-myc genes in Burkitt's lymphoma. Nature. 309:592–597.[CrossRef][Medline]
68 Taub, R., C. Moulding, J. Battey, W. Murphy, T. Vasicek, G.M. Lenoir, and P. Leder. 1984. Activation and somatic mutation of the translocated c-myc gene in burkitt lymphoma cells. Cell. 36:339–348.[CrossRef][Medline]
69 Schrader, C.E., S.P. Bradley, J. Vardo, S.N. Mochegova, E. Flanagan, and J. Stavnezer. 2003. Mutations occur in the Ig Smu region but rarely in Sgamma regions prior to class switch recombination. EMBO J. 22:5893–5903.[CrossRef][Medline]
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|