|
||
ARTICLE |
CORRESPONDENCE R. Casellas: casellar{at}mail.nih.gov
|
|
|---|
E.E. Crouch and Z. Li contributed equally to this work.
The elimination of antigens by B lymphocytes is performed by antibody molecules that contain an N-terminal variable domain followed by a C-terminal constant domain. During the immune response, B lymphocytes express the activation-induced cytidine deaminase (AID) enzyme, which induces two major alterations in Ig gene loci to enhance antibody and B cell function. First, the process of somatic hypermutation introduces single point mutations at variable genes, which can increase antibody affinity for antigens (1). Second, the mechanism of class switch recombination replaces the Ig heavy chain constant region Cµ for C
The importance of AID in the humoral immune response is highlighted in AID-deficient patients and animals, which are highly susceptible to infection and exhibit gut floradependent hyperplasia of intestinal villi (3, 4). Conversely, complex diseases such as autoimmunity have long been associated with AID-dependent hypermutation (5). Moreover, untimely, ectopic, or elevated AID expression results in translocations and malignant transformation of B cells (6, 7) and T cells (8). These considerations emphasize the need to understand the molecular pathways that regulate AID expression during B cell ontogeny.
Initially, AID expression was thought to be limited to follicular germinal center (GC) B cells (9). Conversely, recent evidence suggests that AID is also active outside of the GC microenvironment. In mice carrying a highly reduced V gene repertoire, hypermutation and AID transcripts were reported in a small subset of immature bone marrow B cells (10). In a lupus-prone mouse, hypermutation and affinity maturation occur at the T cell zonered pulp border (11). Likewise, in rheumatoid arthritis patients, somatic hypermutation has been shown to occur in B cells residing in nonlymphoid synovial tissue (12). In normal mice, AID transcription and class switch recombination might occur in the gut lamina propria outside of Peyer's patches (PPs) and isolated lymphoid follicles (ILFs) (13), although others have recently contradicted these findings (14). Large extrafollicular proliferating cells have also been shown to express AID in human lymphoid tissues (15, 16). Finally, recent data indicate that AID is induced in preB cells in response to retroviral infection, perhaps as part of an innate defense mechanism (17). These studies therefore underscore the need for experimental model systems to monitor AID expression in the context of the entire organism.
The development of indicator mouse strains using bacterial artificial chromosomes (BACs) has greatly facilitated the study of gene expression and the unraveling of gene regulatory elements in the past decade (18, 19). The success of gene reporter expression systems is based on the premise that transgene constructs must carry sufficient regulatory information to recapitulate tissue-specific and copy-dependent regulation of genes of interest. However, the in vivo demarcation of gene regulatory boundaries typically relies on the production of large cohorts of transgenic animals (20, 21), making this process expensive and time-consuming. We here provide an alternative approach that combines comparative genomic analysis with high-resolution histone H3 acetylation mapping. This strategy allowed us to predefine the minimal DNA segment capable of recapitulating the temporal and spatial expression patterns of endogenous AID and led to the development of two complementary AID reporter lines that efficiently track AID-expressing cells as well as their progeny. Our studies define AID expression during T celldependent and independent immune responses as well as upon retroviral infection of immature B cells.
, C
, or C
, thereby controlling the antibody effector function (2).
![]()
RESULTS
Top
ABSTRACT
RESULTS
DISCUSSION
MATERIALS AND METHODS
REFERENCES
Mapping AID gene regulatory boundaries
To identify the cis-regulatory elements governing AID transcription in vivo, we used phylogenetic footprinting to compare one megabase of human, dog, and mouse genomic DNA containing the AID (Aicda) gene. Using a combination of global and local alignment algorithms (http://family.caltech.edu/ and http://www-gsd.lbl.gov/vista/index.shtml), we generated alignment plots that revealed the conserved protein-encoding sequences (exons) of three syntenic genes within the one megabase of genomic DNA analyzed: Kiaa1238, Mfap5, and Aicda (Fig. 1, red peaks).
Additionally, we found 11 highly conserved noncoding sequences (CNSs) that exhibited on average
75% identity in all three species (Fig. 1, black peaks).
|
|
Unlike CNS IVII and XI, which exhibited no change in H3 acetylation upon B cell activation (Fig. 2 B and not depicted), a second acetylation peak occurred at CNS X. This element, located
7 kb downstream of mouse Aicda (Fig. 2 A) or
24 kb 3' of human Aicda (Fig. 1), is composed of two elements highly conserved in humans and mice (Fig. 2 D). To investigate whether CNS X functions as a bona fide protein-binding site upon AID transcription, we performed DNaseI hypersensitivity assays on nuclei obtained from resting and activated B lymphocytes. In contrast to CNS VII, which is not hyperacetylated during B cell activation (Fig. 2 C, left), we found clear evidence of protein binding at CNS X (Fig. 2 C, right), strongly suggesting that this element functions as a regulator of AID transcription.
Monitoring in vivo AID expression using AID-GFP reporter mice
The above studies predicted that AID proximal promoter elements and CNS X might be sufficient to direct physiological expression of an AID reporter gene. To evaluate this hypothesis, we generated transgenic mice with a 45-kb BAC carrying the mouse AID gene, including CNS X (Fig. 2 D and Fig. 3 A, top).
By means of homologous recombination (25), we modified the BAC by fusing the GFP gene to AID exon 5. To define the role of CNS X in AID expression, we also created a second transgene construct in which CNS X was deleted by recombination (AID-GFP-
X; Fig. 3 A, bottom). Two AID-GFP and three AID-GFP-
X transgenic mouse strains were generated with two to five transgenic copies per line.
|
X lines showed no green fluorescence in GC B cells in the absence of CNS X (Fig. 3 B). Furthermore, PCR analysis showed a five- to sevenfold decrease in AID-GFP transcripts in activated AID-GFP-
X lymphocytes compared with AID-GFP controls (Fig. 3 C). We conclude that our AID-GFP transgene recapitulates the spatiotemporal expression of endogenous AID and that CNS X is required for AID transcription during the immune response. Activated B cells leaving the GC differentiate into plasma or memory B cells. To examine whether AID expression is maintained or down-regulated as B cells exit the GC microenvironment, we assessed green fluorescence in post-GC B cells during the NP response. We first analyzed pre-plasma memory B cells (NP+IgDB220CD138) (26, 27) in AID-GFP mice immunized with NP-KLH. As described previously, these GC-derived B cells appear in the spleen 710 d after immunization, are somatically hypermutated, do not secrete antibody, and persist after primary challenge (27). We found that although NP+B220+CD95high GC cells express abundant AID-GFP (Fig. 4 A, right), pre-plasma memory lymphocytes lack AID-GFP expression (Fig. 4 A, middle) suggesting that AID is down-regulated as cells exit the GC microenvironment. To confirm this result, we assessed AID transcription in post-GC NP-binding cells recovered from the blood of nontransgenic animals. NP-specific IgG1+ B cells carrying somatic mutations appear in the blood as early as 7 d after immunization (28). To determine AID mRNA levels in this small compartment, we developed a single cell RT-PCR strategy (SC-RT-PCR; see Materials and methods). Consistent with previous observations (28), few NP-specific B cells were found in unimmunized mice (Fig. 4 B, day 0), whereas 7 d after NP-CGG immunization, B220+IgG1+NP+ B cells were clearly present in the blood (Fig. 4 B, day 7). We found that although nearly all (70 of 72) B220+IgG1+NP+CD95high lymph node GC cells were AID+ at day 7, AID transcripts were absent in B220+IgG1+NP+blood lymphocytes (Fig. 4 B). In agreement with these observations, no AID-GFP+ cells were observed in the blood of AID-GFPimmunized mice (not depicted).
|
Genetic labeling of B lymphocytes after AID expression
As stated above, the AID-GFP transgene and endogenous AID are activated in GC cells undergoing switching and/or hypermutation, but turned off during plasma and memory B cell differentiation. To permanently tag the progeny of AID-expressing B cells with a fluorescent reporter protein, we introduced the bacterial cre recombinase gene in lieu of AID exon 1 (Fig. 5 A).
AID-Cre transgenic mice were bred to the ROSA26-EYFP reporter strain, in which the yellow fluorescent protein (YFP) is expressed indelibly upon Cre-mediated deletion of a floxed neomycin gene (Fig. 5 A) (32). To evaluate the interplay of the two transgenes in vivo, we measured yellow fluorescence in different B cell subsets from AID-Cre-YFP double transgenic mice. Six different founder lines with approximately one to five transgene copies were analyzed. We found no YFP expression in immature bone marrow B cells (see below) or other hematopoietic lineage cells (not depicted). In addition, the spleen or axillary lymph nodes of nonimmunized mice, which have few GCs, showed a small number of lymphocytes expressing YFP (Fig. 5 B, left). In contrast, we found that PPs, which harbor constitutive GCs due to persistent B cell stimulation with gut antigens, had large numbers (
20% of B220+) of CD95highYFP+ GC cells (Fig. 5 B, right), demonstrating that AID transcription promotes Cre expression in activated B cells. Consistent with this idea, virtually all lamina propria CD138+ plasma cells, which originate in PPs and possibly other sites of B cell activation, were YFP+ in AID-Cre-YFP mice (Fig. 5 C).
|
AID in the GALT
IgA, together with innate mucosal immunity, provides the first line of defense against bacterial antigens in the GALT. AID expression and class switching to IgA have been proposed to take place either in situ in the gut lamina propria (13) or within GCs in PPs and ILFs of the small intestine (14). To ascertain the site of AID expression in mucosal surfaces, we determined green fluorescence in AID-GFP lymphocytes isolated from small intestine PPs and large intestine lamina propria. Under specific pathogen-free conditions, the large intestine (which normally lacks PPs) fails to develop ILF GCs (unpublished data). We found little AID-GFP expression in B220+IgM+ PP B cells (Fig. 6 A, middle).
In contrast, around 65% of all B220+IgA+ PP cells expressed AID and high levels of CD95 (Fig. 6 A, right panel and top histogram, respectively), indicating that PP GCs are primarily populated by IgA+ lymphocytes. As in PPs, B220+IgM+ B cells of the large intestine lamina propria displayed little green fluorescence (Fig. 6 B, left). However, a population of B220+IgA+ B lymphocytes expressed AID-GFP and high levels of CD95 in the large intestine (Fig. 6 B, right, and Fig. 6 A, bottom histogram, respectively). IgA+CD95highAID-GFP+ lamina propria B cells may represent lymphocytes stimulated in situ perhaps by gut antigens as proposed previously (13). Alternatively, these lymphocytes could be recently emigrated PP or ILF B cells carrying residual AID-GFP protein. To evaluate these possibilities, we determined green fluorescence in the lamina propria of AID-GFP-OcaB/ mice. In the absence of OcaB, the capacity of B lymphocytes to form pauciclonal aggregates and differentiate into plasmacytes in T cellrich areas of lymphoid organs is intact, whereas B cell translocation to follicles and GC formation is impaired (3335). In consequence, OcaB/ mice lack both PPs, ILFs in the gut, and GCs in mesenteric lymph nodes (Fig. 6 C, micrographs, and not depicted) (3335). We found that OcaB/ AID-GFP mice, although unable to form GCs, displayed IgA+CD95highAID-GFP+ B cells in the large intestine lamina propria (Fig. 6 C, right), although at lower levels compared with wild-type animals (Fig. 6 B, right). To determine whether AID-GFP+ B cells showed ongoing AID transcription, we performed SC-RT-PCR. We found evidence of AID mRNA in nearly all CD95high lymphocytes analyzed, whereas AID was rarely found in CD95low cells (Fig. 6 C, bottom). Collectively, our results demonstrate that gut lamina propria B cells can express AID outside of PPs and ILF GCs.
|
|
| DISCUSSION |
|---|
|
|
|---|
In this study, histone H3 acetylation mapping uncovered two elements at the mouse AID locus that undergo nearly complete acetylation upon B cell activation. The first element corresponds to Aicda proximal promoter sequences, including transcription-enhancing E2A binding sites (23). High levels of acetylation at these sites correlate with the reported ability of E-box proteins to recruit p300 acetyltransferase activity to chromatin (43). Because evidence indicates that p300 and E2A collaborate in B cell ontogeny (44), it will be important to determine whether the p300E2A complex regulates AID gene transcription in activated B lymphocytes. The second hyperacetylation element, termed CNS-X, is a putative transcriptional enhancer, and its deletion nearly entirely abolishes AID expression both in GC as well as in in vitroactivated B cells. DNaseI hypersensitivity assays demonstrate protein binding activity at CNS-X in activated B cells. Additional studies will be required to determine the nature of these factors and the mechanism by which they regulate AID gene transcription upon B cell activation.
Our reporter strains show that AID expression is induced in GC B cells both during T celldependent and independent immune responses, and that memory and/or plasma cell differentiation leads to AID transcriptional down-regulation. These results are consistent with previous studies showing that the transition of GC cells to the terminally differentiated plasma cell stage is regulated by mutually exclusive transcription programs (30). These gene regulatory networks, which depend on the activity of Pax5, Bcl6, IRF-4, and Blimp1, directly control AID gene expression as B cells differentiate out of the GC microenvironment (45). However, as shown in mice that lack or have poorly developed PPs and ILFs, GCs are clearly not the only location for terminal B cell differentiation (46, 47). Molecular characterization of lamina propria B cells indicates active, ongoing class switch recombination outside of GCs (13). Our results using wild-type and OcaB/AID-GFP mice support the idea that AID expression is induced in situ in the GALT.
We find that under physiological conditions, bone marrowdeveloping B cells do not significantly express AID. Previous experiments with animals expressing a limited repertoire (QM mice) suggested that AID may function in immature B cells (10). Similar conclusions were reached studying mMT/ mice (48), where Igµ
bone marrow B cells are arrested at the proB cell stage (49). In these animals, a small fraction of lymphocytes bypass the developmental block via class switch recombination, implying that AID is active at early stages of B cell development. However, both QM and mMT/ differ from wild-type mice in that B lymphopoiesis occurs under strong selective pressure. Consequently, the physiological significance of bone marrow AID activity under wild-type conditions was unclear. Our reporter strains show no evidence of AID expression in the bone marrow of animals with a normal antibody repertoire, and sensitive real-time PCR analysis only detected AID transcripts in transitional CD93+IgM+ bone marrow B cells at levels 100500-fold lower than those found in GC lymphocytes. Although we cannot rule out that under unique circumstances AID may play a role in early B cell lymphopoiesis, low levels of AID mRNA in the bone marrow of wild-type mice may be simply reminiscent of a common evolutionary past between mice and "GALT species" (36).
Although unperturbed bone marrow B cells show little AID expression, infection with a transforming retrovirus readily activates AID transcription in developing lymphocytes (17 and this study). Likewise, B cell infection with hepatitis C (50), Epstein-Barr virus (51, 52), or Moloney murine leukemia virus (53) leads to AID up-regulation, suggesting that AID induction is part of a general innate antiviral host response. It will be important to determine whether nonB cells upon viral infection can also trigger AID expression.
In conclusion, our AID indicator strains efficiently track B cells expressing AID and their progeny in the context of the humoral immune response. These animals along with similar B cell activation reporter mice, such as Blimp-EGFP (54) and C
1-Cre (55) transgenics, will further our knowledge of the late stages of B cell differentiation both in the normal immune response as well as during autoimmunity and B cell tumorigenesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
To immunoprecipitate acetylated histone H3DNA complexes from resting and activated B cells, we used antiacetyl-histone H3 antibodies (06-599; Upstate Biotechnology) according to the manufacturer's instructions. On average, 85 ng of acetylated DNA was recovered per 106 cells. To calculate the absolute percentage of acetylated histone H3 for a given genomic target, we amplified 4 ng antiacetyl-histone H3 immunoprecipitated (IM) and input (IN) DNA (normalized using PicoGreen, P7589; Invitrogen) in the presence of SYBR Green (4309155; Applied Biosystems) using an iCycler (Bio-Rad Laboratories). Primers were designed to scan the mouse AID locus at
500-bp intervals. PCR products were between 100 and 150 bp in length. The fold difference between the two sets of samples for any given target sequence was calculated using the following PCR equation:
![]() | (1) |
where X0 and X represent the DNA concentration before and after PCR amplification, respectively, E denotes the PCR efficiency and n represents the number of cycles necessary to achieve a specified threshold, which we set to cross a point at which amplification was linear (110 RFU using software from Bio-Rad Laboratories). Under these conditions, X becomes a constant and the ratio of the initial DNA abundance between the IM and the IN fractions can be calculated as follows:
![]() | (2) |
Thus, the fold difference between the immunoprecipitated and input samples is determined as the difference in number of cycles each fraction takes to reach the specified threshold and taking the resulting power of 2. The fold difference X0(IM)/X0(IN) is also proportional to the percentage of acetylated histone H3 in the immunoprecipitated sample (%AcIM) over that of the input (%AcIN):
![]() | (3) |
Thus, the absolute percentage of histone H3 at any given genomic site can be assessed if %AcIN is known. To empirically determined %AcIN, we measured the total fraction (f) of the genome that can be pulled down by immunoprecipitation in the presence of an excess of anti-acetylated H3 antibody as follows:
![]() | (4) |
where DNAIN and DNAIM are the amount of DNA measured before and after immunoprecipitation, respectively, and B represents nonspecific DNA pulled down by the antibody, which is constant when the immunoprecipitating antibody is in excess. To determine f, we performed several dilutions of cross-linked DNA obtained from B lymphocytes and measured, using PicoGreen, the absolute concentration of DNA before and after immunoprecipitation (performed in the presence of 100 µl anti-acetylated H3 antibody). By plotting DNAIM versus DNAIN and using linear regression analysis, we determined the slope f (0.08, Fig. 2 B) and concluded that 8% of all histone H3 is acetylated at any one point in time in the mammalian genome. This measurement is comparable to what has been previously determined for chicken cells (7%) (22). Therefore, by using the fold difference calculated by real-time PCR analysis, we can now assess the percentage of histone H3 acetylated at any given target in mammalian cells:
![]() | (5) |
DNaseI hypersensitivity.
B lymphocytes were isolated using CD43 MACS beads and cultured in the presence of 25 µg ml1 LPS or 1 µg/ml anti-CD40 (HM40-3; BD Biosciences) and 25 ng ml1 IL-4 (404-ML; R&D Systems) for 36 h. Resting and activated B cells were then washed, and the nuclei were isolated followed by exposure for 20 min at 37°C to increasing amounts of 10 U µl1 DnaseI (diluted 1/160, 1/320, 1/640, 1/1280, 1/2560, 1/5120 and 1/10240, respectively; 92877720; Roche). The reaction was terminated with EDTA. Next, the nuclei were treated for 30 min at 37°C with RNase A (0.5 mg ml1 DNase-free RNase A in TE) followed by incubation overnight with proteinase K at 55°C. The DNA was precipitated, resuspended in 20 µl TE, digested overnight with EcoRV or XbaI, and fractionated on Southern blots probed with 32P-labeled DNA fragments designated PI and PII. These probes were generated by PCR amplification using primer pairs 2B-5' (TGTGTTGAGGTTTCATATCGCC) and 2B-3' (CCAGCACTTGGGAGGCAAAG), and 7B-5' (TCTCCAGCCCTGGAAACTTATG) and 7B-3' (CTTGGTCACCTACAAGGAACTC), respectively.
Generation of AID-GFP, AID-GFP
X, and AID-Cre transgenic mice.
BAC transgenes were constructed by modification of a 200-kb mouse BAC containing mouse Aicda (RPCI24-68I7). Deletions and insertions were generated using homologous recombination in bacteria as described previously (25). In brief, 12-kb constructs carrying two arms of homology (
500 each) were ligated into the PsVI shuttle vector that was transformed into DH10B-competent cells expressing the RPCI24-68I7 BAC. The proper insertion of the respective modifications and final bacterial selection in chloramphenicol/fusaric acid plates were monitored by PCR using primers internal and external to the homologous constructs. By this method, two deletions were performed flanking the Aicda gene within the RPCI24-68I7 BAC. The 3' deletion consisted of a 110.7-kb DNA fragment starting 13,717 bp 3' of AID exon 5 and ending at the T7 promoter of the pTARBAC backbone vector of RPCI24-68I7. The 5' deletion consisted of
37 kb DNA starting 25,202 bp 5' of AID exon 1 and ending at the SP6 promoter of pTARBAC. Finally, the GFP gene was introduced in such a way as to create a fusion to AID exon 5. To generate the AID-GFP
X transgenic construct, a 6-kb XbaI fragment containing CNS-X (3,9059,917 bp downstream of mouse AID exon 5) was deleted from the trimmed BAC. Alternatively, the bacterial Cre recombinase gene was inserted in lieu of AID exon 1 so that only the recombinase (and not AID) would be expressed from the transgene. As an example of the strategy used to clone and select the aforementioned constructs, primers used to amplify the 5' arm of AID-Cre were: 5'(1) aagtcgacCCAATGTGAGAAGTGTCCAGTG and 5'(2) GTGTACGGTCAGTAAATTGGACATatcggtctccagcgtgactttc; to amplify the 3' arm: 3'(1) CTGCTGGAAGATGGCGATTAGGGACAGgtaacaagacagtc and 3'(2) gtcgacagtaAGGAGTTGCTACGACCTC; and the Cre gene was amplified with Cre1 gaaagtcacgctggagaccgatATGTCCAATTTACTGACCGTACAC and Cre2 gactgtcttgttacCTGTCCCTAATCGCCATCTTCCAGCAG. To create the final homologous recombination construct, 10 ng of each of the DNA fragments was fused in a PCR reaction using primers 5'(1) and 3'(2). The DNA piece was then extracted, sequenced, digested with SalI, and ligated to PsVI. To assess recombination of the construct's right arm we used primers Cre5'(1) CACACTCACAGAGCTCATTATCATG and Cre5'(2) GTTGCATCGACCGGTAATGCAG, whereas left arm recombinations were determined with Cre3'(1) ATCCGTAACCTGGATAGTGAAACAG and Cre3'(2) CCATGCGAGTCTTAAGATGTTGG.
All animal experiments were performed according to the NIH guidelines for laboratory animals and were approved by the Scientific Committee of the NIAMS Animal Facility.
RT-PCR and SC-RT-PCR.
To discriminate and compare endogenous AID and transgenic AID-GFP transcripts, splenic B cells from AID-GFP (and AID-GFP-
X) mice were isolated with CD43 microbeads and cultured in the presence of LPS or LPS plus IL-4 for 48 h. RNA was extracted with RNAqueous-Micro (Ambion) and treated twice with DNaseI. cDNA was generated, and the level of endogenous AID transcripts were monitored by real-time PCR with primers: AIDWT-RT5': CCCTTGTACGAAGTCGATGAC, AIDWT-RT3': ATCACGTGTGACATTCCAGGAG. AID-GFP transcripts were amplified with: AID-GFP-RT5': GACTTGCGAGATGCATTTCGTATG and AID-GFP-RT3': GCTGAACTTGTGGCCGTTTAC. To determine the fold difference between different samples, cDNA obtained from AID-GFPactivated B cells was diluted twofold, fivefold, 10-fold, 50-fold, and 100-fold, and both endogenous AID and AID-GFP were amplified by real-time PCR. We normalized cDNA between samples by amplifying from each cDNA reaction the DNA-PK subunit Ku70 mRNA with the following primers: Ku70-5': TGCCCTTTACTGAGAAGGTGAC and Ku70-3': TGCTGCAGGACTGGATTCTC.
To quantify AID transcription in different B cell compartments (Fig. 4), mouse AID primer sequences were obtained from PrimerBank (http://pga.mgh.harvard.edu/primerbank/index.html): PrimerBank-mAID5': GCCACCTTCGCAACAAGTCT and PrimerBank-mAID3': CCGGGCACAGTCATAGCAC.
To analyze AID expression at the single cell level, B lymphocytes were stained as indicated and individual cells were sorted using a MoFlo (DakoCytomation) instrument into iCycler 96-well plates (Bio-Rad Laboratories) containing 10 µl of 10 mM RNAase-Free Tris buffer and 1 U/µl of RNase inhibitor (Promega). RT-PCR was set up by adding to each well 15 µl of QIAGEN's OneStep RT-PCR master mix plus 0.6 µM of PrimerBank primers (described above). The plates were incubated (iCycler; Bio-Rad Laboratories) at 50°C for 30 min, followed by a 15-min cycle at 95°C and 40 cycles of 10 s at 95°C and 30 s at 55°C. Samples were run in a 2% agarose gel.
Hypermutation analysis.
GC or activated B cells were sorted using a MoFlo high-speed cell sorter (DakoCytomation). Genomic DNA was isolated, and the JH4 intron was amplified by nested PCR using KOD DNA polymerase (Novagen) and primers V1: AGCCTGACATCTGAGGAC and V2: TAGTGTGGAACATTCCTCAC for 30 cycles at 55°C. The second amplification step was performed with primers V3: CTGACATCTGAGGACTCTGC and V4: GCTGTCACAGAGGTGGTCCTG for 30 cycles at 60°C. PCR products were cloned using ZERO-blunt PCR cloning kit (Invitrogen) and sequenced using M13 universal primers. Sequence analysis was performed using SeqMan software (DNASTAR).
FACS analysis.
Unless otherwise stated, all other antibodies were from BD Biosciences: B220-PercP-Cy5.5, B220-APC-Cy7, B220-FITC, IgM-APC (Jackson ImmunoResearch Laboratories), CD95-PE, CD95-PE-Cy7, GL7-FITC, GL7-APC (APC conjugation was performed using Phycolink from Prozyme), CD43-PE, CD93-biotin, CD138-PE, CD4-PE-Cy5, CD8-PE-Cy5, IgA-Biotin, IgG1-biotin, GR1-Alexa 647 and F4/80-Alexa 647 (eBiosciences), IgD-Biotin, IgD-Alexa 647, Streptavidin-APC, Streptavidin-PE-Cy5, Streptavidin-PercP-Cy5.5, Streptavidin-PE, NP-APC (provided by McHeyzer-Williams), and NP-PE (Biosearch Technologies). Apoptotic cells were gated out using To-Pro-3 (Invitrogen) or DAPI (Sigma-Aldrich). Flow cytometers used were FACSCalibur (Becton Dickinson) and Cyan (DakoCytomation) for acquisition and MoFlo (DakoCytomation) for sorting. FACS data was analyzed with FlowJo software.
Online supplemental material.
Fig. S1 shows expression of AID mRNA by RT-PCR analysis in different tissues of wild-type, AID-GFP, and AID- Cre-YFP transgenic mice. It is available at http://www.jem.org/cgi/content/full/jem.20061952/DC1.
| Acknowledgments |
|---|
This research was supported in part by the Intramural Research Program of the NIH, NIAMS.
The authors have no conflicting financial interests.
Submitted: 8 September 2006
Accepted: 28 March 2007
| REFERENCES |
|---|
|
|
|---|
1 Longerich, S., U. Basu, F. Alt, and U. Storb. 2006. AID in somatic hypermutation and class switch recombination. Curr. Opin. Immunol. 18:164174.[CrossRef][Medline]
2 Honjo, T., K. Kinoshita, and M. Muramatsu. 2002. Molecular mechanism of class switch recombination: linkage with somatic hypermutation. Annu. Rev. Immunol. 20:165196.[CrossRef][Medline]
3 Revy, P., T. Muto, Y. Levy, F. Geissmann, A. Plebani, O. Sanal, N. Catalan, M. Forveille, R. Dufourcq-Labelouse, A. Gennery, et al. 2000. Activation-induced cytidine deaminase (AID) deficiency causes the autosomal recessive form of the Hyper-IgM syndrome (HIGM2). Cell. 102:565575.[CrossRef][Medline]
4 Fagarasan, S., M. Muramatsu, K. Suzuki, H. Nagaoka, H. Hiai, and T. Honjo. 2002. Critical roles of activation-induced cytidine deaminase in the homeostasis of gut flora. Science. 298:14241427.
5 McIntosh, R., P. Watson, and A. Weetman. 1998. Somatic hypermutation in autoimmune thyroid disease. Immunol. Rev. 162:219231.[CrossRef][Medline]
6 Ramiro, A.R., M. Jankovic, E. Callen, S. Difilippantonio, H.T. Chen, K.M. McBride, T.R. Eisenreich, J. Chen, R.A. Dickins, S.W. Lowe, et al. 2006. Role of genomic instability and p53 in AID-induced c-myc-Igh translocations. Nature. 440:105109.[CrossRef][Medline]
7 Kuppers, R., and R. Dalla-Favera. 2001. Mechanisms of chromosomal translocations in B cell lymphomas. Oncogene. 20:55805594.[CrossRef][Medline]
8 Okazaki, I.M., H. Hiai, N. Kakazu, S. Yamada, M. Muramatsu, K. Kinoshita, and T. Honjo. 2003. Constitutive expression of AID leads to tumorigenesis. J. Exp. Med. 197:11731181.
9 Muramatsu, M., V.S. Sankaranand, S. Anant, M. Sugai, K. Kinoshita, N.O. Davidson, and T. Honjo. 1999. Specific expression of activation-induced cytidine deaminase (AID), a novel member of the RNA- editing deaminase family in germinal center B cells. J. Biol. Chem. 274:1847018476.
10 Mao, C., L. Jiang, M. Melo-Jorge, M. Puthenveetil, X. Zhang, M.C. Carroll, and T. Imanishi-Kari. 2004. T cell-independent somatic hypermutation in murine B cells with an immature phenotype. Immunity. 20:133144.[CrossRef][Medline]
11 William, J., C. Euler, S. Christensen, and M.J. Shlomchik. 2002. Evolution of autoantibody responses via somatic hypermutation outside of germinal centers. Science. 297:20662070.
12 Schroder, A.E., A. Greiner, C. Seyfert, and C. Berek. 1996. Differentiation of B cells in the nonlymphoid tissue of the synovial membrane of patients with rheumatoid arthritis. Proc. Natl. Acad. Sci. USA. 93:221225.
13 Fagarasan, S., K. Kinoshita, M. Muramatsu, K. Ikuta, and T. Honjo. 2001. In situ class switching and differentiation to IgA-producing cells in the gut lamina propria. Nature. 413:639643.[CrossRef][Medline]
14 Shikina, T., T. Hiroi, K. Iwatani, M.H. Jang, S. Fukuyama, M. Tamura, T. Kubo, H. Ishikawa, and H. Kiyono. 2004. IgA class switch occurs in the organized nasopharynx- and gut-associated lymphoid tissue, but not in the diffuse lamina propria of airways and gut. J. Immunol. 172:62596264.
15 Cattoretti, G., M. Buettner, R. Shaknovich, E. Kremmer, B. Alobeid, and G. Niedobitek. 2006. Nuclear and cytoplasmic AID in extrafollicular and germinal center B cells. Blood. 107:39673975.
16 Moldenhauer, G., S.W. Popov, B. Wotschke, S. Bruderlein, P. Riedl, N. Fissolo, R. Schirmbeck, O. Ritz, P. Moller, and F. Leithauser. 2006. AID expression identifies interfollicular large B cells as putative precursors of mature B-cell malignancies. Blood. 107:24702473.
17 Gourzi, P., T. Leonova, and F.N. Papavasiliou. 2006. A role for activation-induced cytidine deaminase in the host response against a transforming retrovirus. Immunity. 24:779786.[CrossRef][Medline]
18 Heintz, N. 2004. Gene expression nervous system atlas (GENSAT). Nat. Neurosci. 7:483.[CrossRef][Medline]
19 Copeland, N.G., N.A. Jenkins, and D.L. Court. 2001. Recombineering: a powerful new tool for mouse functional genomics. Nat. Rev. Genet. 2:769779.[Medline]
20 Yannoutsos, N., V. Barreto, Z. Misulovin, A. Gazumyan, W. Yu, N. Rajewsky, B.R. Peixoto, T. Eisenreich, and M.C. Nussenzweig. 2004. A cis element in the recombination activating gene locus regulates gene expression by counteracting a distant silencer. Nat. Immunol. 5:443450.[CrossRef][Medline]
21 Fields, P.E., G.R. Lee, S.T. Kim, V.V. Bartsevich, and R.A. Flavell. 2004. Th2-specific chromatin remodeling and enhancer activity in the Th2 cytokine locus control region. Immunity. 21:865876.[CrossRef][Medline]
22 Litt, M.D., M. Simpson, F. Recillas-Targa, M.N. Prioleau, and G. Felsenfeld. 2001. Transitions in histone acetylation reveal boundaries of three separately regulated neighboring loci. EMBO J. 20:22242235.[CrossRef][Medline]
23 Sayegh, C.E., M.W. Quong, Y. Agata, and C. Murre. 2003. E-proteins directly regulate expression of activation-induced deaminase in mature B cells. Nat. Immunol. 4:586593.[CrossRef][Medline]
24 Wittschieben, B.O., G. Otero, T. de Bizemont, J. Fellows, H. Erdjument-Bromage, R. Ohba, Y. Li, C.D. Allis, P. Tempst, and J.Q. Svejstrup. 1999. A novel histone acetyltransferase is an integral subunit of elongating RNA polymerase II holoenzyme. Mol. Cell. 4:123128.[CrossRef][Medline]
25 Misulovin, Z., X.W. Yang, W. Yu, N. Heintz, and E. Meffre. 2001. A rapid method for targeted modification and screening of recombinant bacterial artificial chromosome. J. Immunol. Methods. 257:99105.[CrossRef][Medline]
26 Shapiro-Shelef, M., K.I. Lin, L.J. McHeyzer-Williams, J. Liao, M.G. McHeyzer-Williams, and K. Calame. 2003. Blimp-1 is required for the formation of immunoglobulin secreting plasma cells and pre-plasma memory B cells. Immunity. 19:607620.[CrossRef][Medline]
27 Driver, D.J., L.J. McHeyzer-Williams, M. Cool, D.B. Stetson, and M.G. McHeyzer-Williams. 2001. Development and maintenance of a B220 memory B cell compartment. J. Immunol. 167:13931405.
28 Blink, E.J., A. Light, A. Kallies, S.L. Nutt, P.D. Hodgkin, and D.M. Tarlinton. 2005. Early appearance of germinal centerderived memory B cells and plasma cells in blood after primary immunization. J. Exp. Med. 201:545554.
29 Shih, T.A., M. Roederer, and M.C. Nussenzweig. 2002. Role of antigen receptor affinity in T cell-independent antibody responses in vivo. Nat. Immunol. 3:399406.[CrossRef][Medline]
30 Shaffer, A.L., K.I. Lin, T.C. Kuo, X. Yu, E.M. Hurt, A. Rosenwald, J.M. Giltnane, L. Yang, H. Zhao, K. Calame, and L.M. Staudt. 2002. Blimp-1 orchestrates plasma cell differentiation by extinguishing the mature B cell gene expression program. Immunity. 17:5162.[CrossRef][Medline]
31 Cheung, W.C., J.S. Kim, M. Linden, L. Peng, B. Van Ness, R.D. Polakiewicz, and S. Janz. 2004. Novel targeted deregulation of c-Myc cooperates with Bcl-X(L) to cause plasma cell neoplasms in mice. J. Clin. Invest. 113:17631773.[CrossRef][Medline]
32 Srinivas, S., T. Watanabe, C.S. Lin, C.M. William, Y. Tanabe, T.M. Jessell, and F. Costantini. 2001. Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus. BMC Dev. Biol. 1:4.[CrossRef][Medline]
33 Kim, U., X.F. Qin, S. Gong, S. Stevens, Y. Luo, M. Nussenzweig, and R.G. Roeder. 1996. The B-cell-specific transcription coactivator OCA-B/OBF-1/Bob-1 is essential for normal production of immunoglobulin isotypes. Nature. 383:542547.[CrossRef][Medline]
34 Nielsen, P.J., O. Georgiev, B. Lorenz, and W. Schaffner. 1996. B lymphocytes are impaired in mice lacking the transcriptional co-activator Bob1/OCA-B/OBF1. Eur. J. Immunol. 26:32143218.[Medline]
35 Schubart, D.B., A. Rolink, M.H. Kosco-Vilbois, F. Botteri, and P. Matthias. 1996. B-cell-specific coactivator OBF-1/OCA-B/Bob1 required for immune response and germinal centre formation. Nature. 383:538542.[CrossRef][Medline]
36 Weill, J.C., and C.A. Reynaud. 2005. Do developing B cells need antigen? J. Exp. Med. 201:79.
37 Chiu, Y.L., V.B. Soros, J.F. Kreisberg, K. Stopak, W. Yonemoto, and W.C. Greene. 2005. Cellular APOBEC3G restricts HIV-1 infection in resting CD4+ T cells. Nature. 435:108114.[CrossRef][Medline]
38 Newman, E.N., R.K. Holmes, H.M. Craig, K.C. Klein, J.R. Lingappa, M.H. Malim, and A.M. Sheehy. 2005. Antiviral function of APOBEC3G can be dissociated from cytidine deaminase activity. Curr. Biol. 15:166170.[CrossRef][Medline]
39 Rosenberg, N. 1994. Abl-mediated transformation, immunoglobulin gene rearrangements and arrest of B lymphocyte differentiation. Semin. Cancer Biol. 5:95102.[Medline]
40 Nobrega, M.A., I. Ovcharenko, V. Afzal, and E.M. Rubin. 2003. Scanning human gene deserts for long-range enhancers. Science. 302:413.
41 Kim, T.H., L.O. Barrera, M. Zheng, C. Qu, M.A. Singer, T.A. Richmond, Y. Wu, R.D. Green, and B. Ren. 2005. A high-resolution map of active promoters in the human genome. Nature. 436:876880.[CrossRef][Medline]
42 Pokholok, D.K., C.T. Harbison, S. Levine, M. Cole, N.M. Hannett, T.I. Lee, G.W. Bell, K. Walker, P.A. Rolfe, E. Herbolsheimer, et al. 2005. Genome-wide map of nucleosome acetylation and methylation in yeast. Cell. 122:517527.[CrossRef][Medline]
43 Bayly, R., L. Chuen, R.A. Currie, B.D. Hyndman, R. Casselman, G.A. Blobel, and D.P. LeBrun. 2004. E2A-PBX1 interacts directly with the KIX domain of CBP/p300 in the induction of proliferation in primary hematopoietic cells. J. Biol. Chem. 279:5536255371.
44 Bradney, C., M. Hjelmeland, Y. Komatsu, M. Yoshida, T.P. Yao, and Y. Zhuang. 2003. Regulation of E2A activities by histone acetyltransferases in B lymphocyte development. J. Biol. Chem. 278:23702376.
45 Sciammas, R., A.L. Shaffer, J.H. Schatz, H. Zhao, L.M. Staudt, and H. Singh. 2006. Graded expression of interferon regulatory factor-4 coordinates isotype switching with plasma cell differentiation. Immunity. 25:225236.[CrossRef][Medline]
46 Neumann, B., A. Luz, K. Pfeffer, and B. Holzmann. 1996. Defective Peyer's patch organogenesis in mice lacking the 55-kD receptor for tumor necrosis factor. J. Exp. Med. 184:259264.
47 Vajdy, M., M.H. Kosco-Vilbois, M. Kopf, G. Kohler, and N. Lycke. 1995. Impaired mucosal immune responses in interleukin 4targeted mice. J. Exp. Med. 181:4153.
48 Kitamura, D., J. Roes, R. Kuhn, and K. Rajewsky. 1991. A B cell-deficient mouse by targeted disruption of the membrane exon of the immunoglobulin mu chain gene. Nature. 350:423426.[CrossRef][Medline]
49 Macpherson, A.J., A. Lamarre, K. McCoy, G.R. Harriman, B. Odermatt, G. Dougan, H. Hengartner, and R.M. Zinkernagel. 2001. IgA production without mu or delta chain expression in developing B cells. Nat. Immunol. 2:625631.[CrossRef][Medline]
50 Machida, K., K.T. Cheng, V.M. Sung, S. Shimodaira, K.L. Lindsay, A.M. Levine, M.Y. Lai, and M.M. Lai. 2004. Hepatitis C virus induces a mutator phenotype: enhanced mutations of immunoglobulin and protooncogenes. Proc. Natl. Acad. Sci. USA. 101:42624267.
51 Tobollik, S., L. Meyer, M. Buettner, S. Klemmer, B. Kempkes, E. Kremmer, G. Niedobitek, and B. Jungnickel. 2006. Epstein-Barr virus nuclear antigen 2 inhibits AID expression during EBV-driven B-cell growth. Blood. 108:38593864.
52 Uchida, J., T. Yasui, Y. Takaoka-Shichijo, M. Muraoka, W. Kulwichit, N. Raab-Traub, and H. Kikutani. 1999. Mimicry of CD40 signals by Epstein-Barr virus LMP1 in B lymphocyte responses. Science. 286:300303.
53 Gourzi, P., T. Leonova, and F.N. Papavasiliou. 2007. Viral induction of AID is independent of the interferon and the Toll-like receptor signaling pathways but requires NF-
B. J. Exp. Med. 204:259265.
54 Kallies, A., J. Hasbold, D.M. Tarlinton, W. Dietrich, L.M. Corcoran, P.D. Hodgkin, and S.L. Nutt. 2004. Plasma cell ontogeny defined by quantitative changes in blimp-1 expression. J. Exp. Med. 200:967977.
55 Casola, S., G. Cattoretti, N. Uyttersprot, S.B. Koralov, J. Segal, Z. Hao, A. Waisman, A. Egert, D. Ghitza, and K. Rajewsky. 2006. Tracking germinal center B cells expressing germ-line immunoglobulin gamma1 transcripts by conditional gene targeting. Proc. Natl. Acad. Sci. USA. 103:73967401.
Related Article
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|