|
||
ARTICLE |
CORRESPONDENCE Dennis L. Kasper: dennis_kasper{at}hms.harvard.edu
|
|
|---|
in PSA-stimulated dendritic cellCD4+ T cell co-cultures depends on both Toll-like receptor (TLR) 2 and antigen presentation. Synergy between the innate and adaptive responses was also shown when TLR2/ mice exhibited impaired intraabdominal abscess formation in response to B. fragilis. Commensal bacteria, using molecules like PSA, potentially modulate the Th1/Th2 cell balance and the response to infection by coordinating both the innate and adaptive pathways.
The gram-negative anaerobic bacterium Bacteroides fragilis is an integral component of the normal gastrointestinal flora. This organism colonizes the intestinal tract of essentially all mammalian species; in fact, B. fragilis has no known reservoir other than mammals. Genomic sequencing and biochemical analysis have revealed that in B. fragilis, an unprecedented proportion of the genomic DNA is dedicated to the production of capsular polysaccharides, which are important virulence factors in most extracellular bacterial pathogens. Loci for at least eight B. fragilis capsular polysaccharides have been identified (1), and at least two of these capsular polysaccharides possess a zwitterionic charge motif (2). Studies of B. fragilis colonization of the gastrointestinal tract in germ-free mice have identified one of the zwitterionic polymers, polysaccharide A (PSA), as the first bacterial product with a demonstrated ability to stimulate T cell lineage differentiation of the mammalian immune system (3). Indeed, it is the polysaccharide's dual-charge structural motif that appears to confer this ability (4, 5).
Toll-like receptors (TLRs) play a critical role in early innate immunity by sensing the presence of microbial pathogens and initiating a response to clear them (6, 7). These receptors, homologues of the Drosophila Toll gene, recognize the highly conserved structural motifs called pathogen-associated molecular patterns (PAMPs) (8). Among the pathogen-associated molecules encompassed by the designation PAMP are endotoxin (LPS), peptidoglycan, and other bacterial cell-wall components including flagellin, bacterial DNA, and viral double-stranded RNA. At least 11 TLRs and their distinct ligands have been identified so far in mammals (9). Among these receptors are TLR4, which is activated by most bacterial LPSes (10), and TLR2, which is activated by several bacterial products, including peptidoglycans, lipoproteins, mycobacterial lipoarabinomannan, and atypical LPSes such as those found in Porphyromonas (8, 11). TLRs signal primarily through an adaptor protein, MyD88 (12), although some TLRs can signal through nonMyD88-dependent pathways (13, 14); this signaling ultimately results in NF-
Extensive research has been performed to elucidate the role of TLRs in innate and adaptive immunity and to identify ligands that can stimulate these receptors (24). Although many known TLR ligands contain carbohydrate moieties, it appears that the noncarbohydrate portion of these molecules (e.g., lipid A in LPS) is usually critical for TLR ligation and activation (25). The potential role of pure carbohydrates as ligands for TLRs remains largely uninvestigated, even though antibodies to TLR2 and TLR4 have been shown to inhibit B cell and macrophage activation induced by polysaccharide fractions isolated from cell cultures of Acanthopanax senticosus (26). Likewise, low molecular weight hyaluronic acid oligosaccharides produced during inflammation, fragmented heparin sulfate, and glucuronoxylomannan have been reported to induce maturation of DCs through TLR4 (27, 28).
We have previously identified a mechanism by which PSA can stimulate the adaptive immune response by activation of CD4+ T cells through an MHC class II (MHCII)dependent mechanism (29). Processing and presentation of PSA depend on the production of NO; MHCII presentation of processed polysaccharides does not occur in mice lacking the inducible NO synthase gene (iNOS/). In addition, MHCII and the co-stimulatory molecule CD86 are up-regulated upon PSA-mediated activation of APCs (30). Many of the immunologic events leading to PSA-mediated T cell activation (such as iNOS expression, MHCII presentation, co-stimulation, and cytokine production) have been shown in other systems to be linked to TLR activation (1618). Therefore, we sought to determine whether PSA can initiate the innate immune response in a TLR-dependent manner that is consistent withor even complementary tothe role played by this polysaccharide (through MHCII) in the adaptive portion of the response.
In this paper we demonstrate that PSA activation of TLR2 not only mediates the release of proinflammatory cytokines and NO by APCs but also leads to NF-
In vivo abscess formation after challenge with PSA or live B. fragilis has been shown to depend on a robust adaptive immune response (30). We now demonstrate the additional requirement for an intact innate signaling system for abscess formation, documenting an impaired abscess-forming ability in TLR2/ mice. These data reveal a critical role for PSA signaling via TLR2 in coordinating the innate and adaptive immune responses.
Bmediated gene transcription (15). In fact, all the signaling pathways induce transcription of many immunologically important genes, such as those encoding for major histocompatibility complex MHC molecules (16), co-stimulatory molecules (17), cytokines, chemokines, and adhesion molecules (18). It is through activation of these molecules that TLRs mediate inflammatory responses, coordinate innate and adaptive immunity (19), prime naive T cells (20, 21), induce memory (22), and facilitate the elimination of pathogens (23).
B nuclear translocation in these cells. Consistent with this result, TLR2/ and MyD88/ bone marrowderived DCs (BMDCs) fail to produce TNF-
when incubated with PSA. Optimal production of IFN-
by CD4+ T cells requires MHCII presentation of PSA by BMDCs. However, when PSA is presented by TLR2/ BMDCs, CD4+ T cell production of IFN-
is considerably decreased. Furthermore, IFN-
production is almost completely abolished when both the innate (TLR2) and adaptive (antigen-processing) arms of the immune response are rendered nonfunctional.
![]()
RESULTS
Top
ABSTRACT
RESULTS
DISCUSSION
MATERIALS AND METHODS
REFERENCES
PSA activates cytokine production by APCs via TLR2-dependent mechanisms
To begin elucidating the response of professional APCs to the B. fragilis polysaccharide antigen PSA, we examined the cytokine production profiles of various APCs upon stimulation with the carbohydrate PSA. PSA, Escherichia coli LPS (a TLR4 agonist), and the synthetic macrophage-activating lipopeptide 3 (MALP-3; a TLR2 agonist) were incubated with a mouse RAW 264.7 macrophage cell line or primary mouse BMDCs. As shown in Fig. 1 A, TNF-
production induced by PSA was comparable to that produced in response to MALP-3 and E. coli LPS in both cell types.
Similarly, PSA induced substantial IL-12p40 secretion by BMDCs; however, macrophages failed to produce IL-12p40 in response to any of the agonists tested. Poor IL-12 production by macrophages was not a dose-related phenomenon: even very high doses of PSA did not induce IL-12 production in these cells (unpublished data). Induction of these cytokines by APCs appeared to be a unique function of PSA in that other polysaccharidessuch as mannan, polygalacturonic acid, and type 1 Streptococcus pneumoniae capsular polysaccharide (Sp1)failed to stimulate TNF-
or IL-12p40 production in either cell type (unpublished data). Results similar to those described with RAW 264.7 cells were obtained with fresh human monocytes, THP-1derived macrophages, and fresh mouse peritoneal macrophages.
|
B translocation and cytokine production experiments. This mAb, raised against the extracellular domain of mouse TLR2, inhibits cell activation in experimental mouse models of infection and prevents TLR2-driven lethal shocklike syndromes (31). Macrophages were preincubated with the mAb before the addition of stimuli to ensure complete blockage, and cytokine production was assessed 15 h after stimulation. At 15 h, TNF-
production was significantly reduced in PSA-stimulated cells preincubated with the anti-TLR2 mAb compared with cells treated with an isotype control antibody (P < 0.05; Fig. 1 B). Studies with the TLR2 agonist MALP-3 showed a similar blockade of cytokine production by the anti-TLR2 mAb (31), whereas TNF-
production by LPS-stimulated cells was unaffected by this mAb. Likewise, PSA-mediated cytokine release was not reduced by preincubation with an anti-TLR4 mAb (unpublished data).
NF-
B is a critical nuclear transcription factor that regulates many immune genes and cytokine responses (32). Various inducers, such as LPS, result in the degradation of I
B protein and the release of NF-
B dimers that subsequently translocate to the cell nucleus and activate appropriate target genes. To determine whether PSA induces these events in activated APCs, we used a modified ELISA to measure NF-
B p65 (RelA) protein levels after PSA activation. RAW 264.7 macrophages were incubated with PSA, MALP-3, LPS, and a medium control for various intervals, after which activation of NF-
B was measured. NF-
B p65 protein levels increased upon PSA stimulation, with peak activation at 1.5 h (unpublished data). Activation of NF-
B by PSA and MALP-3 was reduced back to the baseline level in the presence of the anti-TLR2 mAb, whereas LPS-induced activation of NF-
B was unaffected by blocking TLR2 activation (Fig. 1 C).
Engagement of TLRs by microbial products often results in TLR dimerization and subsequent recruitment of the adaptor molecule MyD88 (7); these events constitute one major pathway leading to NF-
B translocation and cytokine production. We further investigated the role of TLR2 and the adaptor protein MyD88 in PSA-mediated APC activation. BMDCs were isolated from WT, TLR2/, and MyD88/ mice. Upon PSA stimulation, TLR2/ BMDCs produced lower levels of TNF-
and IL-12p40 than WT cells (P < 0.05; Fig. 1 D). Similar results were obtained with BMDCs isolated from MyD88/ mice (P < 0.0001; Fig. 1 E). LPS-induced cytokine production was not affected by the absence of TLR2 but was significantly impaired in MyD88/ cells, as this signal transduction protein is common to both TLR2 and TLR4 signaling pathways. These results establish a mechanism for PSA-induced activation of APCs through a TLR2-dependent mechanism, which requires intact MyD88.
Cytokine production is TLR2 dependent
In further cytokine production studies of the role of PSA in TLR2 activation, we used cells with known TLR expression patterns. Human embryonic kidney (HEK)293 cells, which do not normally express TLR2 or TLR4, were cotransfected with the human tlr2 or tlr4 gene and incubated with the carbohydrate antigen (33, 34). PSA stimulation induced IL-8 production by TLR2-expressing cells but not by TLR4-positive cells (Fig. 2 A).
The unresponsiveness of TLR4-transfected cells to PSA confirmed the absence of E. coli LPS contamination in the PSA sample. The human astrocytoma cell line U373 (35), which lacks the TLR2 receptor, failed to produce IL-6 when stimulated with either PSA or the known TLR2 agonist MALP-3, whereas the TLR4 agonist E. coli LPS strongly induced the release of IL-6 by this cell type (Fig. 2 B).
|
BMDCs from TLR2/ mice take up PSA into their endosomal compartment
BMDCs from WT and TLR2/ mice were incubated with fluorescently labeled PSA for 3 h to allow fluorescence uptake by the APCs. Cells were then fixed and stained with MHCII-specific mAbs, and cellular localization was assessed. Both WT and TLR2/ BMDCs efficiently endocytosed PSA (Fig. 3).
PSA and MHCII colocalized within cells, a result indicating that PSA had entered the MHCII compartment within the traditional class II pathway (Fig. 3, arrows).
|
To establish a link between the adaptive arm of the immune response to PSA and our data demonstrating innate recognition of the same antigen, we examined whether PSA activation of TLR2 signaling can induce the expression of the iNOS gene. RAW macrophages were incubated with antigens for 8 h, and total mRNA was extracted and subjected to RT-PCR analysis with gene-specific primer sets. As shown in Fig. 4 A, transcription of the iNOS gene was substantially up-regulated in APCs after incubation with PSA. To confirm that increased transcription correlates with NO production, we monitored NO production by APCs in the presence and absence of blocking mAbs to TLRs using the Griess Reagent System to detect nitrite production. After stimulation for 15 h, the macrophages produced readily detectable levels of NO, but this production was significantly reduced in the presence of anti-TLR2 mAb (P = 0.0002; Fig. 4 B). NO production stimulated by E. coli LPS was not affected by this antibody.
|
PSA activation of both innate and adaptive immune responses contributes to antigen presentation and CD4+ T cell activation
TLR2 activation of NF-
B has been reported in other systems to result in the up-regulation of numerous molecules known to be important in PSA processing and presentation (e.g., NO, MHCII, and CD86) (9). We examined the role of TLR2 in the up-regulation of these molecules on BMDCs stimulated in vitro with PSA. PSA was incubated with BMDCs for 24 h, and CD11c+ cells were analyzed by flow cytometry for expression of CD86 (B7-2) and MHCII (I-E/I-A). PSA-stimulated WT BMDCs up-regulated CD86 expression by 82% and MHCII expression by 29%. BMDCs from TLR2/ mice did not up-regulate these molecules (Table I).
|
production by WT CD4+ T cells coincubated with BMDCs derived from TLR2-sufficient and -deficient mice. When PSA was presented by TLR2/ BMDCs, there was a considerable decrease in IFN-
production by CD4+ T cells (Fig. 5).
To ensure that the remaining IFN-
production resulted from PSA presented via the MHCII pathway and not from stimulation of another innate pathway, we treated both WT and TLR2/ BMDCs with chloroquine, which prevents acidification of the MHCII compartment vesiclea crucial step in the MHCII antigen-processing pathway that is required to free the peptide-binding site on the MHCII molecule before peptideMHCII interaction (37, 38). Compared with untreated co-cultures, those treated with chloroquine exhibited substantially reduced IFN-
production by CD4+ T cells when PSA was presented by WT BMDCs. Blocking presentation by TLR2/ BMDCs almost completely eliminated IFN-
production by CD4+ cells. Similar results were obtained using the drug cytochalasin D, which inhibits cytoskeleton polymerizationa process that is necessary for the endocytosis of molecules into the APC before processing by the MHCII pathway (unpublished data). The superantigen staphylococcal enterotoxin A (SEA) induced comparable IFN-
production by CD4+ cells after stimulation of either WT or TLR2/ BMDCs; in addition, chloroquine treatment did not affect SEA-induced CD4+ cell activation, because SEA does not require intracellular processing by the APC before presentation by MHCII molecules (Fig. 5). Similar experiments were performed using PSA-primed CD4+ T cells isolated from mice that had received repeated administration of 50 µg PSA over a 2-wk period. IFN-
production by these primed CD4+ T cells was greater than that seen by the naive cells after in vitro PSA stimulation in the presence of WT BMDCs only. TLR2/ BMDCs induced minimal IFN-
production even by the PSA-primed CD4+ T cells.
|
|
| DISCUSSION |
|---|
|
|
|---|
The B. fragilis surface polysaccharides are involved in key interactions with the innate immune system. The innate immune system plays a critical role in the maintenance of intestinal epithelial homeostasis and in protection against intestinal injury and associated mortality (40). We now report that innate immunity mediated by TLR2 signaling is critical for an optimal adaptive immune response to intestinal microbes, leading to the T cell activation that is essential for the development of a proper Th1/Th2 cell balance in the mammalian immune system (3).
PSA is the most abundant polysaccharide of B. fragilis. Its zwitterionic charge motif is critical for its processing by APCs in a NO-dependent fashion through the MHCII pathway and its presentation to T cells (29). DCs and macrophages are two types of professional APCs that encounter and present antigens originating in the intestine, as well as exogenous antigens found in the early stages of infection. Because these cells play a critical role in the development of T cellmediated immune responses, it is important to understand the APCPSA interaction leading to the downstream signaling events that help to shape the host response to this carbohydrate.
We have identified TLR2 as a PSA receptor that plays a critical role in initiating the innate immune response through both the production of cytokines and the priming of the adaptive response to the polysaccharide. In this paper we show that PSA initiates a critical signaling cascade in APCs wherein the polysaccharide's agonist effect on APCs leads to several important biologic events, including (a) activation of the transcription factor NF-
B, (b) production of the proinflammatory cytokine TNF-
, and (c) production of cytokines and other molecules known to modulate the adaptive immune response (e.g., IL-12, CD86, MHCII, and NO). In studies eliminating TLR2 activation with antibodies or using TLR2/ mice, we document reductions in PSA-induced NF-
B production and in the release of NO and proinflammatory cytokines. NF-
B activation by TLR2 is mediated via the MyD88 signaling pathway. These data suggest that TLR2 stimulation may facilitate NO-dependent polysaccharide processing through up-regulation of NO production. In conjunction with NO up-regulation, TLR2-mediated signaling results in up-regulation of MHCII and co-stimulatory molecule expression (CD86) by APCs, along with increases in the expression of the chemokine receptor CC chemokine receptor 7 (unpublished data). CC chemokine receptor 7 expression is associated with DC maturation and homing to the secondary lymphoid organs (41). Collectively, these TLR2-mediated events appear to be important in maximizing the adaptive immune response to PSA by enhancing DC maturation and antigen presentation.
IFN-
is important in shaping the adaptive immune response and is associated with driving Th1 cellmediated immunity. We therefore examined whether PSA could induce CD4+ T cell activation and production of this cytokine either through activation of innate immune signals or via the more classic adaptive immune pathway of MHCII-associated antigen presentation. Clearly, optimal induction of IFN-
by CD4+ T cells depends on both arms of the immune system. PSA processing and presentation by the MHCII pathway was inhibited by treatment of APCs with either chloroquine or cytochalasin (29). Both drugs partially blocked IFN-
production by T cells upon PSA presentation by DCs. These findings substantiate our earlier report that MHCII-deficient DCs fail to induce IFN-
production by CD4+ T cells in response to PSA (3). However, we now demonstrate the involvement of TLR2-mediated signaling by APCs in regulating IFN-
production by T cells. Considerably less IFN-
was produced by both naive and PSA-primed CD4+ T cells after in vitro PSA presentation by TLR2/ DCs than after PSA presentation by WT DCs. Presumably, this decreased ability to activate CD4+ T cells is linked to a combination of reduced IL-12 signaling to the T cell from TLR2 knockout DCs and decreased presentation of PSA by the MHCII pathway because of decreased NO production and decreased expression of MHCII and CD86.
We have previously shown that PSA-induced IL-12 production by DCs is vital for optimal IFN-
production by T cells (3). IL-12 is a heterodimer that is composed of two subunitsp35 and p40and is secreted by activated DCs. IL-12 signals through the IL-12R protein, which couples to the JAKSTAT signaling pathwayor, more specifically, to transcription factors such as STAT4 (42). Recent experiments have shown that a critical stage in Th1 cell differentiation from naive CD4+ T cells involves the transcription factor T-bet (T-box expressed in T cells). T-bet induces IL-12Rß2 chain expression and allows IL-12/STAT4 signaling to optimize IFN-
production, which facilitates the Th1 cell developmental process (43). In addition, we have shown that blocking IL-12 production by APCs stimulated with PSA can completely eliminate the production of IFN-
by CD4+ T cells (3). We now demonstrate that PSA induces IL-12p40 production in DCs and that the induction of IL-12p40 is substantially attenuated in TLR2/ DCs. These data suggest that TLR2 is a critical receptor on DCs that can facilitate CD4+ T cell priming through IFN-
production in response to carbohydrate antigens, a process that ultimately leads to Th1 cell differentiation. Interestingly, confocal microscopy (Fig. 3) revealed that PSA is taken up well into the endosomal compartment of TLR2-deficient DCs. Therefore, TLR2 does not function as an uptake receptor for PSA despite its importance in stimulating T cell priming.
It is important to note that macrophages, unlike DCs, fail to produce the Th1 cellstimulating cytokine IL-12 upon stimulation with PSA (Fig. 1 A). These cell typedependent effector functions may point to differential expression of pattern recognition receptors and coreceptors, as well as different signal transduction cascades in the two types of APCs (44). The innate immune system reportedly uses a wide variety of microbial recognition receptors, including TLRs, lectins, scavenger receptors, and integrins, to identify potential antigens (4547). The outcomes of receptor ligation include phagocytosis, the release of oxidative species and proinflammatory cytokines, and the development of adaptive immunity; yet, not all antigens induce these responses equally. Recently, it has been shown that DCs can differentiate between self- and nonself-antigens through TLR engagement and that, on the basis of the antigen source, these cells can generate preferentially presented peptideMHC complexes from the contents of phagosomes derived from microbes (48). It has been suggested that more than one receptor may be involved in antigen binding by TLRs (49, 50). For example, the C-type lectin dectin-1 cooperates with TLR2 to induce an inflammatory response to zymosan (51). Given the differential cytokine production by DCs and macrophages in response to PSA-mediated TLR2-dependent stimulation, it is reasonable to suggest that distinct patterns of expression of various coreceptors on individual cell types are involved in shaping the overall response to PSA. Stimulation of TLR2 by PSA appears to be partially charge dependent. Elimination of positively charged amine groups on PSA via N-acetylation reduces the production of IL-8, TNF-
, and NO by TLR2-expressing HEK cells, DCs, and macrophages (Fig. 4, C and D). These observations support previous reports that the charges on PSA are critical for polysaccharide-mediated T cell activation (2). However, one important issue related to antigen structure is that the TLR2-mediated response of the APCs tested was not solely dependent on zwitterionic charge. Sp1, another T cellactivating ZPS, failed to activate TLR2. Therefore, the zwitterionic charge motif of PSA is necessary but not sufficient to induce TLR2-mediated APC activation. Specific structurefunction studies of PSATLR2 interaction are needed.
We show in this paper that both the innate and adaptive pathways of immunity are involved in at least one biologic response to PSA: intraabdominal abscess formation. TLR2-deficient mice display a substantially reduced ability to form intraabdominal abscesses after challenge with either PSA or live bacteria along with SCC (Fig. 6). We have previously shown that mice with defects in antigen processing or presentation by the MHCII pathway are likewise unable to form abscesses (29). Interplay of the two arms of the immune system may be required not only for an optimal response to PSA but also for other biologic functions of PSA, such as stimulation of cell lineage differentiation.
The identification of a critical role for TLR2 signaling in PSA-mediated activation of APCs adds an essential piece of information to our understanding of how this polysaccharide antigen stimulates the host immune response. On the basis of these data, we propose an integrated model for PSA-dependent activation of DCs and CD4+ T cells that involves considerable interplay of the innate and adaptive arms of the immune system (Fig. 7).
In the innate portion of this response, PSA stimulates APCs through a TLR2-dependent mechanism. TLR2 activation then results in NF-
Bdependent NO production, which is critical for PSA processing and presentation by MHCII and, thus, for initiation of the adaptive immune response. PSA-mediated TLR2 signaling also up-regulates MHCII and co-stimulatory molecule expression on the surface of APCs, further linking the innate and adaptive responses to this antigen. Upon antigen presentation by MHCII and recognition by
ß T cell receptors (along with co-stimulation), PSA-activated CD4+ T cells secrete IFN-
. This process is enhanced by the production of the cytokine IL-12 by DCs, which occurs as a consequence of TLR2 stimulation. These experiments identify TLR2 as a major factor in initiating the host response required for optimal CD4+ T cell responses to PSA. Moreover, the results of these studies define a novel system that identifies the crucial interplay between the innate and adaptive arms of the host response.
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
HEK-293 cells were stably transfected with TLR2 or TLR4 (33, 34). Mouse RAW 264.7 macrophages and human THP-1 monocytes were obtained from the American Type Culture Collection. THP-1 cells were incubated with 100 ng/ml PMA for 3 d to obtain macrophages. Unless stated otherwise, cells were grown in a cell culture incubator at 37°C with 5% CO2.
Primary cell culture.
BMDCs were cultured by previously described methods with minor modifications (33). In brief, bone marrow was collected from femurs and tibias of 8-wk-old WT, TLR2/, or MyD88/ mice. Cells were resuspended in complete RPMI medium (American Type Culture Collection) containing 10 ng/ml GM-CSF (R&D Systems). After 4 d of culture, cells were placed in fresh medium containing GM-CSF. On day 7, adherent and nonadherent cells were collected and seeded into either 6- or 96-well culture plates, and experiments were performed the next day.
Bacteria and reagents.
PSA was purified from a mutant strain of B. fragilis (
44) according to a previously published method (52). No LPS was detectable in the PSA preparation by gel electrophoresis, 1H-NMR analysis, or endotoxin assay. PSA was modified with acetic anhydride in 0.1 M NaHCO3 to obtain N-acetylated PSA.
E. coli LPS was purchased from Sigma-Aldrich and was further purified by phenol extraction A synthetic lipopeptide, MALP-3 (Pam3Cys-SKKKK), was purchased from EMC microcollections GmbH and was used as a TLR2 agonist. Polysaccharide controls included mannan, polygalacturonic acid, and ZPS from Sp1.
RT-PCR.
RAW 264.7 cells were plated at 5 x 105 in 3 ml of DMEM on sixwell plates 24 h before assay. Different antigens (100 µg/ml PSA, 20 nM MALP-3, and 250 ng/ml LPS) were added to corresponding wells, and plates were incubated for another 8 h. Total RNA was extracted with RNeasy columns (QIAGEN) according to the manufacturer's protocol. RT-PCR was performed with gene-specific primer sets for the GAPDH, iNOS, and TNF-
genes. 100 ng of total mRNA was subjected to one-step RT-PCR (SuperScript III; Invitrogen) and amplified (iCycler; Bio-Rad Laboratories). The primer sequences and sizes of PCR products were as follows: GAPDH, GGTGTGAACCACGAGAAATA (forward) and CTGTTGCTGTAGCCGTATTC (reverse; 569 bp) (1); iNOS, ACGCTTGGGTCTTGTTCACT (forward) and GTCTCTGGGTCCTCTGGTCA (reverse; 468 bp) (2); and TNF-
, AGCACAGAAAGCATGATCCG (forward) and CAGAGCAATGACTCCAAAGT (reverse; 702 bp) (3).
NO detection.
NO production was quantified by measurement of the accumulation of nitrite (NO2, a stable end product of NO) in cell culture supernatants with the Griess Reagent System (Promega).
NF-
B detection.
The production of NF-
B p65 (RelA) was measured with NF-
B assay kits (TransAm; Active Motif).
Confocal microscopy.
Confocal microscopy was performed as previously described (29).
BMDC and CD4+ T cell co-culture experiments.
For analysis of IFN-
production by CD4+ T cells, T cells were isolated from spleens of C57BL/6J mice (The Jackson Laboratory) by centrifugation in Ficoll and were purified on CD4+ T cell enrichment columns (R&D Systems). BMDCs were purified from the femurs of both C57BL/6J and TLR2/ mice as described previously (33). For cytokine assays, 2 x 105 CD4+ T cells were combined with 105 BMDCs in 96-well round-bottom plates, and antigens and inhibitor drugs were added. SEA and PSA were used at concentrations of 10 ng and 100 µg, respectively. Preliminary doseresponse experiments were conducted to determine the optimal concentration of each inhibitor drug, i.e., the lowest concentration that inhibited the endosomal pathway and was not toxic for the BMDCs. For inhibition experiments, 1 µM cytochalasin D or 1 µg/ml chloroquine were added to the cells simultaneously with the antigens
Flow cytometry.
BMDCs were incubated for 24 h with either 100 µg/ml PSA or culture media. Cells were then harvested and incubated with fluorescent-conjugated mAbs to the cell surface markers CD86 (clone GL1) and I-A/I-E (clone M5/114.15.2; BD Biosciences) for 30 min at 4°C. Cells were washed and analyzed on a flow cytometer (FC500; Beckman Coulter). Appropriate isotype controls were included in each experiment.
ELISA.
All cytokine ELISA kits, except the one for IL-12p40 (BD Biosciences), were obtained from R&D Systems. 105 cells were seeded onto 96-well flat-bottom plates 1 d before stimulation. Different concentrations of antigens (e.g., PSA, MALP-3, and LPS) were added to wells in triplicate (with a medium control), and plates were incubated for 15 h.
Mouse model of intraabdominal abscess formation.
The intraabdominal abscess model used in these studies was based on that described in a previous publication (53).
Statistical analysis.
Results are expressed as mean ± SD. Data were analyzed, as appropriate, by unpaired t tests with Prism software for Windows (version 3.00; GraphPad Software). Differences were considered statistically significant at P < 0.05.
| Acknowledgments |
|---|
This work was supported by National Institutes of Health/National Institute of Allergy and Infectious Diseases grant R01AI039576 to D.L. Kasper.
The authors have no conflicting financial interests.
Submitted: 18 September 2006
Accepted: 9 November 2006
| REFERENCES |
|---|
|
|
|---|
1 Krinos, C.M., M.J. Coyne, K.G. Weinacht, A.O. Tzianabos, D.L. Kasper, and L.E. Comstock. 2001. Extensive surface diversity of a commensal microorganism by multiple DNA inversions. Nature. 414:555558.[CrossRef][Medline]
2 Tzianabos, A.O., A.B. Onderdonk, B. Rosner, R.L. Cisneros, and D.L. Kasper. 1993. Structural features of polysaccharides that induce intra-abdominal abscesses. Science. 262:416419.
3 Mazmanian, S.K., C.H. Liu, A.O. Tzianabos, and D.L. Kasper. 2005. An immunomodulatory molecule of symbiotic bacteria directs maturation of the host immune system. Cell. 122:107118.[CrossRef][Medline]
4 Tzianabos, A., J.Y. Wang, and D.L. Kasper. 2003. Biological chemistry of immunomodulation by zwitterionic polysaccharides. Carbohydr. Res. 338:25312538.[CrossRef][Medline]
5 Tzianabos, A.O., R.W. Finberg, Y. Wang, M. Chan, A.B. Onderdonk, H.J. Jennings, and D.L. Kasper. 2000. T cells activated by zwitterionic molecules prevent abscesses induced by pathogenic bacteria. J. Biol. Chem. 275:67336740.
6 Yeh, W.C., and N.J. Chen. 2003. Immunology: another toll road. Nature. 424:736737.[CrossRef][Medline]
7 Barton, G.M., and R. Medzhitov. 2003. Toll-like receptor signaling pathways. Science. 300:15241525.
8 Takeda, K., T. Kaisho, and S. Akira. 2003. Toll-like receptors. Annu. Rev. Immunol. 21:335376.[CrossRef][Medline]
9 Pasare, C., and R. Medzhitov. 2004. Toll-like receptors: linking innate and adaptive immunity. Microbes Infect. 6:13821387.[CrossRef][Medline]
10 Miller, S.I., R.K. Ernst, and M.W. Bader. 2005. LPS, TLR4 and infectious disease diversity. Nat. Rev. Microbiol. 3:3646.[CrossRef][Medline]
11 Erridge, C., A. Pridmore, A. Eley, J. Stewart, and I.R. Poxton. 2004. Lipopolysaccharides of Bacteroides fragilis, Chlamydia trachomatis and Pseudomonas aeruginosa signal via toll-like receptor 2. J. Med. Microbiol. 53:735740.
12 Khan, A.Q., Q. Chen, Z.Q. Wu, J.C. Paton, and C.M. Snappe. 2005. Both innate immunity and type 1 humoral immunity to Streptococcus pneumoniae are mediated by MyD88 but differ in their relative levels of dependence on toll-like receptor 2. Infect. Immun. 73:298307.
13 Takeda, K., and S. Akira. 2004. TLR signaling pathways. Semin. Immunol. 16:39.[CrossRef][Medline]
14 Stockinger, S., B. Reutterer, B. Schaljo, C. Schellack, S. Brunner, T. Materna, M. Yamamoto, S. Akira, T. Taniguchi, P.J. Murray, et al. 2004. IFN regulatory factor 3-dependent induction of type I IFNs by intracellular bacteria is mediated by a TLR- and Nod2-independent mechanism. J. Immunol. 173:74167425.
15 Mempel, M., V. Voelcker, G. Kollisch, C. Plank, R. Rad, M. Gerhard, C. Schnopp, P. Fraunberger, A.K. Walli, J. Ring, et al. 2003. Toll-like receptor expression in human keratinocytes: nuclear factor kappaB controlled gene activation by Staphylococcus aureus is toll-like receptor 2 but not toll-like receptor 4 or platelet activating factor receptor dependent. J. Invest. Dermatol. 121:13891396.[CrossRef][Medline]
16 Reis e Sousa, C. 2004. Toll-like receptors and dendritic cells: for whom the bug tolls. Semin. Immunol. 16:2734.[CrossRef][Medline]
17 Mazzoni, A., and D.M. Segal. 2004. Controlling the Toll road to dendritic cell polarization. J. Leukoc. Biol. 75:721730.
18 Guillot, L., G.R. Le, S. Bloch, N. Escriou, S. Akira, M. Chignard, and M. Si-Tahar. 2005. Involvement of toll-like receptor 3 in the immune response of lung epithelial cells to double-stranded RNA and influenza A virus. J. Biol. Chem. 280:55715580.
19 Iwasaki, A., and R. Medzhitov. 2004. Toll-like receptor control of the adaptive immune responses. Nat. Immunol. 5:987995.[CrossRef][Medline]
20 Sun, J., M. Walsh, A.V. Villarino, L. Cervi, C.A. Hunter, Y. Choi, and E.J. Pearce. 2005. TLR ligands can activate dendritic cells to provide a MyD88-dependent negative signal for Th2 cell development. J. Immunol. 174:742751.
21 Gelman, A.E., J. Zhang, Y. Choi, and L.A. Turka. 2004. Toll-like receptor ligands directly promote activated CD4+ T cell survival. J. Immunol. 172:60656073.
22 Pasare, C., and R. Medzhitov. 2004. Toll-dependent control mechanisms of CD4 T cell activation. Immunity. 21:733741.[CrossRef][Medline]
23 Chalifour, A., P. Jeannin, J.F. Gauchat, A. Blaecke, M. Malissard, T. N'Guyen, N. Thieblemont, and Y. Delneste. 2004. Direct bacterial protein PAMP recognition by human NK cells involves TLRs and triggers alpha-defensin production. Blood. 104:17781783.
24 Schjetne, K.W., K.M. Thompson, N. Nilsen, T.H. Flo, B. Fleckenstein, J.G. Iversen, T. Espevik, and B. Bogen. 2003. Cutting edge: link between innate and adaptive immunity: Toll-like receptor 2 internalizes antigen for presentation to CD4+ T cells and could be an efficient vaccine target. J. Immunol. 171:3236.
25 Alexander, C., and E.T. Rietschel. 2001. Bacterial lipopolysaccharides and innate immunity. J. Endotoxin Res. 7:167202.[CrossRef]
26 Han, S.B., Y.D. Yoon, H.J. Ahn, H.S. Lee, C.W. Lee, W.K. Yoon, S.K. Park, and H.M. Kim. 2003. Toll-like receptor-mediated activation of B cells and macrophages by polysaccharide isolated from cell culture of Acanthopanax senticosus. Int. Immunopharmacol. 3:13011312.[CrossRef][Medline]
27 Termeer, C., F. Benedix, J. Sleeman, C. Fieber, U. Voith, T. Ahrens, K. Miyake, M. Freudenberg, C. Galanos, and J.C. Simon. 2002. Oligosaccharides of hyaluronan activate dendritic cells via Toll-like receptor 4. J. Exp. Med. 195:99111.
28 Monari, C., F. Bistoni, A. Casadevall, E. Pericolini, D. Pietrella, T.R. Kozel, and A. Vecchiarelli. 2005. Glucuronoxylomannan, a microbial compound, regulates expression of costimulatory molecules and production of cytokines in macrophages. J. Infect. Dis. 191:127137.[CrossRef][Medline]
29 Cobb, B.A., Q. Wang, A.O. Tzianabos, and D.L. Kasper. 2004. Polysaccharide processing and presentation by the MHCII pathway. Cell. 117:677687.[CrossRef][Medline]
30 Tzianabos, A.O., A. Chandraker, W. Kalka-Moll, F. Stingele, V.M. Dong, R.W. Finberg, R. Peach, and M.H. Sayegh. 2000. Bacterial pathogens induce abscess formation by CD4(+) T-cell activation via the CD28-B7-2 costimulatory pathway. Infect. Immun. 68:66506655.
31 Meng, G., M. Rutz, M. Schiemann, J. Metzger, A. Grabiec, R. Schwandner, P.B. Luppa, F. Ebel, D.H. Busch, S. Bauer, et al. 2004. Antagonistic antibody prevents toll-like receptor 2-driven lethal shock-like syndromes. J. Clin. Invest. 113:14731481.[CrossRef][Medline]
32 Liang, Y., Y. Zhou, and P. Shen. 2004. NF-kappaB and its regulation on the immune system. Cell. Mol. Immunol. 1:343350.[Medline]
33 Latz, E., J. Franko, D.T. Golenbock, and J.R. Schreiber. 2004. Haemophilus influenzae type b-outer membrane protein complex glycoconjugate vaccine induces cytokine production by engaging human toll-like receptor 2 (TLR2) and requires the presence of TLR2 for optimal immunogenicity. J. Immunol. 172:24312438.
34 Divanovic, S., A. Trompette, S.F. Atabani, R. Madan, D.T. Golenbock, A. Visintin, R.W. Finberg, A. Tarakhovsky, S.N. Vogel, Y. Belkaid, et al. 2005. Negative regulation of Toll-like receptor 4 signaling by the Toll-like receptor homolog RP105. Nat. Immunol. 6:571578.[CrossRef][Medline]
35 Savedra, R., Jr., R.L. Delude, R.R. Ingalls, M.J. Fenton, and D.T. Golenbock. 1996. Mycobacterial lipoarabinomannan recognition requires a receptor that shares components of the endotoxin signaling system. J. Immunol. 157:25492554.[Abstract]
36 Hampton, M.B., A.J. Kettle, and C.C. Winterbourn. 1998. Inside the neutrophil phagosome: oxidants, myeloperoxidase, and bacterial killing. Blood. 92:30073017.
37 Riberdy, J.M., J.R. Newcomb, M.J. Surman, J.A. Barbosa, and P. Cresswell. 1992. HLA-DR molecules from an antigen-processing mutant cell line are associated with invariant chain peptides. Nature. 360:474477.[CrossRef][Medline]
38 Sloan, V.S., P. Cameron, G. Porter, M. Gammon, M. Amaya, E. Mellins, and D.M. Zaller. 1995. Mediation by HLA-DM of dissociation of peptides from HLA-DR. Nature. 375:802806.[CrossRef][Medline]
39 Chung, D.R., D.L. Kasper, R.J. Panzo, T. Chtinis, M.J. Grusby, M.H. Sayegh, and A.O. Tzianabos. 2003. CD4+ T cells mediate abscess formation in intra-abdominal sepsis by an IL-17-dependent mechanism. J. Immunol. 170:19581963.
40 Rakoff-Nahoum, S., J. Paglino, F. Eslami-Varzaneh, S. Edberg, and R. Medzhitov. 2004. Recognition of commensal microflora by toll-like receptors is required for intestinal homeostasis. Cell. 118:229241.[CrossRef][Medline]
41 Sallusto, F., P. Schaerli, P. Loetscher, C. Schaniel, D. Lenig, C.R. Mackay, S. Qin, and A. Lanzavecchia. 1998. Rapid and coordinated switch in chemokine receptor expression during dendritic cell maturation. Eur. J. Immunol. 28:27602769.[CrossRef][Medline]
42 Jacobson, N.G., S.J. Szabo, R.M. Weber-Nordt, Z. Zhong, R.D. Schreiber, J.E. Darnell Jr., and K.M. Murphy. 1995. Interleukin 12 signaling in T helper type 1 (Th1) cells involves tyrosine phosphorylation of signal transducer and activator of transcription (STAT) 3 and STAT4. J. Exp. Med. 181:17551762.
43 Robinson, D.S., and A. O'Garra. 2002. Further checkpoints in Th1 development. Immunity. 16:755758.[CrossRef][Medline]
44 Baltathakis, I., O. Alcantara, and D.H. Boldt. 2001. Expression of different NF-kappaB pathway genes in dendritic cells (DCs) or macrophages assessed by gene expression profiling. J. Cell. Biochem. 83:281290.[CrossRef][Medline]
45 Underhill, D.M., and A. Ozinsky. 2002. Phagocytosis of microbes: complexity in action. Annu. Rev. Immunol. 20:825852.[CrossRef][Medline]
46 Geijtenbeek, T.B., S.J. van Vliet, A. Engering, B.A. 't Hart, and K.Y. van Kooyk. 2004. Self- and nonself-recognition by C-type lectins on dendritic cells. Annu. Rev. Immunol. 22:3354.[CrossRef][Medline]
47 Cambi, A., K. Gijzen, J.M. de Vries, R. Torensma, B. Joosten, G.J. Adema, M.G. Netea, B.J. Kullberg, L. Romani, and C.G. Figdor. 2003. The C-type lectin DC-SIGN (CD209) is an antigen-uptake receptor for Candida albicans on dendritic cells. Eur. J. Immunol. 33:532538.[CrossRef][Medline]
48 Blander, J.M., and R. Medzhitov. 2006. Toll-dependent selection of microbial antigens for presentation by dendritic cells. Nature. 440:808812.[CrossRef][Medline]
49 Mukhopadhyay, S., J. Herre, G.D. Brown, and S. Gordon. 2004. The potential for Toll-like receptors to collaborate with other innate immune receptors. Immunology. 112:521530.[CrossRef][Medline]
50 Philpott, D.J., and S.E. Girardin. 2004. The role of Toll-like receptors and Nod proteins in bacterial infection. Mol. Immunol. 41:10991108.[CrossRef][Medline]
51 Gantner, B.N., R.M. Simmons, S.J. Canavera, S. Akira, and D.M. Underhill. 2003. Collaborative induction of inflammatory responses by dectin-1 and Toll-like receptor 2. J. Exp. Med. 197:11071117.
52 Tzianabos, A.O., A. Pantosti, H. Baumann, J.R. Brisson, H.J. Jennings, and D.L. Kasper. 1992. The capsular polysaccharide of Bacteroides fragilis comprises two ionically linked polysaccharides. J. Biol. Chem. 267:1823018235.
53 Tzianabos, A.O., P.R. Russell, A.B. Onderdonk, F.C. Gibson III, C. Cywes, M. Chan, R.W. Finberg, and D.L. Kasper. 1999. IL-2 mediates protection against abscess formation in an experimental model of sepsis. J. Immunol. 163:893897.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|