|
|
|
|
|
|
|
||
ARTICLE |
CORRESPONDENCE Janet Stavnezer: Janet.Stavnezer{at}umassmed.edu
 Top ABSTRACT RESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Ig class switch recombination (CSR) occurs by intrachromosomal deletion and results in the exchange of antibody constant regions, thereby improving the effector function of the humoral immune response. Recombination between the switch (S) regions located 5' of each constant region gene (except C
) results in CSR (1). DNA double-stranded breaks (DSBs) in the S regions are essential intermediates in the recombination process. In recent years, much progress has been made toward understanding the molecular mechanism of CSR because of the discovery that the enzyme activation-induced cytidine deaminase (AID) is required for CSR (2, 3). Compelling data show that AID initiates the formation of DSBs by deamination of cytosines, generating uracils in S regions (4–7). The base excision repair enzyme uracil DNA glycosylase (UNG) subsequently excises the uracils, resulting in abasic sites, and mice and humans deficient in UNG have greatly reduced CSR and S region DSBs (6–8). How the abasic sites in S regions are converted to DNA breaks during CSR is unknown. In the base excision repair pathway, the enzyme that acts subsequent to UNG is apurinic/apyrimidinic endonuclease (APE), which nicks the DNA backbone at abasic sites to create DNA single-stranded (SS) breaks (SSBs) (9–11). DNA SS nicks that are spaced sufficiently close on opposite DNA strands could form a DSB spontaneously. However, during normal base excision repair, the SSBs introduced by APE do not progress to DSBs but are instead repaired by DNA polymerase β and ligase. During CSR, DNA abasic sites resulting from UNG activity might be cleaved by APE, but no evidence for involvement of APE in CSR has been reported.
In mammals, two homologues of the Escherichia coli exonuclease III have been cloned and characterized, representing the APEs. APE1 is considered to be the main APE: it is essential for early embryonic development in mice and for the viability of human cell lines (12, 13). APE1 has strong endonuclease activity and weak 3'-5' exonuclease and 3'-phosphodiesterase activities (14, 15). In addition to its function in base excision repair, APE1 also regulates transcription factors such as p53, activator protein 1, Myb, and NF-
B, although the mechanism is not yet clear (16–19). However, the yeast Apn1 protein, which lacks the ability to stimulate transcription factors, is able to restore viability of human cell lines in which APE1 expression was downmodulated using small interfering RNA (12). These results show that the transcription regulatory function of APE1 is not essential for cellular viability.
Much less is known about APE2, which is encoded on the X chromosome. APE2-deficient mice show a slight growth defect and have a twofold reduction of white blood cells in the periphery, mainly affecting T and B cells (20). Furthermore, splenocytes and thymocytes from these mice exhibit a moderate accumulation in the G2/M phase of the cell cycle upon mitogen stimulation (20). Enzyme assays using abasic site–containing oligonucleotide substrates showed that recombinant purified human APE2 has a weaker APE activity than APE1 (21). Its 3'-5' exonuclease activity, however, is strong compared with APE1 (14). It is not clear to what extent APE2 carries out these activities in vivo, but they are not required for embryonic development or cell viability because they are essentially normal in APE2-deficient mice. APE2 might be important for the repair of oxidative damage in mitochondrial DNA, as it has a putative mitochondrial targeting signal and was detected in mitochondria by electron microscopic immunocytochemistry and Western blotting (22, 23).
In this study, we demonstrate that both APE1 and APE2 are important for CSR, as we find reduced switching to all isotypes in splenic B cells from ape1+/–, ape2Y/–, and ape1+/–/ape2Y/– APE double-deficient (DBL) mice. Because APE2 is located on the X chromosome, we used APE2-deficient (ape2Y/–) male mice in all experiments. Linker ligation-mediated PCR (LM-PCR) analysis shows that DSBs in Sµ are greatly reduced in DBL B cells and, unlike DSBs in WT B cells, do not occur preferentially at the G:C bp or AID hotspots. Our data show that APE2 contributes considerably to the CSR mechanism, describing a new role for this protein.
 |
RESULTS |
|---|
|
TopABSTRACTRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
|
|
Class switching is reduced in ape1+/–, ape2Y/–, and DBL B cells
To determine the function of APE1 and APE2 in CSR, CFSE-stained splenic B cells from ape1+/–, ape2Y/–, and DBL mice were cultured for 3 d with LPS and specific combinations of cytokines that induce CSR to different isotypes, and analyzed by flow cytometry for surface Ig expression and cell division. In each experiment, WT littermates from ape1+/– and ape2+/– crossbreedings were used as controls. An example of a FACS analysis showing switching to IgG1 and IgG2a in the different genotypes is shown in Fig. 3 A.
Overall, CSR is reduced in ape1+/– B cells to a mean of 77 ± 4.9% (SEM) of WT (Fig. 3 B). Ape2Y/– B cells show a reduction to 65 ± 3.9% of WT, comparable to the reduction observed in DBL mice (64 ± 2.7%). The reduction in CSR is highly significant for all three genotypes (P < 0.001). Fig. 3 C shows that switching to each of the isotypes tested is reduced in the APE-deficient B cells. The reduction in switching reaches significance for the IgG2b and IgG3 isotypes in ape1+/– B cells and for the IgG1, IgG2a, and IgG2b isotypes in ape2Y/– B cells, whereas all isotypes are significantly reduced in DBL B cells. These results indicate that both APE1 and APE2 are involved in CSR.
|
|
|
3 junctions from B cells induced to switch to IgG3 from DBL and WT cells. No significant differences were detected in the lengths of junctional microhomology (Fig. S2, available at http://www.jem.org/cgi/content/full/jem.20071289/DC1), suggesting that APE1 and APE2 are not involved in the processing of DNA ends during the formation of S–S junctions.
DSBs in Sµ are reduced in ape1+/–, ape2Y/–, and DBL B cells
To determine whether the DSBs in S regions observed during CSR are dependent on APE1 and APE2, splenic B cells from WT, ape1+/–, ape2Y/–, and DBL mice were stimulated with LPS plus IL-4 or LPS plus anti–-dextran for 2 d, genomic DNA was isolated, and DSBs in the Sµ region were detected by LM-PCR using primers specific for the 5' or 3' ends of Sµ. Using this assay, we have previously demonstrated that blunt DSBs in Sµ are AID- and UNG-dependent in switching B cells (7). Fewer blunt Sµ breaks are detected in switching B cells from ape1+/– and ape2Y/– mice than from WT mice, although the reduction varies between experiments (Fig. 6).
However, we consistently detect very few breaks in B cells from DBL mice. Moreover, treatment of DNA with T4 polymerase to fill in or excise SS overhangs from staggered DSBs before linker ligation increased the number of detected breaks, but they were still reduced in B cells from ape1+/–, ape2Y/–, and DBL mice relative to WT B cells (Fig. S3, available at http://www.jem.org/cgi/content/full/jem.20071289/DC1). These results suggest that APE1 and APE2 act in CSR by cutting at abasic sites rather than functioning as exonucleases converting staggered DSBs into blunt breaks.
|
|
|
|
DISCUSSION |
|---|
|
TopABSTRACTRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
The finding that APE2 plays an important role in CSR is surprising, as it has been reported that APE2 has low endonuclease activity despite its highly conserved nuclease domain (15, 21). However, it must be noted that in these studies DNA incision activity was determined using partially purified human APE2 produced in E. coli (15, 21). In a more recent study, it was shown that purified human APE2 produced in S. cerevisiae possessed considerable endonuclease activity at physiological salt conditions (14). It is conceivable that cellular cofactors increase the endonuclease activity of APE2.
APE1 is a ubiquitous protein and is crucial during early embryogenesis and development, whereas APE2 is not required. The phenotype of APE2-deficient mice appears to be restricted to the lymphoid compartment, suggesting a special role for this protein in lymphoid cells (20). In agreement, we have shown in this study that APE2 is induced in B cells upon CSR stimulation, whereas APE1 appears to be constitutively expressed in B cell nuclei. These data suggest that APE2 might fulfill a specialized function related to B cell activation, resulting in the generation of DNA DSBs needed for recombination, whereas APE1 is required for the maintenance of global genome stability, which is APE2 independent.
By the use of in vitro cleavage assays with purified proteins, it has been suggested that Mre11–Rad50 cleaves DNA at abasic sites after AID and UNG action (29). However, whether the Mre11–Rad50 complex is actually involved in creating DNA breaks in S regions in vivo is unknown. The MRN complex, consisting of Mre11, Rad50, and Nbs1, is essential for the repair of DSBs and, therefore, is likely to be important for recombination between S regions during CSR (30–32). Cleavage of apurinic/apyrimidinic sites by Mre11–Rad50 would result in 3'-phospho-
,β-unsaturated aldehydes, which must be removed before DNA polymerases can extend from the 3' end. Both APE1 and APE2 are capable of removing such 3' groups either through their lyase or exonuclease activity (14, 33); thus, in principle it is possible that Mre11–Rad50, APE1, and APE2 act in the same pathway during CSR.
Our observation that CSR is not ablated in B cells from DBL mice or in CRT0044876-treated B cells can be explained in several ways. First, the remaining APE1 allele in DBL mice might be responsible for sufficient APE1 activity, resulting in reduced but sufficient DSBs for recombination. It has been recently shown that even a single DSB in Sµ and a downstream S region allows CSR (34). The notion that S region breaks are not limiting during CSR provides an explanation for the relatively mild CSR defect observed in our study (
35% reduction in DBL B cells), whereas the number of DSBs are reduced to a much greater extent in B cells from DBL mice. Conversely, it was recently found that in DNA polymerase β–deficient B cells, a two- to threefold increase in DSBs results in only a modest CSR increase (35).
Elimination of all APE1 protein or function leads to rapid cell death (36), hampering assessment of the contribution of the remaining APE1 to DSB formation in CSR (12). Thus, complete inhibition of APE function was probably not achieved by the CRT0044876 dosage used in this study, but a further dose increase resulted in decreased proliferation and considerable cell death, preventing analysis of CSR.
Second, persistent abasic sites, as would be expected in these B cells, might have an intrinsic fragility in vivo, which when closely spaced might result in DSB formation. It has been shown that abasic DNA is highly unstable in vitro and undergoes spontaneous strand cleavage 3' to the abasic site, especially under alkaline conditions (37, 38).
Third, abasic sites might be cleaved by topoisomerase II during DNA replication (39). However, we have found that AID-dependent S region DSBs are made and resolved in the G1 phase of the cell cycle, arguing against a role for replication in the generation of DSBs (40).
Fourth, transcription is arrested when it encounters an abasic site, which might recruit transcription-coupled nt excision repair (NER) proteins capable of cleaving the DNA backbone (41). However, we have found that the gene for xeroderma pigmentosum A, which encodes an essential component of the NER pathway, is dispensable for CSR (40). It is possible that this pathway might be used when APEs are reduced or absent, but whether this is physiologically relevant in WT cells is questionable (42). Furthermore, SSBs introduced by NER would not specifically occur at the G:C bp (43), whereas the DSBs and staggered DSBs detected in Sµ regions in WT B cells occur specifically at the G:C bp (7, 44).
Fifth, the recently described endonuclease activity of MutL (Mlh1-Pms2 heterodimer) might be responsible for some SSBs, although the possibility that this activity leads to DSBs is unlikely, as the endonuclease activity is targeted only to previously nicked DNA strands, and the sites of SSBs introduced by MutL are not likely to be restricted to the G:C bp (45). Moreover, we found that B cells from pms2–/– mice did not show a greater reduction in CSR when treated with CRT0044876 than B cells from WT mice (unpublished data).
Finally, a novel APE termed PALF/APLF/XIP1 (PNK- and APTX-like FHA protein), which was recently identified in human cells (46–48), might contribute to the remaining abasic-site cleavage activity in CRT0044876-treated or DBL B cells. It is unknown, however, if this protein is expressed in B cells.
APE deficiency did not affect the frequency of mutations in the 5' region of the unrecombined (germline) Sµ segment but did result in a decreased proportion of mutations at A:T bp's. It was possible that accumulation of abasic sites in the Sµ region followed by replication would result in an increased mutation frequency, especially at G:C bp's. However, the decrease in SSBs at abasic sites in APE-deficient B cells might also reduce Sµ mutations, as there are fewer entry sites for exonuclease1 and subsequent repair by error-prone polymerase.
In conclusion, our studies are consistent with a model for CSR in which abasic sites generated by AID and UNG activity are converted to SSBs in an APE1- and APE2- dependent fashion. Further studies are required to determine the relative contribution of APE1 and APE2, and to establish if APE2 has special functions that favor its participation in CSR.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Splenic B cell isolation and culture.
Single-cell suspensions were prepared from the spleens of 2–5-mo-old mice by mechanical dispersion, and RBCs were lysed in Gey's solution. B cells were enriched by guinea pig complement lysis of T cells using a cocktail of anti–T cell antibodies, as previously described (49). For CSR analysis, cells stained with CFSE (Invitrogen) were cultured at 105 cells per milliliter in 24-well plates and activated for switching to the different Ig isotypes. Cultures contained 50 µg/ml LPS (Sigma-Aldrich) and 100 ng/ml human BLyS (Human Genome Sciences). For IgG1 switching, 800 U/ml IL-4 was added; for IgG2a switching, 10 U/ml IFN- was added; for IgG2b switching, 30 µg/ml dextran sulfate (GE Healthcare) was added; for IgG3 switching, 0.3 ng/ml anti–-dextran (a gift from C. Snapper, Uniformed Services University of the Health Sciences, Bethesda, MD) was added; and for IgA switching, 2 ng/ml TGF-β (R&D Systems), 800 U/ml IL-4, 1.5 ng/ml IL-5 (BD Biosciences), and 0.3 ng/ml anti–-dextran were added. For LM-PCR analysis, cells were cultured at 2 x 105 cell per milliliter in sixwell plates and activated for 2 d, as previously described (7). A 1-M stock solution of the selective APE1 inhibitor CRT0044876 (Maybridge Trevillett) was made in DMSO, and working stocks of 100 and 200 mM (1,000x) were prepared freshly in DMSO for each experiment. CRT0044876 was added at the start of the culture and again after 24 h of culture. An equal amount of DMSO was added to untreated control cultures.
Flow cytometry.
For FACS analysis, cells were washed twice with PBS, 1% FCS, and 0.2% NaN3, and were incubated for 30 min on ice with PE–goat F(ab')2 anti–mouse IgG1, IgG2b, and IgG3 and PE–goat anti–mouse IgA (SouthernBiotech). For CFSE labeling, cells were washed in HBSS (Invitrogen) and resuspended at 40 x 106 cells per milliliter. An equal volume of 2 µM CFSE was added, and cells were incubated at 37°C for 15 min, quenched in 100% FCS, and washed twice with medium containing 10% FCS. For splenic B cell subset analysis, cells were stained with anti-B220 allophycocyanin (RA3-6B2; Invitrogen), anti-CD23 PE (2G8; SouthernBiotech), anti-CD21 FITC (7G6; BD Biosciences), and biotinylated anti-CD24 (Invitrogen), followed by streptavidin-PerCP (BD Biosciences). CFSE fluorescence and antibody staining were acquired on a flow cytometer (LSR; BD Biosciences) and analyzed using the FlowJo software package (Tree Star Inc.).
Western blotting.
Cytoplasmic and nuclear extracts were prepared by resuspending cells in hypotonic buffer (10 mM Hepes [pH 8], 1 mM EDTA, 10 mM KCl, 0.1 mM EGTA, 1 mM DTT, 2 µM pepstatin, and complete protease inhibitor cocktail [Roche]). After a 15-min incubation on ice, cells were lysed by the addition of NP-40 to a final concentration of 0.625%. Supernatants were taken as cytoplasmic extracts. Nuclei were washed once with hypotonic buffer and resuspended in hypertonic buffer (20 mM Hepes [pH 8], 1 mM EDTA, 400 mM NaCl, 1 mM EGTA, 1 mM DTT, 2 µM pepstatin, and complete protease inhibitor cocktail). For whole-cell extracts, cells were lysed in RIPA buffer (150 mM NaCl, 0.5% deoxycholate, 0.1% SDS, 1% NP-40, 50 mM Tris-Cl, and complete protease and phosphatase inhibitor cocktail) and subjected to three freeze–thaw cycles. The protein content of cytoplasmic, nuclear, and whole-cell extracts was determined using the Bradford assay (Bio-Rad Laboratories). Equal amounts of proteins were electrophoresed on 8% SDS-polyacrylamide gels or 4–20% gradient SDS-polyacrylamide gels (Thermo Fisher Scientific) and blotted onto polyvinylidene fluoride membranes (Immobilon-P; Millipore). Immunoblotting was done using rabbit–-anti-APE1, rabbit–anti-APE2 (AnaSpec Inc.), rabbit–anti-GAPDH (Santa Cruz Biotechnology, Inc.), and mouse–anti–TATA box–binding protein 1 (Abcam), followed by goat–anti–rabbit horseradish peroxidase (HRP) or donkey–anti–mouse HRP (Santa Cruz Biotechnology, Inc.), and enhanced chemiluminescent substrate (Thermo Fisher Scientific).
ARP assay for quantification of abasic sites in DNA.
Abasic sites in living cells were measured as previously described (50). B cells stimulated with LPS and IL-4 for 2 d were resuspended in PBS plus 5 mM glucose at 106 cells per milliliter and incubated with 1 mM of biotin-containing ARP N'-aminooxy-methylcarbonyl hydrazino-D-biotin (Invitrogen) for 60 min at 37°C. Cells incubated with 5 mM methyl methanesulfonate (Sigma-Aldrich) were used as a positive control. Cells were washed twice with ice-cold PBS, and DNA was isolated using DNeasy columns (QIAGEN). For each sample, 700 ng DNA was resuspended in 200 µl of 10-mM Tris (pH 9), 15 µl of 5-M NaCl, and 30 µl of a 1:120 dilution of avidin-conjugated HRP (Thermo Fisher Scientific) was added, and the mixture was incubated for 1 h at room temperature. DNA–HRP complexes were precipitated by the addition of 65 µl of 1-mM DNA precipitation agent (DAPER; Sigma-Aldrich). Precipitated DNA–HRP was washed twice with wash buffer (1% BSA, 0.17 M NaCl, 20 mM Tris [pH 8], 0.25% Tween 20), resuspended in 500 µl of ice-cold 50-mM sodium-citrate (pH 5.3), and sonicated 10 times for 2 s at an output of 3 W. HRP activity was measured by use of a substrate kit (TMB ImmunoPure; Thermo Fisher Scientific).
Genomic DNA preparation and linker LM-PCR.
After culture for 2 d, viable cells were isolated by flotation on Ficoll-Hypaque gradients (P = 1.09) or Lympholyte (Cedar Lane), cells were imbedded in low-melt agarose plugs, and DNA was isolated as previously described (7). For linker ligation, 50 µl of 1x ligase buffer was added to the plugs, which were then heated to 62°C to melt the agarose. 20 µl DNA (10,000 cell equivalents) was added to 2 µl T4 DNA ligase (2 Weiss units; MBI Fermentas), 10 µl of DS annealed linker in 1x ligase buffer, 3 µl of 10x ligase buffer, and 30 µl dH2O and incubated overnight at 18°C. Linker was prepared by annealing 5 nmol each of LMPCR.1 (5'-GCGGTGACCCGGGAGATCTGAATTC-3') and LMPCR.2 (5'-GAATTCAGATC-3') in 300 µl of 1x ligase buffer, which results in a DS oligo with a 14-nt SS overhang that can only ligate unidirectionally. Ligated DNA samples were heated at 70°C for 10 min, diluted 5x in dH2O, and assayed for gapdh DNA by PCR to adjust DNA input before LM-PCR. The primers 5' Sµ (5'-GCAGAAAATTTAGATAAAATGGATACCTCAGTGG-3'; Integrated DNA Technologies) or 3' Sµ (5'-GCTCATCCCGAACCATCTCAACCAGG-3') were used in conjunction with the linker primer (LMPCR.1) to amplify DNA breaks. Threefold dilutions of input DNA (0.5, 1.5, and 4.5 µl) were amplified by HotStar Taq (QIAGEN) using a touchdown PCR program. PCR products were electrophoresed on 1.25% agarose gels and vacuum blotted (VacuGene XL; GE Healthcare) onto nylon membranes (GeneScreen Plus; PerkinElmer). Blots were hybridized with an Sµ-specific oligonucleotide probe (µ probe 5', AGGGACCCAGGCTAAGAAGGCAAT for 5' Sµ LM-PCR; or µ probe 3', CCTGTCCTGCTTGGCTTCCCTCTG for 3' Sµ LM-PCR) end labeled with -[32P]ATP at 37°C overnight and washed at 55°C with 2x SSC/0.1% SDS. LM-PCR products were cloned into the vector pCR4-TOPO (Invitrogen) and sequenced by Macrogen using T3 and T7 primers. Cloned breaks in Sµ were aligned with germline Sµ sequenced from C57BL/6 chromosome 12 (available from GenBank/EMBL/DDBJ under accesion no. AC073553), with numbering starting at nt 136,645. This is the 5' Sµ primer binding site and is 800 nt's upstream of the beginning of the tandem repeats.
PCR amplification of germline Sµ segments.
Sµ PCR was performed as previously described (51). Genomic DNA was isolated from B cells stimulated for 4 d with either LPS plus IL-4 or LPS plus anti–-dextran. The primers used for germline Sµ PCR were 5µ3 (5'-AATGGATACCTCAGTGGTTTTTAATGGTGGGTTA-3') and 3µ2 (5'-AGAGGCCTAGATCCTGGCTTCTCAAGTAG-3'). The 3-kb PCR products were excised from agarose gels and cloned into pCR4-TOPO and sequenced by Macrogen using T7 primers.
Online supplemental material.
Fig. S1 shows the overlay CFSE fluorescence histograms of ex vivo B cells immediately after CFSE staining and after 3 d of culturing with LPS, BLyS, and IL-4 and different doses of CRT0044876. Fig. S2 shows the Sµ–S3 junction microhomology in splenic B cells from WT and DBL mice cultured for 4 d with LPS, BLyS, and anti–-dextran. Fig. S3 shows a Southern blot to compare the blunt and staggered Sµ DSBs detected by LM-PCR after T4 DNA–polymerase polishing. Table S1 shows the sites of staggered DSBs in WT and APE-deficient cells. Online supplemental material is available at http://www.jem.org/cgi/content/full/jem.20071289/DC1.
|
Acknowledgments |
|---|
This work was supported by National Institutes of Health grants RO1 AI065639 (to C.E. Schrader), and RO1 AI23283 and RO1 AI63026 (to J. Stavnezer). J.E.J. Guikema is supported by a postdoctoral fellowship from the Cancer Research Institute.
The authors have no conflicting financial interests.
Submitted: 25 June 2007
Accepted: 18 October 2007
|
REFERENCES |
|---|
|
TopABSTRACTRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
1 Manis, J.P., M. Tian, and F.W. Alt. 2002. Mechanism and control of class-switch recombination. Trends Immunol. 23:31–39.[CrossRef][Medline]
2 Muramatsu, M., K. Kinoshita, S. Fagarasan, S. Yamada, Y. Shinkai, and T. Honjo. 2000. Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell. 102:553–563.[CrossRef][Medline]
3 Revy, P., T. Muto, Y. Levy, F. Geissmann, A. Plebani, O. Sanal, N. Catalan, M. Forveille, R. Dufourcq-Labelouse, A. Gennery, et al. 2000. Activation-induced cytidine deaminase (AID) deficiency causes the autosomal recessive form of the Hyper-IgM syndrome (HIGM2). Cell. 102:565–575.[CrossRef][Medline]
4 Petersen-Mahrt, S.K., R.S. Harris, and M.S. Neuberger. 2002. AID mutates E. coli suggesting a DNA deamination mechanism for antibody diversification. Nature. 418:99–103.[Medline]
5 Chaudhuri, J., and F.W. Alt. 2004. Class-switch recombination: interplay of transcription, DNA deamination and DNA repair. Nat. Rev. Immunol. 4:541–552.[CrossRef][Medline]
6 Rada, C., G.T. Williams, H. Nilsen, D.E. Barnes, T. Lindahl, and M.S. Neuberger. 2002. Immunoglobulin isotype switching is inhibited and somatic hypermutation perturbed in UNG-deficient mice. Curr. Biol. 12:1748–1755.[CrossRef][Medline]
7 Schrader, C.E., E.K. Linehan, S.N. Mochegova, R.T. Woodland, and J. Stavnezer. 2005. Inducible DNA breaks in Ig S regions are dependent on AID and UNG. J. Exp. Med. 202:561–568.
8 Imai, K., G. Slupphaug, W.I. Lee, P. Revy, S. Nonoyama, N. Catalan, L. Yel, M. Forveille, B. Kavli, H.E. Krokan, et al. 2003. Human uracil-DNA glycosylase deficiency associated with profoundly impaired immunoglobulin class-switch recombination. Nat. Immunol. 4:1023–1028.[CrossRef][Medline]
9 Strauss, P.R., W.A. Beard, T.A. Patterson, and S.H. Wilson. 1997. Substrate binding by human apurinic/apyrimidinic endonuclease indicates a Briggs-Haldane mechanism. J. Biol. Chem. 272:1302–1307.
10 Strauss, P.R., and N.E. O'Regan. Abasic site repair in higher eukaryotes. In DNA Damage and Repair, vol. III. J.A. Nickoloff and M.F. Hoekstra, editors. 2001. Humana Press, Totowa, NJ. 43–86.
11 Christmann, M., M.T. Tomicic, W.P. Roos, and B. Kaina. 2003. Mechanisms of human DNA repair: an update. Toxicology. 193:3–34.[CrossRef][Medline]
12 Fung, H., and B. Demple. 2005. A vital role for Ape1/Ref1 protein in repairing spontaneous DNA damage in human cells. Mol. Cell. 17:463–470.[CrossRef][Medline]
13 Xanthoudakis, S., R.J. Smeyne, J.D. Wallace, and T. Curran. 1996. The redox/DNA repair protein, Ref-1, is essential for early embryonic development in mice. Proc. Natl. Acad. Sci. USA. 93:8919–8923.
14 Burkovics, P., V. Szukacsov, I. Unk, and L. Haracska. 2006. Human Ape2 protein has a 3'-5' exonuclease activity that acts preferentially on mismatched base pairs. Nucleic Acids Res. 34:2508–2515.
15 Hadi, M.Z., K. Ginalski, L.H. Nguyen, and D.M. Wilson III. 2002. Determinants in nuclease specificity of Ape1 and Ape2, human homologues of Escherichia coli exonuclease III. J. Mol. Biol. 316:853–866.[CrossRef][Medline]
16 Hanson, S., E. Kim, and W. Deppert. 2005. Redox factor 1 (Ref-1) enhances specific DNA binding of p53 by promoting p53 tetramerization. Oncogene. 24:1641–1647.[CrossRef][Medline]
17 Hirota, K., M. Matsui, S. Iwata, A. Nishiyama, K. Mori, and J. Yodoi. 1997. AP-1 transcriptional activity is regulated by a direct association between thioredoxin and Ref-1. Proc. Natl. Acad. Sci. USA. 94:3633–3638.
18 Jayaraman, L., K.G. Murthy, C. Zhu, T. Curran, S. Xanthoudakis, and C. Prives. 1997. Identification of redox/repair protein Ref-1 as a potent activator of p53. Genes Dev. 11:558–570.
19 Xanthoudakis, S., G. Miao, F. Wang, Y.C. Pan, and T. Curran. 1992. Redox activation of Fos-Jun DNA binding activity is mediated by a DNA repair enzyme. EMBO J. 11:3323–3335.[Medline]
20 Ide, Y., D. Tsuchimoto, Y. Tominaga, M. Nakashima, T. Watanabe, K. Sakumi, M. Ohno, and Y. Nakabeppu. 2004. Growth retardation and dyslymphopoiesis accompanied by G2/M arrest in APEX2-null mice. Blood. 104:4097–4103.
21 Hadi, M.Z., and D.M. Wilson III. 2000. Second human protein with homology to the Escherichia coli abasic endonuclease exonuclease III. Environ. Mol. Mutagen. 36:312–324.[CrossRef][Medline]
22 Akbari, M., M. Otterlei, J. Pena-Diaz, and H.E. Krokan. 2007. Different organization of base excision repair of uracil in DNA in nuclei and mitochondria and selective upregulation of mitochondrial uracil-DNA glycosylase after oxidative stress. Neuroscience. 145:1201–1212.[CrossRef][Medline]
23 Tsuchimoto, D., Y. Sakai, K. Sakumi, K. Nishioka, M. Sasaki, T. Fujiwara, and Y. Nakabeppu. 2001. Human APE2 protein is mostly localized in the nuclei and to some extent in the mitochondria, while nuclear APE2 is partly associated with proliferating cell nuclear antigen. Nucleic Acids Res. 29:2349–2360.
24 Raffoul, J.J., D.C. Cabelof, J. Nakamura, L.B. Meira, E.C. Friedberg, and A.R. Heydari. 2004. Apurinic/apyrimidinic endonuclease (APE/REF-1) haploinsufficient mice display tissue-specific differences in DNA polymerase beta-dependent base excision repair. J. Biol. Chem. 279:18425–18433.
25 Meira, L.B., S. Devaraj, G.E. Kisby, D.K. Burns, R.L. Daniel, R.E. Hammer, S. Grundy, I. Jialal, and E.C. Friedberg. 2001. Heterozygosity for the mouse Apex gene results in phenotypes associated with oxidative stress. Cancer Res. 61:5552–5557.
26 Izumi, T., W.D. Henner, and S. Mitra. 1996. Negative regulation of the major human AP-endonuclease, a multifunctional protein. Biochemistry. 35:14679–14683.[CrossRef][Medline]
27 Madhusudan, S., F. Smart, P. Shrimpton, J.L. Parsons, L. Gardiner, S. Houlbrook, D.C. Talbot, T. Hammonds, P.A. Freemont, M.J. Sternberg, et al. 2005. Isolation of a small molecule inhibitor of DNA base excision repair. Nucleic Acids Res. 33:4711–4724.
28 Rada, C., J.M. Di Noia, and M.S. Neuberger. 2004. Mismatch recognition and uracil excision provide complementary paths to both Ig switching and the A/T-focused phase of somatic mutation. Mol. Cell. 16:163–171.[CrossRef][Medline]
29 Larson, E.D., W.J. Cummings, D.W. Bednarski, and N. Maizels. 2005. MRE11/RAD50 cleaves DNA in the AID/UNG-dependent pathway of immunoglobulin gene diversification. Mol. Cell. 20:367–375.[CrossRef][Medline]
30 Kracker, S., Y. Bergmann, I. Demuth, P.O. Frappart, G. Hildebrand, R. Christine, Z.Q. Wang, K. Sperling, M. Digweed, and A. Radbruch. 2005. Nibrin functions in Ig class-switch recombination. Proc. Natl. Acad. Sci. USA. 102:1584–1589.
31 Lahdesmaki, A., A.M. Taylor, K.H. Chrzanowska, and Q. Pan-Hammarstrom. 2004. Delineation of the role of the Mre11 complex in class switch recombination. J. Biol. Chem. 279:16479–16487.
32 Reina-San-Martin, B., M.C. Nussenzweig, A. Nussenzweig, and S. Difilippantonio. 2005. Genomic instability, endoreduplication, and diminished Ig class-switch recombination in B cells lacking Nbs1. Proc. Natl. Acad. Sci. USA. 102:1590–1595.
33 Demple, B., and L. Harrison. 1994. Repair of oxidative damage to DNA: enzymology and biology. Annu. Rev. Biochem. 63:915–948.[CrossRef][Medline]
34 Zarrin, A.A., C. Del Vecchio, E. Tseng, M. Gleason, P. Zarin, M. Tian, and F.W. Alt. 2007. Antibody class switching mediated by yeast endonuclease-generated DNA breaks. Science. 315:377–381.
35 Wu, X., and J. Stavnezer. 2007. DNA polymerase β is able to repair breaks in switch regions and plays an inhibitory role during immunoglobulin class switch recombination. J. Exp. Med. 204:1677–1689.
36 Izumi, T., D.B. Brown, C.V. Naidu, K.K. Bhakat, M.A. Macinnes, H. Saito, D.J. Chen, and S. Mitra. 2005. Two essential but distinct functions of the mammalian abasic endonuclease. Proc. Natl. Acad. Sci. USA. 102:5739–5743.
37 Kupfer, P.A., and C.J. Leumann. 2007. The chemical stability of abasic RNA compared to abasic DNA. Nucleic Acids Res. 35:58–68.
38 Lindahl, T., and A. Andersson. 1972. Rate of chain breakage at apurinic sites in double-stranded deoxyribonucleic acid. Biochemistry. 11:3618–3623.[CrossRef][Medline]
39 Wilstermann, A.M., and N. Osheroff. 2001. Base excision repair intermediates as topoisomerase II poisons. J. Biol. Chem. 276:46290–46296.
40 Schrader, C.E., J.E. Guikema, E.K. Linehan, E. Selsing, and J. Stavnezer. 2007. Activation-induced cytidine deaminase–dependent DNA breaks in class switch recombination occur during G1 phase of the cell cycle and depend upon mismatch repair. J. Immunol. 179:6064–6071.
41 Tornaletti, S., L.S. Maeda, and P.C. Hanawalt. 2006. Transcription arrest at an abasic site in the transcribed strand of template DNA. Chem. Res. Toxicol. 19:1215–1220.[CrossRef][Medline]
42 Spivak, G., and P.C. Hanawalt. 2006. Host cell reactivation of plasmids containing oxidative DNA lesions is defective in Cockayne syndrome but normal in UV-sensitive syndrome fibroblasts. DNA Repair (Amst.). 5:13–22.[CrossRef][Medline]
43 Hoeijmakers, J.H. 2001. Genome maintenance mechanisms for preventing cancer. Nature. 411:366–374.[CrossRef][Medline]
44 Stavnezer, J., and C.E. Schrader. 2006. Mismatch repair converts AID-instigated nicks to double-strand breaks for antibody class-switch recombination. Trends Genet. 22:23–28.[CrossRef][Medline]
45 Kadyrov, F.A., L. Dzantiev, N. Constantin, and P. Modrich. 2006. Endonucleolytic function of MutLalpha in human mismatch repair. Cell. 126:297–308.[CrossRef][Medline]
46 Kanno, S., H. Kuzuoka, S. Sasao, Z. Hong, L. Lan, S. Nakajima, and A. Yasui. 2007. A novel human AP endonuclease with conserved zinc-finger-like motifs involved in DNA strand break responses. EMBO J. 26:2094–2103.[CrossRef][Medline]
47 Bekker-Jensen, S., K. Fugger, J.R. Danielsen, I. Gromova, M. Sehested, J. Celis, J. Bartek, J. Lukas, and N. Mailand. 2007. Human Xip1 (C2ORF13) is a novel regulator of cellular responses to DNA strand breaks. J. Biol. Chem. 282:19638–19643.
48 Iles, N., S. Rulten, S.F. El Khamisy, and K.W. Caldecott. 2007. APLF (C2orf13) is a novel human protein involved in the cellular response to chromosomal DNA strand breaks. Mol. Cell. Biol. 27:3793–3803.
49 Schrader, C.E., W. Edelmann, R. Kucherlapati, and J. Stavnezer. 1999. Reduced isotype switching in splenic B cells from mice deficient in mismatch repair enzymes. J. Exp. Med. 190:323–330.
50 Atamna, H., I. Cheung, and B.N. Ames. 2000. A method for detecting abasic sites in living cells: age-dependent changes in base excision repair. Proc. Natl. Acad. Sci. USA. 97:686–691.
51 Schrader, C.E., S.P. Bradley, J. Vardo, S.N. Mochegova, E. Flanagan, and J. Stavnezer. 2003. Mutations occur in the Ig Smu region but rarely in Sgamma regions prior to class switch recombination. EMBO J. 22:5893–5903.[CrossRef][Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Facebook 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|
