We then used a "back-gating" analysis, examining the distribution of cell surface proteins used in delineating these subsets to assess whether we might have excluded significant portions of cells belonging to the CD117^hiCD127^– and CD117^medCD127⁺ cell populations, considered to identify the MLP and CLP stages, respectively (9, 10). Although all CD117^medCD127⁺ were included in the CD93^hiCD43^med gate, this analysis revealed that only a portion of the CD117^hiCD127^– cells were CD93^hiCD43^med, with many more exhibiting a CD93^medCD43^hi phenotype. Most cells in the CD93^medCD43^hi population belong to the LIN^– Sca1⁺cKit⁺ (LSK) fraction of very early hematopoietic cell precursors, including stem cells (Fig. S1, available at http://www.jem.org/cgi/content/full/jem.20052444/DC1). Thus, it seems likely that the earliest stages of hematopoietic cell differentiation, such as LSK, have lower levels of CD93 (and higher levels of CD43) than the MLP, CLP, and Fr. A stage cells that are the focus of this work. As Fig. S2 shows, most LIN^–CD19^– cells expressing very high levels of a RAG-2 GFP reporter (see next section) fall within the CD117^medCD127⁺ gate and these cells are predominantly CD43^med and CD24^low (i.e., are CLP and Fr. A as we define them). We conclude that using the gates in Fig. 1 encompasses essentially all early B lineage precursors.

In a second gating approach with the same stained sample, we focused on cell surface proteins whose expression identifies Fr. A through Fr. C', focusing on B220⁺CD43^med cells, subdividing them on the basis of CD24 and CD19. Among these cells, most of those lacking CD19 have a distinctively low to undetectable level of CD24 (Fig. 1, right side). Furthermore, in contrast to the relatively unimodal high-level CD93 expression found with CD19⁺ stage cells, there is considerable heterogeneity in the CD24^low fraction. Again, based on previous work showing that CD93^– cells with this phenotype do not belong to the B lineage (5), we excluded CD93^– cells and identified a set of CD93⁺CD117^medCD127⁺ cells, corresponding to the pre-pro–B population (Fr. A) identified in the first gating analysis described above. We also distinguish two subsets of CD43⁺CD19⁺ stage cells, with intermediate and high levels of CD24, respectively. Both of these fractions, corresponding to stages termed pro–B (Fr. B and Fr. C) and early pre–B (Fr. C'; reference 13), express homogenous high levels of CD93 and are CD127⁺, but have variable (in B and C) to undetectable (in C') levels of CD117. Table I summarizes the surface markers used in identifying the CD19^– fractions and CD19⁺ pro–B fractions examined in this work.

View larger version (35K): [in this window] [in a new window]   Figure 2. B, T, NK, and myeloid engraftment from MLP stage cells, in contrast with predominant lymphoid repopulation using CLPs, and predominant B cell repopulation using Fr. A. Cell populations defined as in Fig. 1 were isolated by cell sorting from B6.Ly5.2 mouse bone marrow and injected i.v. together with unfractionated bone marrow from B6 wild-type (Ly5.1) mice into lethally irradiated B6 mice. After 3 wk, recipient animals were killed and indicated tissues were analyzed by flow cytometry for the presence of Ly5.1/Ly5.2 cells in B (B220+CD19+IgM+), T (CD4/C8+CD3+), NK (NK1.1/DX5+), and myeloid (CD11b/GR1+) cell populations. (A) Percent engraftment reported is frequency of Ly5.2+ cells divided by total cell frequency for the indicated population. (B) Absolute numbers of Ly5.2+ cells of the indicated cell type were determined and then compared with the number obtained with MLP stage cells (defined as 1.0 for each cell type). Error bars show standard error for analyses of 6–10 individual recipients from four separate experiments.

Bipotential B/myeloid assay reveals myeloid potential in CLPs
Next, we asked whether all CLP stage cells are lymphoid committed. Although the cell transfer analysis appeared to indicate such restriction, this assay suffers from at least two deficits: (a) lineage plasticity may be masked by failure of cells to migrate into inducing microenvironments for all potential alternate cell lineages; and (b) the seeding efficiency may vary among different cell subsets, making it difficult to estimate the frequency and homogeneity of subsets under analysis. Therefore, we assessed lineage plasticity of cells in these early stages by a series of clonal (or near-clonal) in vitro assays. First, we investigated B/myeloid potential using a bipotential assay (29), depositing individual cells (1 cell/well) into a 96-well plate containing a preestablished S17 stromal cell monolayer and medium supplemented with SCF, Flt3 ligand, and IL-7 (Fig. 3 A). This combination of cytokines and stromal cells supports the growth and differentiation of most early hematopoietic cells (30) and, under these conditions, both myeloid and B lymphoid cells can develop clonally with high efficiency. Most clones developing from MLPs were myeloid (CD11b⁺/CD19^–) with occasional B lineage colonies. CLP stage cells generated more B lineage colonies, but we also observed a significant number of myeloid colonies. In contrast, plates sorted with the B220⁺ Fr. A and the CD19⁺ pro–B Fr. B and C contained very few myeloid colonies. Thus, although CLPs generated numerous myeloid colonies, few were seen in plates containing sorted Fr. A cells.

View larger version (29K): [in this window] [in a new window]   Figure 3. Bipotential stromal cell assay reveals unexpected myeloid capacity in CLP stage cells that is lost upon progression to the B220+ (Fr. A) stage. (A) Individual cells from the indicated population were deposited into wells of a 96-well flat-bottom plate containing preestablished S17 stromal cells in complete RPMI 1640 medium, supplemented with SCF, Flt3L, and IL-7. After 7–10 d, plates were examined for cell colonies and these were harvested and analyzed by flow cytometry. Colonies were classified as B (CD11b–CD19+), myeloid (CD11b+CD19–), or other (CD11b–CD19–). No mixed colonies were observed. Representative data from more than four separate experiments is shown. (B) A similar analysis was performed with cells sorted from the bone marrow of RAG-2–GFP reporter mice, selecting the GFP intermediate (+) or brightest (++) MLP stage cells, or the GFP-high (+++) CLP or Fr. A stage cells. Gated regions are marked on the GFP histograms in Fig. 4. Representative data from more than four separate experiments is shown.

View larger version (16K): [in this window] [in a new window]   Figure 4. (A) Detection of RAG-2 gene transcriptional activation very early in hematopoietic development. LIN– cells, gated to eliminate CD43– pre–B and later stage B lineage cells, were analyzed for expression of RAG-2–GFP and CD93. Vertical bar indicates the demarcation between positive and negative GFP levels. (B) Comparison of levels of RAG-2–GFP in early stages of B lineage development in mouse bone marrow. The level of green fluorescence detected in RAG-2–GFP transgenic– littermates is shown for each cell subset analyzed. Numbers on the plots show the mean fluorescence intensity for each population. Sort gates for the cells analyzed in B/Myeloid bipotential assays (Fig. 3 B) are indicated. Representative data of three separate analyses is shown.

View larger version (42K): [in this window] [in a new window]   Figure 5. Comparable T cell potential in CLP and Fr. A stage cells. (A) Three cells of the indicated population were deposited into wells containing a fetal thymic lobe. Plates were then maintained under high oxygen submersion FTOC conditions in the presence of SCF and IL-7. Wells were analyzed after 2 wk and evaluated for the presence of CD90/Thy1.2+CD25+ early T lineage cells or CD19+ B lineage cells. B lineage cells were not efficiently generated under the conditions used. Data from five separate experiments is shown. (B) Individual CLP and Fr. A cells were deposited by electronic cell sorting into microplate wells containing DL1-OP9 or GFP-OP9 (control) stromal cells and the type of cells generated was assayed 7–10 d later. B and T lineage cells were identified as described above. "Other" stands for not falling into either gate.

Ig heavy chain rearrangement initiates very early in B lineage development
While our RAG-2 reporter analysis (Fig. 4 B) indicated that RAG transcription is already activated in nearly 100% of MLP stage cells, it was unclear when D_HJ_H rearrangement initiated because chromatin configuration at the heavy chain locus will play a key role in determining heavy chain locus accessibility. Therefore, we then focused on this issue. To determine the frequency of cells with Ig heavy chain locus recombination we used a single cell DNA PCR assay (7, 36, 37). This approach uses two rounds of amplification with nested primers, one set that amplifies a germline band and another set that detects many of the possible D_HJ_H rearrangements, allowing us to assess the extent of heavy chain rearrangement at the single cell level. Importantly, this assay was very efficient, recovering signals from 80% of the cells analyzed (Table II). The earliest fraction, MLP, showed germline bands with little detectable D_HJ_H rearrangement (<2%). Yet, we detected D_HJ_H rearrangement in 48% of signal-positive CLP stage cells, and rearrangement increased to 88% of Fr. A cells (Table II, see values in parenthesis). Thus, even cells with extensive DJ rearrangement retain the capacity to develop into T cells. In comparison, CD19⁺ pro–B stage cells had extensive D_HJ_H bands with essentially no germline signal, indicating that most cells had D_HJ_H rearrangements on both chromosomes, consistent with a previous analysis using a germline-loss bulk PCR assay (13).

View larger version (46K): [in this window] [in a new window]   Figure 6. Real-time quantitative RT-PCR analysis of gene expression in early B lineage fractions isolated from mouse bone marrow. Results show average and standard error for three separate sorted samples. For each gene, maximum expression observed in the four fractions tested is set to 1.0. (A) B lineage–associated or –restricted genes are expressed from very early stages of hematopoietic development. (B) Gene expression in MLP stage cells compared with that in mature recirculating (Fr. F) B cells, showing readily detectable levels of mRNA for TdT and RAG-2 at this very early stage. (C) Patterns of expression of transcription factors indicate an ordered sequence of gene activation early in B cell development. (D) Genes associated with other hematopoietic lineages (Csf1R, C/EBP, myeloid; Notch-1, GATA3, and T lineage) show diminishing expression as cells progress from CLP to Fr. A to CD19+ Fr. B.

We also surveyed expression of genes representative of alternative lineage fates, including T lineage, GATA3 (47) and Notch-1 (33, 34), and myeloid lineage, Csf1r (48) and C/EBP (49). These genes showed very significant decreases in the progression from CLP to Fr. A to the CD19⁺ pro–B stage (Fig. 6 D). In fact, the expression of these genes was reciprocal to EBF and Pax-5, consistent with a progressive restriction to the B lineage fate as cells pass through these three stages. Consistent with the myeloid potential in CLPs, there is little change in Csf1r mRNA levels from MLP to CLP, whereas the level of GATA3 rises sharply in CLPs, possibly indicating the activation of a T lineage program that is then extinguished as cells progress to express B220 and then CD19 in the absence of Notch-1 signaling. Significantly, Notch-1 expression is sharply up-regulated at the CLP stage, declining thereafter, providing a mechanism for T lineage specification via Notch-1 signaling in CLP and Fr. A stage cells.

Determining global patterns of gene expression by microarray analysis
Finally, we analyzed RNA prepared from these four early B lineage stages from mouse bone marrow to identify sets of genes that were coordinately regulated as cells progressed down the B cell development pathway. We generated ratios of signal from amplified RNA to a common reference RNA for two samples per fraction. Genes showing a statistically significant difference in at least one stage were identified by ANOVA, and the resulting set (1,000 genes) was analyzed by KMeans clustering. The results obtained were visualized by a "heat map" display (Fig. 7) where individual gene levels are coded green for low, black for intermediate, and red for high. Using this approach we can identify a set of genes that show low-level expression in MLP and pro–B stages, but higher expression in CLP and Fr. A (cluster A); another that is low in MLP and CLP, but increasing in Fr. A and Fr. B and C; and yet others where high-level expression found early diminishes in later fractions. Importantly, we could identify genes present in each cluster that were consistent with the patterns of expression shown in Fig. 6. Thus, cluster A includes the IL-7R gene, consistent with the highest staining for this protein on CLP and Fr. A. Cluster B contains well-known B lineage–associated transcription factors (Pou2af1/OCAB, EBF-1, PBX-1, LEF1, IRF4, and SPI-B) and a large number of lymphoid/B lineage–associated genes, including RAG-1, Blnk, CD19, CD79a, Cd79b, and VpreB. Cluster C is a group of genes sharply up-regulated at the pro–B stage and includes ABL-1. Cluster D includes cKit and one of the myeloid colony-stimulating factor receptor genes. Cluster E contains Csf1, the myeloid growth factor receptor gene that we analyzed by quantitative PCR and found was present in CLP and down-regulated in Fr. A (the pattern shown here). Cluster F includes Notch1 and GATA 3, consistent with the T lineage potential of Fr. A that is lost in Fr. B and C. In summary, the patterns of expression that we observe are consistent with our quantitative PCR determination for every gene examined that is contained in this set of differentially expressed genes, and this analysis identifies a large number of additional genes.

View larger version (51K): [in this window] [in a new window]   Figure 7. Cluster analysis reveals distinct patters for 1,000 genes (out of 40,000 features on the slides used) whose expression varies within the four early B lineage stages analyzed in this work. Heat map display of expression shows relative level for each individual gene: green, low; black, medium; red, high. Six patterns of expression, including those present at high levels early that are down-regulated (clusters D and E), those up-regulated at the CLP and Fr. A stages (cluster A), and those up-regulated with B cell development (clusters B and C). Cluster B includes many genes considered important in B cell development, such as RAG-1, BLNK, CD19, CD79a, CD79b, EBF, and VpreB.

	DISCUSSION

Top Abstract RESULTS DISCUSSION MATERIALS AND METHODS References

View larger version (26K): [in this window] [in a new window]   Figure 8. Diagram of early stages in B lineage development, indicating extent of DHJH rearrangement, expression of key transcription factors, expression of a RAG-2–GFP reporter transgene, extent of B/T/myeloid repopulating capacity, and lineage plasticity in vitro.

Myeloid cell generation from the CLP fraction was also surprising. Our analysis shows that although these cells have become considerably more lymphoid specified than MLP, expressing higher levels of TdT and RAG message (and functional RAG protein, as indicated by DHJH rearrangement), they nevertheless retain significant myeloid capacity as revealed in the B/myeloid bipotential assay. As with Fr. A, the i.v. repopulation assay shows a more restricted lineage potential, either because these cells predominantly home to microenvironmental niches that disfavor myeloid development or else rapidly progress to Fr. A in vivo. We can only speculate that this in vitro myeloid potential was overlooked previously due to differences in stromal culture conditions that favored lymphoid progression or else to differences in sensitivity of detection of CD45R/B220 that might have included Fr. A in the CLP population, increasing its apparent lymphoid restriction. Therefore, the subdivision of B220^– and B220⁺ fractions of CD117^medCD127⁺ cells is important because it reveals clear differences in lineage restriction read out in both in vivo and in vitro. That is, in contrast with CLP, most Fr. A cells did not respond to myeloid-inducing signals in stromal cell culture. Thus, Fr. A pre-pro–B cells behave as a strict "common lymphoid progenitor" in terms of their lineage potential.

The finding of B220⁺ CLP is reminiscent of a previous report from Martin et al. (50) describing a lymphoid-restricted "CLP2" cell type. However, in their studies, the B220⁺ CLP-like cells were reported to lack CD117, clearly not the case with Fr. A. Furthermore, the CLP2 cells were described functionally as efficiently homing to the thymus, which we do not observe; Fr. A cells injected i.v. generate far fewer thymocytes compared with classical (i.e., B220^–) CLP stage cells (Fig. 2 B). The capacity of CLP2 stage cells to home to the thymus led Martin et al. to propose that these cells are a founder population for thymic T cell development. In contrast, we would suggest that Fr. A stage cells are an intermediate between CLP and CD19⁺ pro–B stage cells, in a B lineage–specified, but not yet committed, state. Recent work from Allman et al. (51) has identified an early thymic progenitor that appears distinct from CLP2. Clearly, this issue will require further investigation to clarify the relationships among B220⁺CD19^– subsets from bone marrow and thymus in terms of lineage potentials.

A very recent report by Balciunaite et al. (21) described the presence of a B220⁺CD117⁺CD19^– hematopoietic progenitor with B, T, and myeloid potential in vitro and lymphoid potential in vivo. Although these authors' limiting dilution analysis suggests a precursor with some similarity to ours, their population appears more similar to the B220^– CLP stage we report here; the expression of B220 in our experience greatly reduces myeloid potential (by 10-fold) found in CLPs. Furthermore, the decrease in csfR1, a gene encoding the receptor for colony stimulating factor 1 (a key myeloid growth factor), in the progression from CLP to Fr. A provides a mechanistic explanation for the difference we observe. In fact, we found that B220 expression was a better marker for the loss of myeloid potential than induction of a RAG-2–GFP reporter, sounding a cautionary note on the use of RAG reporters for identifying "early lymphoid progenitors" (17).

Both CLP and Fr. A stage cells generated T lineage cells in vitro, revealing T lineage potential, but this does not necessarily mean that either are normal intermediates in a developmental pathway from hematopoietic stem cells to T cells. Although the existence of T cell lines or thymocytes with Ig D_HJ_H rearrangement have been reported (52), there are no T lineage precursors among triple negative (CD3^–4^–8^–) thymocytes with a surface phenotype corresponding to bone marrow CLP (51), and we detect no cells corresponding to Fr. A in the thymus (not depicted). Our results seem most consistent with a type of developmental model where B lineage "specification" precedes B lineage commitment in bone marrow (53–55). In this model, B lineage genes are induced and non–B lineage genes are repressed in progressive stages of hematopoietic development, mediated by a hierarchy of transcription factors, resulting in a B lineage–specified stage, coincident with D_HJ_H rearrangement and the high-level expression of a set of early B lineage genes, such as Ig/ß, 5/VpreB, and RAG-1/2. However, absolute irreversible lineage commitment occurs at a later stage, coincident with high-level expression of functional Pax-5 (42, 43).

In fact, it appears that B lineage specification initiates even before the CLP stage, as MLP cells express some lymphoid/B lineage genes, including TdT, RAG-2, and Ig-ß. We also note that most MLP stage cells show activation of a RAG reporter transgene, similar to the previously described CD117^hi early lymphoid progenitors fraction that lacks CD127 (17). Nevertheless, we found a robust myeloid lineage engraftment with MLP, suggesting that RAG-2 gene transcriptional activation, along with a significant component of the B lineage program, initiates in a cell fraction that maintains considerable myeloid potential as revealed using the cell engraftment competition assay.

Finally, our microarray analysis illustrates the progressive nature of B cell development. We identify clusters of genes with expression shared between MLP and CLP, between CLP and Fr. A, and between Fr. A and CD19⁺ pro–B stage cells. Continuing examination of the members of these clusters will help to elucidate more fully the gene program resulting in progressive restriction to B lineage development, along with the key microenvironmental interactions that foster this process.

	MATERIALS AND METHODS

Top Abstract RESULTS DISCUSSION MATERIALS AND METHODS References

 
Animals.
6–12-wk-old BALB/c (ICR) female mice, bred in our animal facility, were used in most experiments. For the i.v. competition cell transfer assay, B6.Ly5.2 female mice were obtained from the National Cancer Institute. RAG-2–GFP BAC transgenic mice were obtained from M. Nussenzweig (Rockefeller University, New York, NY) and bred in our animal facility. RAG-2/common chain double-deficient (RAG2°C°) a-lymphoid animals, originally described by Colucci et al. (56), were obtained from D. Wiest at our institute, and timed matings for generating fetal thymic lobes were performed in our animal facility. C57BL/6 mice were obtained from our animal facility production colony. All experiments with mice were conducted under an approved animal protocol.

i.v. competitive repopulation assay.
The selected population was sorted from B6.Ly5.2 bone marrow and the yield derived from two bone marrow equivalents was transferred i.v. per recipient, typically 5–10 x 10³ for CD19^– fractions and 5–10 x 10⁴ for CD19⁺ cells, together with 10⁵ unfractionated Ly5.1 (recipient type) bone marrow. 2-mo-old C57/B6 female recipient mice were lethally irradiated (9 Gy) 1 d before transfer and provided neomycin polymixin B antibiotic in water. Animals were analyzed 3 wk after transfer, using antibodies specific for Ly5.1 and Ly5.2 in addition to reagents specific for T, B, NK, and myeloid cells (CD3, CD4, and CD8 for T cells; B220, CD19, and IgM for B cells; NK1.1 and DX5 for NK cells; and CD11b and GR-1 for myeloid cells/granulocytes).

Myeloid/B cell bipotential stromal cell cultures.
S17 stromal cells were grown in a 37°C humidified, 10% CO₂ gassed incubator in 5% FBS/RPMI 1640 medium (supplemented with 1x glutamine, 10 mM Hepes, 5 x 10^–5 M 2-ME, and 0.5 mg/ml gentamicin). Cells were passaged into 96-well plates in the same medium and allowed to reach confluence 3–5 d before use. Immediately before cloning, medium was replaced with fresh medium containing cytokines (10 ng/ml SCF, 10 ng/ml Flt3L, and 100 U/ml IL-7; R&D Systems). Individual cells of the selected population were sorted using the single cell deposition unit of a FACSVantage/DiVa flow cytometer and then returned to the incubator. 7–10 d later wells were examined for colonies using an inverted microscope. Positive wells were harvested by pipetting, and then cells were stained with antibody to CD19 and CD11b and analyzed by flow cytometry.

T cell potential assays: high-oxygen tension FTOCs and DL1-OP9.
The modified FTOC culture under high oxygen tension was performed as described previously (32, 57), except that fetal thymic lobes from RAG2°_c° embryos were used. Three cells of selected population were sorted per well using the automated cell deposition unit. Cells were analyzed after 14 d by flow cytometry, staining for CD19, CD90/Thy-1, CD25/IL-2R, DX5, CD11b, and CD11c. Early T lineage cells were recognized as CD90⁺CD25⁺ cells, lacking other markers tested. Alternately, individual cells selected by sorting were deposited into microplate wells containing preestablished stromal cells, either DL1-transduced OP9 or GFP-OP9 (33). Cultures were performed essentially as described previously (33) and analyzed for generation of T or B cells using the staining procedure described above at 7–10 d.

Flow cytometry and monoclonal antibodies.
Sorting was performed using a BD Biosciences FACSVantageSE/DiVa, equipped with three laser excitation lines (407, 488, and 600 nm) for 12-color detection. Early B lineage precursors were isolated using the following staining combination: FL-Ter119, FL–anti-Ly6c, PE-anti–IL-7R (SB/199), PI detected in TR-PE channel, Cy5PE–anti-CD3 (500A-A2), Cy55PE-CD93 (AA4.1), Cy7PE-CD43 (S7), Alexa 594–anti-CD24/HSA (30F1), APC-CD117/cKit (2B8), Cy55APC–anti-CD19 (1D3), Cy7APC–anti-CD11b/Mac-1(M1/70), Cy7APC-GR1, CasBlue–anti-IgM (331.12), and Bi–anti-CD45R/B220 (RA3-6B2). Biotin reagent was revealed by second-step incubation with QDot605-streptavidin. Analysis was performed using either this flow cytometer or a BD Biosciences LSR-II with three lasers (407, 488, and 630 nm) equipped for 10-color detection. All reagents were made in our laboratory, except for QDot605-streptavidin, which was purchased from Quantum Dot Corporation, and DX5 from BD Biosciences. Cells from RAG-2–GFP reporter mice were analyzed by detecting GFP in the FL channel, using the staining combination described above, except that Ter119 and anti-Ly6c antibody were labeled with Cy5PE.

Single cell heavy chain recombination assay.
Analysis was performed using a modification of procedures described previously (7, 36, 37). Cells were sorted directly into 96-well plates (Applied Biosystems) containing 20 µL/well lysis buffer (1x PCR buffer [Applied Biosystems] with 2.5 mM MgCl₂, 9.2 µg/ml tRNA [Sigma-Aldrich], and 100 µg/ml gelatin). Plates were stored at –80°C and then just before PCR, plates were thawed, treated with 0.5 mg/ml proteinase K for 1 h at 55°C, and then heated for 10 min at 95°C. After digestion, a two-round nested PCR was used to detect a germline DNA segment (lost upon heavy chain rearrangement) and potential D_HJ_H rearrangements. The PCR program was 95°C for 1 min, 63°C for 1 min, and 72°C for 1.5 min for 30 cycles, with a 10-min end extension at 72°C. For round 1: GL5-1, CCCGGACAGAGCAGGCAGGTGG; D_H5-1, ACAAGCTTCAAAGCACAATGCCTGGCT; and D_H3-1, AGGCTCTGAGATCCCTAGACAG. For round 2, the following two separate reactions were performed: for germline GL5-2, GAGTTGACTGAGAGGACAG, and GL3-2, CGAAGTACCAGTAGCAC; and for D_HJ_H rearrangements D_H5-2, ACGTCGACTTTT(G/C)TCAAGGGATCTACTACTGT, and D_H3-2, GGGTCTAGACTCTCAGCCGGCTCCCTCAGGG. In the first round, PCR amplification was performed with the contents of each well in a total volume of 50 µl containing 0.2 µM dNTPs, 1 µl BD Advantage cDNA polymerase mix, 1x BD Advantage PCR buffer, 0.5 mg/ml BSA, and 0.4 µM of each primer. In the second round, 1 µl of each first round product was added to a 50-µl reaction volume using the same conditions described above, except that second round primers (GL-5-2/GL-3-2 or D_H-5-2/D_H-3-2) were used at 2 µM. Products were visualized on 1.5% agarose gels stained with ethidium bromide. The validity of these PCR products was verified by sequence analysis.

Quantitative RT-PCR assay.
Total RNA was prepared by sorting cells into Solution D lysis/denaturing solution, followed by acid-phenol extraction and isopropanol precipitation, as described previously (5). cDNA was synthesized by adding 1 µl oligo-(dT)_12–18 primer (0.5 µg/µL; Invitrogen) to 20 µl total RNA, heating at 70°C for 10 min, cooling on ice for 2 min, adding 8 µl 5x first-strand buffer (Invitrogen), 4 µl 0.1 M DTT (Invitrogen), 4 µl dNTPs (each dNTP at 10 mM; Promega), 1 µl random hexamer primers (20 U/ml; GE Healthcare), 2 µl RNAsin (40 U/ml; Promega), and 2 µl Superscript II (200 U/ml; Invitrogen), and then incubating at 42°C for 2 h. Gene expression was quantitated by real-time PCR. Analyses were performed in triplicate in 25-µl volumes using an ABI7500 thermal cycler. For each tube, 12.5 µl ABI TaqMan 2x Mastermix (polymerase and dNTPs), 1.25 µl probe mix (ABI), 9.25 µl DEPC-H₂0, and 2 µl template (typically diluted 1:3 from cDNA synthesis volume) were added. ABI software was used to quantify/calculate Ct values and determine relative gene expression levels, standardizing using ß-actin values. All quantitative PCR ABI assay IDs and sequences for custom-designed sets are available upon request.

RNA extraction from sorted cells, RNA amplification, and labeling for microarray.
Cells were sorted directly into RNA lysis buffer (6 M guanidine thiocyanate, 0.67% Na N-lauroylsarcosine, 33 mM sodium citrate, and 133 mM 2-mercaptoethanol), and total RNA was extracted using the acid phenol method as described previously (5). Integrity and quantity of total RNA samples were analyzed using a 2100 Bioanalyzer (Agilent Technologies). 40 ng total RNA was used for RNA amplification. RNA amplification was performed using the Ovation Aminoallyl RNA Amplification and Labeling System (NuGEN Technologies, Inc.) in accordance with the manufacturer's protocols. 2 µg amplified cDNA was used for dye-coupling with Alexa Fluor 555 and Alexa Fluor 647 (Invitrogen). Quantification of the fluorescent-labeled probes was performed using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies). 50 pmol of fluorescent-labeled cDNA (1.5 µg amplified cDNA) of each probe (experimental sample and reference) was loaded per slide. For use as a reference, total RNA from six cell lines (R1, RS2, J558, EL4, DN3, and P388d) was prepared using TriReagent (Molecular Research Center, Inc.) and 30 µg (5 µg from each cell line) was reverse transcribed at 42°C for 2 h in a total volume of 20 µl that included 1 µl Superscript II reverse transcriptase (200 U/µl; Invitrogen), 1 µl rRNAsin RNAase inhibitor (40 U/µl; Promega), and 2 µl of a mixture of dNTPs (5 mM each of dGTP, dATP, and dCTP; 2 mM of dTTP; and 3 mM of aminoallyl dUTP). RNA was hydrolyzed by the addition of 10 µl 1 M NaOH and incubation at 70°C for 10 min. 10 µl of 1 M HCl was then added to neutralize the sample, and cDNA was precipitated overnight by the addition of 4 µl of 3 M sodium acetate, pH 4.5, 1 µl glycogen (20 µg/µl), and 100 µl ethanol. cDNA was pelleted by centrifugation, washed once with 70% ethanol, and dissolved in 9 µl coupling buffer, followed by the same dye-coupling procedure described above for amplified cDNA.

Microarray analysis.
Two samples were analyzed from each fraction sorted from separate pools of mouse bone marrow cells. RNA prepared from each sample was amplified, used for probe generation, and hybridized with a common reference RNA. Amplified RNA was labeled with both Alexa Flour 555 and Alexa Flour 647 and hybridized with the complementary labeled reference RNA (dye-flip replicates). Whole mouse genome 44K oligo microarray kits (Agilent Technologies) were used for hybridization. The hybridization and SSPE washing and drying procedures were all performed according to the manufacturer's recommendations. The slides were then scanned using an Agilent BA DNA Microarray Scanner. Data from scans were normalized using Agilent feature extraction software and then subject to statistical analysis using GeneSight software (BioDiscovery). Results were determined as ratios of experimental sample to reference, and dye-flip replicates were combined. The resulting data, two ratios for each gene from all four samples, were analyzed by ANOVA, selecting genes differentially expressed reproducibly in at least one stage with a p-value cutoff of <0.005. This set of 1,000 genes was then analyzed by KMeans clustering using a distance measure based on the Pearson correlation and assuming six clusters.

Online supplemental material.
Fig. S1 is a flow cytometry analysis showing the relationship between CD43 and CD93 expression with B cell development, comparing very early precursors (LSK) with CLP and Fr. A. Fig. S2 is a flow cytometry analysis showing the expression of a RAG-2–GFP reporter BAC transgene in early stages of B cell development. The microarray data used to generate the cluster analysis shown in Fig. 7 is also available. The online supplemental material is available at http://www.jem.org/cgi/content/full/jem.20052444/DC1. The microarray data is available from ArrayExpress, European Bioinformatics Institute (http:www.ebi.ac.uk/arrayexpress), as accession no. E-MEXP-559.