SIRP knockdown alters the pattern of cytokine production in LPS-stimulated macrophages

View larger version (36K): [in this window] [in a new window] [Download PPT slide]   Figure 2. Increased cytokine production of SIRP knockdown macrophages upon LPS stimulation in vitro. (A) 5 x 105 cells/well SIRP-KD, -OV, and -VT cells were treated with different amounts of LPS for 12 or 24 h, after which culture supernatants were harvested for measurement of TNF, IL-6, and NO production. (B) Cytokine production by LPS-challenged peritoneal macrophages. 3 x 105 cells/well transfected with SIRP siRNA or negative control oligonucleotides. (C) Cytokine antibody array analysis of LPS-treated cytokine production in SIRP-KD and -OV cells. Cells were primed with 100 ng/ml LPS for 12 h, after which culture supernatants were harvested for the cytokine antibody array analysis. The density value of each test sample was normalized to control spots on the same membrane graphed. (D) 5 x 105 cells/well SIRP-KD, -OV, and -VT cells were primed with different amount of LPS for 12 h, after which culture supernatants were harvested for measurement of MIP-1 and RANTES by ELISA. (E) IFN-ß production after LPS challenge in stable RAW cell lines (left) or in peritoneal macrophages transfected with SIRP siRNA (right) were analyzed as mentioned above. (F) Cells were incubated with 100 ng/ml of LPS for the indicated time, and IFN-ß mRNA levels were determined by quantitative real-time PCR. (G) Cells were transfected with the ISRE reporter plasmid (0.2 µg), together with the control plasmid pRL-TK (0.02 µg), and treated with various doses of LPS for 6 h, and then luciferase activities were detected. The data are representative of three independent experiments with similar results. (H) Peritoneal macrophages from C57BL/6 mice were transfected with control or SIRP siRNA and then stimulated with 10 ng/ml of LPS for the indicated minutes. Cell lysates were blotted with anti–phospho-IRF3 and anti-GAPDH antibodies. Data are the mean ± the SEM of three independent experiments. *, P < 0.05; **, P < 0.01 (OV or KD different from VT in A, D, F, and G).

Interestingly, SIRP knockdown also substantially raised LPS-induced IFN-ß production and mRNA expression in either RAW cell line or mouse peritoneal macrophages (Fig. 2, E and F). In addition, the interferon-sensitive response element (ISRE) reporter activity was also increased in stably transfected RAW cell lines expressing shRNA for SIRP (Fig. 2 G). Because initial induction of IFN-ß is largely dependent on Trif-mediated IRF3 activation, we examined the phosphorylation of IRF3 upon LPS challenge and found that SIRP siRNA treatment evidently led to the enhanced LPS-induced IRF3 activation in mouse peritoneal macrophages (Fig. 2 H). Collectively, our data clearly indicate that SIRP regulates the expression profile of proinflammatory cytokines through both MyD88- and Trif-dependent pathways.

Transferring with SIRP-KD macrophages increases susceptibility of mice to lethal LPS shock
Because SIRP-KD macrophages exhibited a marked elevation in TNF, which plays an important role in the pathogenesis of septic shock (19), we asked whether mice transfered with SIRP-KD macrophages were more susceptible to LPS-induced toxicity. To determine whether RAW cells were capable of reconstituting macrophage-depleted allogeneic BALB/c mice (GdCl₃ pretreatment), RAW264.7 cells were stained with a fluorescent vital dye, SP-DiI, which was systemically delivered in vivo. The cells were analyzed by light and fluorescent microscopy in frozen sections 24 h after injection. As shown in Fig. 3 A, a large number of the injected RAW cells were found in the normal spleen, liver, and lung tissues, which is a typical distribution pattern for host-derived macrophages. Furthermore, the reconstituted mice showed a similar survival rate to the control normal mice after lethal dose challenge with LPS (Fig. 3 B). These results may support the feasibility of this model system. Next, age- and sex-matched cohorts of mice pretreated with GdCl₃ for 24 h were injected i.v with SIRP-KD, -OV, or -VT cells; after an additional 24 h, they were injected i.p. either with vehicle (PBS) or LPS. Survival of these animals was monitored over 4–5 d. As shown in Fig. 3 C, none of the SIRP-KD, -OV, and -VT mice injected with PBS showed a difference on survival. However, at a LPS dose of 20 mg/kg body weight, mortality was observed within 14 h after LPS challenge for KD mice. By 24 h, >50% of KD mice had died, whereas the first mortality for VT mice occurred at 24 h. Although 85% death was noted for KD mice by the end of the experiment (120 h), only 26 and 35% of the OV and VT mice had died. Therefore, KD mice were more susceptible to LPS-induced lethality.

View larger version (42K): [in this window] [in a new window] [Download PPT slide]   Figure 3. Increased response in mice transfered with SIRP knockdown macrophages upon LPS stimulation in vivo. (A) Reconstitution of macrophage-depleted mice with RAW264.7 cells. Fluorescent dye-labeled RAW264.7 cells were injected i.v. into GdCl3-treated Balb/C mice. Mouse organs (spleen, liver, and lung) were preserved for fluorescence microscopy analysis. Numerous injected cells are detectable in lung, spleen, and liver. Tissue morphology is visualized by hematoxylin staining. (B) Similar lethality in mice reconstituted with RAW264.7 cells challenged with LPS. Age- and sex-matched cohorts of mice (n = 6) were pretreated with GdCl3 (10 mg/kg of body weight) or PBS and, 24 h later, were i.v. injected with RAW264.7 cells (107/each) or PBS, respectively. Another 24 h later, mice were i.p. administered with 25 mg LPS/kg of body weight, and lethality was observed over 60 h after this challenge. The data are representative of two independent experiments with similar results. (C) More lethality in mice transfered with SIRP-KD cells challenged with LPS. Age- and sex-matched cohorts of mice (n = 7) were pretreated with GdCl3 (10 mg/kg of body weight), and 24 h later were i.v. injected with SIRP-KD, -OV, and -VT cells (107/each). Another 24 h later, mice were i.p. administered with PBS or 20 mg LPS/kg of body weight, and lethality was observed over 120 h after this challenge. The data are representative of two independent experiments with similar results. (D) Sera from mice pretreated as described in A and injected with PBS or LPS (10 mg/kg of body weight) were collected at 3 h after the challenge, and IL-6 and TNF levels were measured by ELISA. Data show the mean ± the SEM for three mice from each group. *, P < 0.05; **, P < 0.01 (OV or KD different from VT). (E) Severe multiple organ failure in mice transfered with SIRP-KD cells challenged with LPS. Representative images of lung and liver with histological sections from mice pretreated as described in C and killed at 24 h after LPS administration (10 mg/kg weight body). Bars, 100 µm.

To examine the effects of SIRP on the function of key organs, SIRP-KD, -OV, and -VT mice were challenged with LPS at a dose of 10 mg/kg body weight and killed 24 h after LPS injection. As shown in Fig. 3 E, KD mice challenged with LPS showed gross organ failure and severe inflammatory infiltrates in lung and liver, compared with OV and VT mice. Collectively, our results indicate that SIRP-KD mice are highly susceptible to the development of multiple organ failure syndromes after LPS administration, and that SIRP is required for the restriction of macrophage responses to LPS in vivo.

Endotoxin tolerance is SIRP independent
The aforementioned results, finding that SIRP down-regulated LPS-induced biological responses, prompted us to investigate whether SIRP is also important for mediating endotoxin tolerance, a transient state of LPS refractoriness after the initial, nonlethal exposure to LPS. To determine whether SIRP regulates the production of proinflammatory cytokines after LPS pretreatment, we first treated SIRP-KD, -OV, and -VT macrophages with LPS for 24 h, after which we assessed IL-6 and TNF production during a subsequent 12-h LPS treatment, or 24-h treatment for NO. SIRP-KD cells substantially elaborated increased amounts of TNF, IL-6, and NO during the first 12 h after exposure to LPS (Fig. 4 A). Their production by all SIRP-KD, -OV, and -VT macrophages was considerably reduced after 24 h of LPS pretreatment, indicating that SIRP is not required for LPS-induced down-regulation of cytokine production. Similarly, stimulation of cells with CpG or LPS for 24 h, followed by a second 12 or 24 h of LPS or CpG treatment, also resulted in decreased IL-6, TNF, and NO production by all cells (Fig. 4 B), suggesting that cross-tolerance between TLR4 and TLR9 apparently occurred independently of SIRP expression. We also performed these studies with peritoneal macrophages transiently transfected with synthetic SIRP siRNA and obtained similar results (Fig. 4 C). Thus, SIRP seems to regulate the magnitude and duration at the early "time window" of TLR-induced responses independently of previously described endotoxin tolerance mechanisms (20).

View larger version (30K): [in this window] [in a new window] [Download PPT slide]   Figure 4. SIRP is not required for endotoxin tolerance. (A) 5 x 105 cells/well SIRP-KD, -OV, and -VT cells were untreated or tolerized with 100 ng/ml LPS for 24 h, washed, and rechallenged with 100 ng/ml LPS. After 12 h of incubation, the media were assessed for TNF and IL-6, and for NO levels after 24 h. Data are presented as the mean ± the SEM of 3–8 independent experiments. (B) 5 x 105 cells/well SIRP-KD, -OV, and -VT cells were tolerized with LPS or CpG for 24 h, washed, and rechallenged with the indicated doses of LPS or CpG. TNF, IL-6, and NO levels were determined as described in A. (C) 3 x 105 cells/well peritoneal macrophages from C57BL/6 mice were transfected with either control or SIRP siRNA. 24 h later, cells were tolerized with LPS or CpG for 24 h, washed, and rechallenged with the indicated doses of LPS or CpG. TNF, IL-6, and NO levels were determined as described in A.

LPS-induced SIRP reduction contributes to macrophage activation

View larger version (59K): [in this window] [in a new window] [Download PPT slide]   Figure 5. LPS-induced SIRP reduction contributes to macrophage activation. (A) Stable RAW-derived cell lines (left) and peritoneal macrophages transiently transfected with either control or SIRP siRNA (right) were incubated with or without 100 ng/ml LPS for 12 h. Immunoblots with a TLR4-specific antibody were performed. (B) Down-regulation of SIRP protein levels in macrophages after LPS treatment. Mouse macrophage cell lines RAW264.7 and J774A.1, as well as peritoneal macrophages from C57BL/6 mice, were incubated with 100 ng/ml LPS for the indicated times (left) or with the indicated LPS doses for 12 h (right), and SIRP protein expression was determined by Western blotting. PWC, peritoneal macrophages. (C) Down-regulation of SIRP mRNA levels in macrophages after LPS treatment. RAW264.7 macrophages were incubated with 100 ng/ml of LPS for the indicated time (left), or with the indicated LPS doses for 12 h (right), and SIRP mRNA levels were determined by quantitative real-time PCR. (D) The reduction of SIRP protein level involves protein degradation. RAW264.7 cells were incubated for 2 h at 37°C in the absence or presence of 100 µM chloroquine, 10 µM NH4Cl, 40 µM MG132, or 50 µg/ml CHX, after which they were treated with or without 100 ng/ml LPS for 5 h and subjected to Western blot analysis using SIRP-specific antibody. (E) TLR4 is essential for the down-regulation of SIRP. Peritoneal macrophages from TLR4 KO (C57BL/10ScCr) and littermate WT1 (C57BL/10snj) mice or TLR4 mutant (C3H/HeJ) and littermate WT2 (C3H/Heouj) mice were incubated with 100 ng/ml LPS for the indicated times, and SIRP protein expression was determined by Western blot analysis.

SIRP is activated by LPS and binds constitutively to SHP-1 and -2
SIRP is a surface receptor containing immunoreceptor tyrosine–based inhibitory motif domains that are known to exert inhibitory functions through the recruitment of phosphatase enzymes SHP-1 and -2 (22). Thus, we investigated whether LPS treatment affected tyrosine phosphorylation of SIRP and its association with SHP-1 and -2 in macrophages. RAW264.7 cells were stimulated with LPS, and the endogenous SIRP was immunoprecipitated and subjected to immunoblot with respective antibodies. As shown in Fig. 6 A, LPS treatment induced tyrosine phosphorylation of SIRP, but failed to enhance SHP-1 and -2 recruitment. Interestingly, SHP-1 and -2 were found to be constitutively associated with SIRP in macrophages (Fig. 6 A), which coincided with the results of previous studies (23, 24). However, treatment of RAW cells with either the Src-specific inhibitor PP₂ or universal tyrosine kinase inhibitor Genistein nearly abrogated the constitutive association of SIRP with SHP-1 or -2, which suggests that the basal association of SHP proteins is dependent on the undetectable phosphorylation of SIRP (Fig. 6 B). In addition, PP₂ also blocked LPS-induced SIRP phosphorylation, indicating that such phosphorylation of SIRP is mainly mediated by Src kinases (Fig. 6 C).

View larger version (46K): [in this window] [in a new window] [Download PPT slide]   Figure 6. SIRP inhibits LPS signaling mainly through sequestration of SHP-2. (A) RAW264.7 cells were stimulated with LPS for the indicated time, immunoprecipitated for endogenous SIRP, and probed with an antiphosphotyrosine antibody. Immunoblots were also probed with anti-SIRP, –SHP-1, and –SHP-2 antibodies. (B) Basal association of SHP proteins is dependent on SIRP phosphorylation. RAW264.7 cells were treated with vehicle (DMSO), 10 µM PP2, or 50 µM genistein for 1 h, and then subjected to immunoprecipitation and immunoblot, as in A. (C) TLR4-induced SIRP phosphorylation is mediated by Src kinases. RAW264.7 cells were stimulated with LPS for 15 min in the absence or presence of DMSO, PP2, or genistein, and then subjected to immunoprecipitation and immunoblotting as in A. (D) Western blot analysis demonstrates the effects of siRNAs that specifically down-regulate SHP-1 or -2 expression in peritoneal macrophages. (E) Peritoneal macrophages transfected with SHP-1– or -2–specific siRNAs were stimulated with 100 ng/ml LPS for 12 h, and the production of TNF and IL-6 was determined using ELISA. Data are presented as the mean ± the SEM of 3–6 independent experiments. *, P < 0.05; **, P < 0.01 (SHP-1 or SHP2 siRNA different from negative control siRNA). (F) IFN-ß production after LPS challenge in peritoneal macrophages. 3 x 105 cells/well transfected with SHP-1– or -2–specific siRNAs was analyzed as in E. *, P < 0.05; **, P < 0.01 (SHP-1 or -2 siRNA different from negative control siRNA). (G) Peritoneal macrophages transfected with SHP-1 or -2 siRNAs or negative control oligonucleotides were stimulated with 10 ng/ml of LPS for the indicated times. Cell lysates were blotted with the indicated antibodies. (H) Peritoneal macrophages were transfected with SIRP-specific siRNA alone or together with SHP-1– or -2–specific siRNAs with subsequent LPS stimulation. The production of TNF and IL-6 were determined as described in E. *, P < 0.05; **, P < 0.01 (SIRP1/SHP-1 or SHP-2 double-knockdown is different from SIRP1 knockdown alone). (I) Rescue of cytokine production by reintroduction of WT SIRP. 2 x 106 cells/well SIRP-KD cells transfected with GFP, WT SIRP (WT), or its mutant form SIRP-4F (4F) were treated with 100 ng/ml LPS. The amounts of secreted TNF and IL-6 in supernatants were determined by ELISA as described in E. Data are the mean ± the SEM of three independent experiments. **, P < 0.01 (WT different from GFP).

To elucidate whether SHP-1 and -2 contribute to the inhibitory function of SIRP in macrophage activation, peritoneal macrophages were cotransfected with SIRP and SHP-1 siRNAs or SIRP and SHP-2 siRNAs to eliminate both proteins simultaneously. After LPS stimulation, the conditioned medium was analyzed for cytokine production. As shown in Fig. 6 H, knockdown of SHP-1, together with SIRP, slightly increased the production of TNF and IL-6 more than knockdown of SIRP alone, suggesting a synergetic role of SIRP and SHP-1 in suppressing LPS signaling. Conversely, knockdown of SHP-2 nearly reversed the hyperresponsive effects induced by SIRP depletion in response to LPS, which indicate that SIRP mainly functions through its association and sequestration of SHP-2 to prevent LPS-induced macrophage activation. In addition, transient overexpression of WT SIRP into SIRP-knockdown RAW cells restrained LPS-induced cytokine production, whereas its mutant form, SIRP-4F, which is incapable of binding to SHP-2, was unable to restore SIRP-mediated repression of LPS-inducible cytokine genes (Fig. 6 I). These data further indicate that SIRP acts via SHP-2 sequestration to negatively regulate TLR4 signaling.

SIRP prevents LPS responses through sequestration of SHP-2 from IKKs
As a previous study indicates that SHP-2 is an integral component of the IKK complex, and a functional SHP-2 is required for efficient phosphorylation of IB by the IKK complex in cellular response to IL-1/TNF (26), we next searched for physical evidence for SHP-2 involvement in the MyD88 and Trif pathways by coimmunoprecipitation experiments. As expected, LPS induced interaction of endogenous SHP-2 with IKKß and the IKK-like kinase TANK-binding kinase 1 (TBK1)/NAK (Fig. 7 A), both of which are critically important for activation of MyD88- and Trif-dependent signaling, respectively (27, 28). In contrast, SHP-1 could not be found in a complex with IKK (not depicted). Interestingly, compared with empty vector-transfected RAW cells, SIRP knockdown drastically enforced LPS-induced SHP-2–IKK association (Fig. 7 B), which strongly suggests that SIRP may compete with IKKs to bind SHP-2, thus compromising the essential role of SHP-2 in LPS signaling activation.

View larger version (48K): [in this window] [in a new window] [Download PPT slide]   Figure 7. SIRP prevents LPS-induced SHP-2–IKK complex formation. (A) RAW264.7 cells were treated with 100 ng/ml LPS for the indicated time period. Equal amounts of cell lysates were immunoprecipitated with SHP-2–specific antibody. Precipitated proteins and cell lysates were blotted with anti–SHP-2, anti-IKKß, and anti-TBK1 antibodies. (B) SIRP-KD, -OV, and -VT RAW cells were stimulated with 100 ng/ml LPS for the indicated minutes, immunoprecipitated for endogenous SHP-2, and probed with anti-IKKß, -TBK1, and –SHP-2 antibodies.

	DISCUSSION

Top ABSTRACT RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

A notable feature of SIRP is its ability to recruit and signal via the tyrosine phosphatases SHP-1 and -2. Therefore, it is likely that this feature is important for the negative regulatory role of SIRP in LPS-activated signaling. Although structurally very similar, these two phosphatases play quite different cellular roles. SHP-1 has been generally considered as a negative signal transducer, essentially as an antagonist of SHP-2. The data presented here suggests that SHP-1 plays a relatively minor role in suppressing LPS-induced TLR activation, which is consistent with a recent study that SHP-1 modestly inhibits LPS-mediated TNF and iNOS production in mouse macrophages (29). As double-knockdown of SHP-1 and SIRP induced a little more cytokine production than knockdown of SIRP alone, SHP-1 may represent a collaborating event in SIRP-mediated negative regulation of TLR signaling. On the other hand, our data provide direct evidence that SHP-2 plays a largely positive-signaling role in macrophage activation by LPS. By analyzing immune responses in macrophages lacking both SHP-2 and SIRP expression, we propose a model in which SIRP plays reciprocating roles in the temporal regulation of both pro- and antiinflammatory responses. In the initial phase of activation, macrophages have relatively high levels of SIRP protein, which probably acts as a scaffolding molecule to recruit SHP-2 in the vicinity of the cell membrane, thus preventing SHP-2 from activating downstream signaling pathways. Subsequently, the decrease in SIRP levels causes a disassociation of SHP-2 with SIRP, thus making SHP-2 available to mediate TLR signaling activation.

All TLRs are known to elicit conserved inflammatory pathways, culminating in the activation of two major kinase-mediated signaling pathways: the MAPK and IKK complexes, which transduce various upstream signals to the activation of AP-1, NF-B, and IRF3 transcription factors. Both SHP-1 and -2 have been shown to be necessary for growth factor–induced MAPK activation (30). However, whether SHP-1 and -2 regulate LPS-induced MAPK activation remains unknown. By knocking down the expression of SHP-1 and -2, we demonstrate that SHP-1 exerts inhibitory effects on MAPK activation, which is inconsistent with the observation that ERK activation occurred normally in mev/mev cells in response to LPS (17). It is likely that experimental variations in these experiments explain the differing results. In contrast, SHP-2 is seemingly indispensable for MAPK activation, as depletion of SHP-2 reduces macrophage responses to LPS. Previously, the effects of SIRP on growth factor–induced MAPK activation in epithelial or fibroblast cells have been controversially reported (15). We clearly show that SIRP negatively regulates LPS-induced MAPK activation in macrophages. Given that SHP-1 is highly expressed in macrophages and, at a much lower level, in epithelial or fibroblast cells, whereas SHP-2 is expressed in the opposite manner, it is possible that the dynamic interaction of SIRP with SHP-1 and -2 is crucial for proper regulation of the MAPKs by LPS or some growth factors in cells derived from different tissues. In addition to MAPKs, the NF-B pathway is also regulated either positively by SHP-2 (26, 31) or negatively by SHP-1 (18, 32). However, the molecular basis for SHP's activities in the NF-kB pathway is not yet fully understood. We show that SHP-2, but not SHP-1 (not depicted), forms an inducible complex with IKKß or TBK1 upon stimulating TLR4 with LPS, which appears to be required for NF-B and IRF3 activation, as the enforced SHP-2–IKK associations after SIRP knockdown are accompanied by the increased phosphorylation of IB and IRF3. Because SIRP preferentially associates with, and most probably sequesters, SHP-2, which is required for both MAPK and IKK activities, it most likely acts at the level of this phosphatase to negatively regulate TLR signaling.

TLR-induced cytokine production in innate immune cells is mediated mainly by MAPK- and IKK-dependent signals. By inactivating these two pathways, SIRP determines the window of synthesis of a variety of proinflammatory cytokines, including TNF and IL-6. However, unlike other negative regulators, such as IRAK-M or SOCS1, depletion of SIRP has no significant effect on IL-1 and IL-12p40 production after LPS challenge (Fig. 2 C), and both IL-1 and IL-12p40 are known to contribute to the lethal outcome of endotoxin shock. Furthermore, it appears that LPS induces a much more dramatic release of TNF and IL-6 in SIRP-KD macrophages than in IRAK-M– or SOCS1-deficient macrophages (33, 34). These results perhaps reflect the different mechanisms on which these regulators operate. Interestingly, it has been shown that ligation of SIRP with monoclonal antibody results in modest reduction of TNF production, possibly via inducing intracellular retention of the cytokine, but has no effect on other cytokine induction in response to LPS stimulation (35), which is inconsistent with the broad and drastic augmentation of proinflammatory cytokines in SIRP-depleted macrophages after LPS challenge. Considering that both MAPKs and IKKs positively regulate TNF synthesis (36, 37), knockdown of SIRP may mainly enhance both the stability and the translation of TNF mRNA, rather than modulate its secretion. It has been suggested that SIRP ligation may trigger signal cascades other than MPAKs or IKKs; e.g., the PI3K pathway to specifically reduce TNF release. In addition, SIRP ligation has also been shown to induce macrophages to produce NO, thus indicating a positive effect of SIRP (23). However, the level of H₂O₂ is increased after SIRP ligation, and is found to be essential for the SIRP-induced production of NO, so it is difficult to distinguish between effects that result from a direct activation of SIRP signaling or an indirect activation as a consequence of increased ROS production, or both. Future studies should elucidate more precisely whether and how these pathways integrate and translate into the various cellular functions that are regulated by SIRP in macrophages and other cells.

In summary, we have shown that SIRP plays a critically negative role in macrophage activation. LPS-induced SIRP down-regulation is required for inducing optimal strength and duration of the TLR signaling. SIRP therefore functions as a "homeostatic" effector in innate immunity. The basal level of SIRP in macrophages may represent a threshold for maintaining a non-/antiinflammatory environment. SIRP is likely to become a rational pharmacological target for treatment of patients with autoimmunity, chronic inflammation, or infectious diseases.

	MATERIALS AND METHODS

Top ABSTRACT RESULTS DISCUSSION MATERIALS AND METHODS REFERENCES

 
Antibodies and reagents.
Antibodies specific for phosphorylated JNK, p38, and ERK, as well as total ERK, JNK, p38, and Myc-tag, were all purchased from Cell Signaling Technology; anti–phospho-IB, IB, SHP-1, and SHP-2 antibodies were obtained from Santa Cruz Biotechnology. Rabbit polyclonal SIRP antibody was generated in our laboratory against residues in the cytoplasmic domain. Mouse inflammation cytokine antibody arrays were purchased from RayBiotech, Inc. LPS was purchased from Sigma-Aldrich. The CpG oligodeoxynucleotides1826 was purchased from InvivoGen. Vector-based shRNAs containing target sequences of AAGTGAAGGTGACTCAGCCTG and AATCAGTGTCTGTTGCTGCTG of SIRP were constructed using the pSUPER-neo vector (OligoEngine) according to the manufacturer's protocol. Predesigned phosphorothioate-modified stealthTM RNA targeted against SIRP, SHP-1, and SHP-2 were provided by Invitrogen, with the following sequences: SIRP: D10, 5'-AAGUGAAGGUGACUCAGCCUGAGAA-3', D12, 5'-CAAAGCCGGCUGUUGAUCUACAGUU-3'; SHP-1: F01, 5'-CCCUCUCAGUCAGGGUGGAUGAUCA-3', F03, 5'-GAGAUGGCACCAUCAUCCACCUUAA-3'; F05, 5'-GAGAACACUCGUGUCAUCGUCAUGA-3'; SHP-2: E01, 5'-GAGGGAAGAGCAAAUGUGUCAAGUA-3', E03, 5'-CAGACAGAAGCACAGUACCGGUUUA-3', E05, 5'-AAGUAUUCCUUGGUGGACCAGACAA-3'.

Animals.
Male C57BL/6 and BALB/c mice (6–8 wk old, weighing 16–20 g) were obtained from the Shanghai Experimental Center, (Chinese Science Academy, Shanghai, China) and maintained at an animal facility under pathogen-free conditions. Male WT (C3H/HeOuj and C57BL/10SnJ), TLR4 mutant (C3H/HeJ; Pro712-His712), and TLR4-deficient (KO; C57BL/10ScCr) mice were obtained from the Model Animal Research Center of Nanjing University (Nan Jing, China; 8–12 wk old). All animals received human care according to the criteria outlined in the Guide for the Care and Use of Laboratory Animals, which was prepared by the National Academy of Sciences and published by the National Institutes of Health (publication 86–23; revised 1985).

Cell lines and isolation of peritoneal macrophages.
Mouse macrophage cell lines RAW264.7 and J774A.1 were obtained from the Shanghai Cell Bank (Shanghai, China). Cells were cultured in RPMI 1640 with 10% FBS within a humidified incubator containing 5% CO₂ at 37°C and passed every 2–3 d to maintain logarithmic growth. Approximately 6 x 10⁵ cells/well were seeded into 6-well plates and transfected 24 h later with the pSUPER-shRNAs, pcDNA3.1-Myc-SIRP constructs and empty vector using PEI (Polyplus; AFAQ) according to the manufacturer's instructions. Stable RAW cell transformants were selected with 300 µg/ml G418. Peritoneal macrophages were isolated from mice (6–8 wk old, weighing 16–20g). Mice were i.p. injected with 2 ml of 4% thioglycollate (Sigma-Aldrich). 3 d after thioglycolate injection, cells in the peritoneal exudates were isolated by washing the peritoneal cavity with ice-cold HBSS. Collected cells were incubated for 4 h, and adherent cells were taken as peritoneal macrophages. Transfection into peritoneal macrophages was performed using GENEPORTER (Genlantis) according to the manufacturer's instructions. The measurement of viable cell mass was performed with a Cell Counting Kit-8 (Dojin Laboratories) to count living cells by WST-8.

Adoptive transfer of macrophages.
BALB/c mice were injected i.v. with GdCl₃ (Sigma-Aldrich; 10 mg/kg of body weight) to eliminate macrophages in vivo. 24 h after GdCl₃ injection, SIRP-KD/-OV/-VT RAW264.7 macrophages (1 x 10⁷ cells) suspended in 100 µl of pyrogen-free PBS were injected i.v. into the mice. Another 24 h later, mice were injected i.p. with PBS or LPS (20 mg/kg of body weight) and the resulting lethality was observed. Cytokine levels in sera were measured at 3 h after LPS injection (10 mg/kg of body weight).

Cytokine assay.
Cytokine levels in culture supernatants or in sera were determined using commercial ELISA kits for TNF, IL-6 (R&D Systems and BD Biosciences), RANTES, MIP-1, and IFNß (Biosource) according to the manufacturer's instructions. Each value represents the mean of triplicate values. Comprehensive analysis of cytokine levels were performed by using commercially available RayBio Mouse Inflammation Antibody Array 1.1 (RayBiotech, Inc.) according to manufacturer's protocol.

Nitrite oxidant detection.
Cells plated at 1.5 x 10⁵ cells/well in 24-well culture dishes were incubated overnight before stimulation. After the cells were treated with 100 ng/ml LPS for 24 h, culture medium was collected for analysis by the Griess Reagent kit. Nitrite concentrations were determined by the measurement of the optical density at 570 nm.

Luciferase assay.
SIRP-KD/-OV/-VT RAW264.7 macrophages were plated at 5x10⁴ cells/well in 48-well culture dishes and were transfected with 0.2 µg NF-B-Luc, AP-1-Luc, or ISRE-Luc reporter plasmids together with 0.02 µg of pRL-TK (Promega) by GENEPORTER (Genlantis). Luciferase activity was detected by Dual-Luciferase Reporter Assay System (Promega). Relative luciferase activity was normalized with Renilla luciferase activity.

RT-PCR.
RNA was extracted from RAW264.7 cells by using Trizol Reagent (Invitrogen). 2 µg cellular RNA was used for cDNA synthesis. For real-time PCR, we used the specific SYBR-Fluo from TaKaRa Biotechnology Co. Ltd. PCR primers for detecting mRNA of SIRP and ß-actin were synthesized by TaKaRa (Biotechnology Co., Ltd.). PCR reaction consisted of 95°C for 1 min, 57°C for 1 min, 72°C for 1 min, x35 cycles for both ß-actin and SIRP. Primer sequences were as follows: ß-actin, sense, 5'-GGACTCCTATGTGGGTGGCGAGG-3', antisense, 5'-GGGAGAGCATGCCCTCGTAGAT-3'; and SIRP, sense, 5'-TCGAGTGATCAAGGGAGCAT-3', antisense, 5'-CCTGGACACTAGCATACTCTGAG-3'.