|
||
BRIEF DEFINITIVE REPORT |
CORRESPONDENCE Warren S. Pear: wpear{at}mail.med.upenn.edu
|
|
|---|
ß transgenes failed to rescue DNMAML-related defects. Intrathymic injections of DNMAML or DNMAML+ DN thymocytes revealed a complete DN/DP transition block, with production of DNMAML+ DP thymocytes only from cells undergoing late Notch inactivation. These findings indicate that the Notch requirement during the ß-selection checkpoint in vivo is absolute and independent of the pre-TCR, and it depends on transcriptional activation by Notch via the CSL/RBP-JMAML complex.
Notch regulates multiple stages of T cell development (1, 2). Canonical Notch signaling involves release of the intracellular (i.c.) Notch (ICN) domain into the cytoplasm and ICN migration to the nucleus. ICN forms a complex with the transcription factor CSL/RBP-J, creating a binding interface that recruits transcriptional coactivators of the Mastermind-like (MAML) family (3). Disruption of Notch1 signaling leads to B cell accumulation in the thymus and a block in T cell development (4). Notch is required to generate the earliest T lineage progenitors in the thymus (5, 6). Subsequent differentiation depends on continuous Notch signaling (711). In particular, Notch is important for developmental progression from the CD4CD8 double-negative (DN) to the CD4+CD8+ double-positive (DP) stage at the ß-selection checkpoint.
Several studies have identified a role for Notch during ß-selection, although they have provided conflicting information as to the mechanism and importance of this effect. In vivo, Lck-Cre (LC)mediated inactivation of Notch1 or CSL/RBP-J at the CD25+CD44 DN3 stage decreased but did not abolish the generation of DP cells (7, 9). This was associated with accumulation of DN3 cells that were abnormally bright for CD25 and CD25CD44 DN4-like cells with reduced expression of i.c. TCRß. DN3 and DN4 cells in Notch1-deficient mice had impaired V-DJß rearrangement (7). In addition, Notch could induce Ptcra transcripts (encoding pre-TCR
The basis for the discrepancy between the in vivo and in vitro data is unclear. One possibility is that the requirement for the metabolic effects of Notch is less stringent in vivo than in vitro. This could create a situation in which effects of Notch on pre-TCR expression are limiting only in vivo. Alternatively, pre-TCRindependent effects of Notch could be critical in vivo, and the apparent leakiness of the DN-DP transition block could be related to the precise timing of Notch inactivation.
To address these questions, we generated mice expressing a conditional allele of the pan-Notch inhibitor dominant-negative MAML1 (DNMAMLf/+) (13, 14). The DNMAML allele is linked to a GFP sequence, providing the opportunity to track single Notch-deprived cells. We bred DNMAMLf/+ mice with LC transgenic (tg) mice. Our results demonstrate an absolute requirement for a CSL/RBP-Jdependent, pre-TCRindependent effect of Notch at the ß-selection checkpoint in vivo.
) (12). These findings suggested that Notch might act at the ß-selection checkpoint by regulating pre-TCR expression. In contrast, in vitro studies have suggested that the requirement for Notch was independent of the pre-TCR (10). Instead, Notch was shown to influence cellular metabolism and survival through a molecular pathway involving activated Akt (11).
![]()
RESULTS AND DISCUSSION
Top
ABSTRACT
RESULTS AND DISCUSSION
MATERIALS AND METHODS
REFERENCES
Impaired
ß but not 
T cell development in LC x DNMAMLf/+ (LCD) mice
To inhibit signaling from all Notch receptors (Notch14), we generated DNMAMLf/+ mice (14) (Fig. 1 A).
These mice harbor a cassette encoding the GFP-tagged Notch inhibitor DNMAML downstream of a floxed sequence that prevents transcription of DNMAML. Cre recombinase results in DNMAML expression from the ubiquitously active ROSA26 promoter. Notch-deprived cells can be tracked through GFP detection. DNMAMLf/+ mice were crossed to LC tg mice to generate LCD mice and compared with control LC littermates. GFP expression was detected in a small percentage of CD44+CD25+ DN2 cells (Fig. 1 B). In subsequent stages, DNMAML was induced in >50% of CD44CD25+ DN3 cells and >95% of CD44CD25 DN4, TCRßCD8+ immature single-positive and CD4+CD8+ DP cells.
|
ß T cell development, as shown by a decreased percentage of DP and an increased percentage of DN cells (Fig. 1 C), translating into a four to fivefold decrease in thymic cellularity (Fig. 1 D). The absolute number of DN cells was preserved, whereas numbers of immature single-positive, DP, CD4+ single positive (SP) and mature CD8+ SP cells were decreased, which was consistent with a block at the DN-DP transition. Among CD3+ thymocytes, the percentage of TCR
+ cells was increased in LCD mice (Fig. 1 C), an effect secondary to decreased TCRß+ cells because the absolute number of TCR
+ cells was maintained (Fig. 1 D). This was observed despite expression of DNMAML in
80% of LCD 
thymocytes (Fig. 1 B). Regarding
ß T cell development, our observations in LCD mice were consistent with findings reported after LC-mediated inactivation of Notch1 or CSL/RBP-J (7, 9). In contrast, the preservation of 
thymocytes in LCD mice was similar to LC x Notch1f/f mice (7) but differed from the increase in absolute 
cell numbers in LC x CSL/RBP-Jf/f mice (9). This cannot be explained by Notch24 activity after Notch1 deletion because signaling from all four Notch receptors is inhibited both by DNMAML (14) and the absence of CSL/RBP-J. A potential explanation is that Notch-independent CSL/RBP-Jmediated transcriptional repression plays a role during 
development. This repressor function would be lost in the absence of CSL/RBP-J but is unaffected by DNMAML. Alternatively, subtle differences in genetic background or timing of Notch inactivation may account for the discrepant results.
Characterization of LCD CD4CD8 DN thymocytes
We studied the phenotype of Lin DN thymocytes in LC and LCD mice (Fig. 2), using GFP to better define the effects of Notch deprivation.
The proportions of DN2, DN3, and DN4 cells were similar in LC and LCD thymi (Fig. 2 A). LCD DN3 cells expressed higher levels of CD25 than LC DN3 cells (Fig. 2 A). Although the difference was modest, it was statistically significant (Fig. S1, available at http://www.jem.org/cgi/content/full/jem.20061020/DC1). In addition to DN3 cells, abnormal CD25hi DN2 cells were also present in LCD mice. These findings were reminiscent of the CD25hi DN2-DN3 population observed after LC-mediated inactivation of Notch1 or CSL/RBP-J (7, 9). This population was hypothesized to represent Notch-deprived DN2-DN3 cells that failed to undergo ß-selection, as in mice lacking pre-TCR components (7). However, all CD25hi DN2-DN3 cells in LCD mice were GFP, whereas GFP+ DN3 cells expressed lower levels of CD25 than the GFP DN3 cohort (Fig. 2 A). These findings indicated that CD25hi DN2-DN3 cells emerged in LCD mice not as a direct consequence of Notch deprivation but because of a noncell autonomous effect; e.g., an abnormality in intrathymic niches occupied by DNMAML+ DN cells.
|
(Fig. 2 B and Fig. S2, available at http://www.jem.org/cgi/content/full/jem.20061020/DC1). The percentage of i.c. TCRß+ DN3 and DN4 cells showed a modest, though statistically significant, decrease in LCD as compared with LC mice. The percentage of i.c. TCR
+ thymocytes was not significantly different.
We then examined LC/LCD DN3 cells for phenotypic changes associated with ß-selection (Fig. 2, CE). DN3 cells exposed to pre-TCR signals exhibit active cell cycling, increased cell size, and CD27 up-regulation (DN3b population) (15). FSChiCD27hi or CD44loCD27hi DN3b cells were reduced in LCD as compared with LC thymi (Fig. 2 C). When assessed for DNA content, a smaller proportion of DN3 cells were in the S-G2M phases of the cell cycle (Fig. 2 D) and fewer cells incorporated BrdU in LCD as compared with LC DN3 cells (Fig. 2 E). In contrast, no significant proliferation defect was detected in DN4 cells. The proportion of i.c. TCRß+ cells was reduced among BrdU+ LCD as compared with LC DN3 cells (LC, 68 ± 3% vs. LCD, 43 ± 4%; mean ± SEM; P < 0.01), a finding that was consistent with reports of impaired proliferation, predominantly in
ß lineage cells in vitro (16, 17). Collectively, these findings indicate that Notch-deprived DN3 cells, although detected phenotypically as CD25lo cells at the DN3-DN4 transition, failed to undergo the typical changes associated with ß-selection. We recently reported that Notch directly up-regulates c-myc transcription in primary DN3 cells and T cell leukemia cell lines, suggesting that abrogation of the Notchc-myc axis contributes to the ß-selection defects in LCD mice (18).
In vitro studies using Rag-deficient DN3 cells on OP9-DL1 stroma found that Notch signaling had important roles in cell metabolism and survival. In contrast, we did not detect consistent abnormalities in Annexin V staining and cellular bioenergetics, as measured by tetramethylrhodamine ethyl ester labeling in LCD thymi (unpublished data). This does not rule out Notch-related changes in these parameters because compromised/dying thymocytes are rapidly eliminated and have been notoriously difficult to detect in vivo (19).
The in vivo DNMAML-related defects were reminiscent of in vitro findings using OP9 cells in which the main consequences of Notch deprivation were growth arrest, decreased cell size, and eventual cell death (10, 11). To better understand changes induced by the loss of Notch signaling, we assessed cell size and CD25 expression in cultures of LC DN3 or LCD GFP+ DN3 thymocytes with OP9-DL1 cells (Fig. 3 A). After 24 h, LCD GFP+ DN3 cells exhibited decreased cell size and CD25 expression when compared with LC DN3 cells. Therefore, these changes resulted from a transcriptional effect of Notch signaling mediated by the ICN-CSL-RBP-JMAML complex. The rapid modulation of CD25 expression suggested that Cd25 (Il2ra) is a direct transcriptional Notch target in thymocytes (20). A chromatin precipitation (ChIP) assay showed that Notch1 associated with two conserved CSL/RBP-J binding sites in the Il2ra locus; one is located immediately upstream of the transcription start site and the other in intron 3 (Fig. 3 B) These findings confirm that Il2ra is a Notch transcriptional target in developing thymocytes.
|
No rescue of Notch-deprived DN cells by Tcrb or Tcra/b transgenes
As in the absence of Notch1 and CSL/RBP-J (7, 9), i.c. TCRß expression was decreased in LCD DN3 cells (Fig. 2 B). To assess if this was functionally relevant in vivo, we crossed LCD mice to Tcrb tg mice (Fig. 4, A and B).
DNMAML did not affect transgene expression (Fig. S3, available at http://www.jem.org/cgi/content/full/jem.20061020/DC1). The Tcrb transgene failed to restore cellularity of LCD thymi back to normal numbers (Fig. 4 A), despite a twofold increase in LCD/Tcrb tg mice. The percentage of LCD DP cells was decreased with and without the transgene (Fig. 4 B), although the decrease was slightly less pronounced with Tcrb. However, we consistently observed a higher percentage of GFP cells among DP thymocytes of LCD/Tcrb tg than in non-tg LCD mice. This suggested that the transgene accelerated the transition through DN2-DN4 stages of development, allowing more DP cells to arise without being exposed to DNMAML. Together, these results indicated that a Tcrb transgene did not rescue Notch inactivation at the ß-selection checkpoint in vivo.
|
expression (12). To assess if this played a limiting role in vivo, we crossed LCD mice to TcrAND tg mice (Fig. 4, C and D). These mice express Tcra/b transgenes that can substitute for pre-TCR function (21), though with reduced efficiency (22). Expression of the Tcra/b transgenes did not restore thymic cellularity (Fig. 4 C). Accordingly, the percentage of DP cells was reduced in LCD/TcrAND as compared with TcrAND mice (Fig. 4 D). Similar results were observed with DO11.10 tg mice (unpublished data). These results show that Notch deprivation in vivo cannot be rescued by restoring pre-TCR function. Instead, they suggest that Notch and the pre-TCR act in parallel pathways. An important future task will be to characterize the interactions between Notch, pre-TCR signals, and other partners that are active during ß-selection, such as E proteins. Of note, recent work indicates that Notch and E proteins cooperate during T lineage commitment (23).
Intrathymic injections reveal an absolute DN to DP differentiation block in the absence of Notch signaling in vivo
In vitro experiments suggested an absolute requirement for Notch at the DN-DP transition (10, 11). However, the generation of LCD DP cells was reduced but not abolished in vivo. This could be explained by a less stringent requirement for Notch signaling in vivo or by the precise kinetics of LC-mediated excision. To differentiate between these possibilities, we purified GFP and GFP+ DN3 cells from LCD mice and performed intrathymic injections (Fig. 5).
Control LC DN3 cells gave rise to donor-derived DP/SP T cells 10 d after injection (Fig. 5 A, top). In contrast, Notch-deprived GFP+ LCD DN3 cells gave rise to no or barely detectable progeny (Fig. 5 A, middle). There was at least a 3-log reduction in donor-derived cells in the absence of Notch signaling (Fig. 5 B). When GFP LCD DN3 cells were injected, significant numbers of donor-derived DP/SP cells were observed at day 10 (Fig. 5 A, bottom), and >50% of these cells were GFP+ as a result of DNMAML induction in vivo between injection and analysis. These results indicate that the requirement for Notch during ß-selection is as stringent in vivo as in vitro. Furthermore, the apparently partial differentiation block observed in vivo results from late Notch inactivation in a fraction of DN3-DN4 cells.
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
Antibodies.
The following antibodies were from obtained from BD Biosciences or eBioscience: PE anti-CD25 (PC61), CD27 (LG.7F9), TCRß (H57-597), TCR
(GL3), CD4 (RM4-5), and CD3 (145-2C11); APC anti-CD4, TCRß, CD44 (IM7), and BrdU; biotinylated anti-CD45.2 (104), CD8 (53-6.7), TCRß, TCR
, CD4 (GK1.5), CD3, NK1.1 (PK136), B220 (RA3-6B2), CD19 (1D3), CD11b (M1/70), Gr1 (RB6-8C5), and CD11c (HL3); APC-Cy7 anti-CD25; and PE-Cy5.5 anti-CD44 and PE-Cy7 anti-CD45.1 (A20). Biotinylated antibodies were revealed with streptavidin-PerCP (BD Biosciences), Pacific Blue (Invitrogen), or PETexas red (Caltag). Lineage+ cells were defined with anti-CD8, TCRß, TCR
, NK1.1, CD3, B220, CD19, CD11b, Gr1, and CD11c.
Flow cytometry and cell sorting.
Cells were stained in PBS/2% FCS. i.c. staining was performed with fixation/permeabilization or BrdU labeling kits (Becton Dickinson). 0.5 mg BrdU was administered i.p. 3 and 1 h before death. Cells were sorted on a FACS DiVa (Beckton Dickinson) or a MoFlo (DakoCytomation). Analysis was performed on a FACS Calibur or LSR II (Becton Dickinson). DAPI was used to exclude dead cells or assess DNA content in fixed cells. Files were analyzed with software (FlowJo; Tree Star, Inc.).
Intrathymic injections.
12 x 105 sorted DN3 cells were injected intrathymically in anesthetized B6.CD45.1 recipients given 500 rad 26 h before injection.
OP9 cultures.
OP9-DL1 cells were provided by J.C. Zuniga-Pflucker (University of Toronto, Toronto, Canada) and used as previously described (24). Progenitors were seeded into 24-well plates containing a stromal monolayer with 1 ng/ml mIL-7 (PeproTech).
ChIP.
ChIP was performed from Rag-2/ DN3 cells using Notch1 TAD domainspecific antiserum (25), anti-acetylated histone 4 (Upstate Biotechnology), or rabbit IgG (Santa Cruz Biotechnology, Inc.), as previously described (18). Quantitative PCR was performed with SYBR green (Applied Biosystems) and the following Il2ra-specific primers: 25K, 5' CAGTCATTGGTTGGCCACTCT 3' and 5' GGACCTCCATGCAGACATCA 3'; promoter, 5' TGTTGAGTCTTCTGGGGGAGAA 3' and 5' CTAGGAGGTGTGGGCAGTGTTT 3'; and intron 3, 5' TGCAGCATGGGTCAAATGAA 3' and 5' AGGTCTCCCCAGGAAAAGTCAC 5'.
Online supplemental material.
Fig. S1 depicts CD25 median fluorescence intensity in Lin CD44 DN3/DN4 LCD as compared with LC thymocytes. Fig. S2 shows expression of i.c. TCRß and i.c. TCR
in Lin DN3-DN4 LC and LCD thymocytes (a representative example is presented). Fig. S3 shows expression of i.c. TCRß in the presence or absence of a Tcrb transgene in LC and LCD DN thymocyte subsets.
| Acknowledgments |
|---|
This work was supported by grants from the National Institutes of Health (NIH) to A. Bhandoola and W.S. Pear. Individual support was provided by a grant from the Damon Runyon Cancer Research Foundation to I. Maillard (DRG-102-05), NIH training grants to L. Tu (T32HL007439-27) and J. Millholland (T32CA09140-31-35), and a Leukemia & Lymphoma Society Fellow Award to K. Keeshan and a Scholar Award to A. Bhandoola.
The authors have no conflicting financial interests.
Submitted: 12 May 2006
Accepted: 21 August 2006
| REFERENCES |
|---|
|
|
|---|
1 Radtke, F., A. Wilson, S.J. Mancini, and H.R. MacDonald. 2004. Notch regulation of lymphocyte development and function. Nat. Immunol. 5:247253.[CrossRef][Medline]
2 Maillard, I., T. Fang, and W.S. Pear. 2005. Regulation of lymphoid development, differentiation and function by the Notch pathway. Annu. Rev. Immunol. 23:945974.[CrossRef][Medline]
3 Nam, Y., P. Sliz, L. Song, J.C. Aster, and S.C. Blacklow. 2006. Structural basis for cooperativity in recruitment of MAML coactivators to Notch transcription complexes. Cell. 124:973983.[CrossRef][Medline]
4 Radtke, F., A. Wilson, G. Stark, M. Bauer, J. van Meerwijk, H.R. MacDonald, and M. Aguet. 1999. Deficient T cell fate specification in mice with an induced inactivation of Notch1. Immunity. 10:547558.[CrossRef][Medline]
5 Sambandam, A., I. Maillard, V.P. Zediak, L. Xu, R. Gerstein, J. Aster, W.S. Pear, and A. Bhandoola. 2005. Notch signaling controls the generation and differentiation of early T lineage progenitors. Nat. Immunol. 6:663670.[CrossRef][Medline]
6 Tan, J.B., I. Visan, J.S. Yuan, and C.J. Guidos. 2005. Requirement for Notch1 signals at sequential early stages of intrathymic T cell development. Nat. Immunol. 6:671679.[CrossRef][Medline]
7 Wolfer, A., A. Wilson, M. Nemir, H.R. MacDonald, and F. Radtke. 2002. Inactivation of Notch1 impairs VDJbeta rearrangement and allows pre-TCR-independent survival of early alpha beta lineage thymocytes. Immunity. 16:869879.[CrossRef][Medline]
8 Schmitt, T.M., M. Ciofani, H.T. Petrie, and J.C. Zuniga-Pflucker. 2004. Maintenance of T cell specification and differentiation requires recurrent Notch receptorligand interactions. J. Exp. Med. 200:469479.
9 Tanigaki, K., M. Tsuji, N. Yamamoto, H. Han, J. Tsukada, H. Inoue, M. Kubo, and T. Honjo. 2004. Regulation of alphabeta/gammadelta T cell lineage commitment and peripheral T cell responses by Notch/RBP-J signaling. Immunity. 20:611622.[CrossRef][Medline]
10 Ciofani, M., T.M. Schmitt, A. Ciofani, A.M. Michie, N. Cuburu, A. Aublin, J.L. Maryanski, and J.C. Zuniga-Pflucker. 2004. Obligatory role for cooperative signaling by pre-TCR and Notch during thymocyte differentiation. J. Immunol. 172:52305239.
11 Ciofani, M., and J.C. Zuniga-Pflucker. 2005. Notch promotes survival of pre-T cells at the beta-selection checkpoint by regulating cellular metabolism. Nat. Immunol. 6:881888.[CrossRef][Medline]
12 Reizis, B., and P. Leder. 2002. Direct induction of T lymphocyte-specific gene expression by the mammalian Notch signaling pathway. Genes Dev. 16:295300.
13 Maillard, I., A.P. Weng, A.C. Carpenter, C.G. Rodriguez, H. Sai, L. Xu, D. Allman, J.C. Aster, and W.S. Pear. 2004. Mastermind critically regulates Notch-mediated lymphoid cell fate decisions. Blood. 104:16961702.
14 Tu, L., T.C. Fang, D. Artis, O. Shestova, S.E. Pross, I. Maillard, and W.S. Pear. 2005. Notch signaling is an important regulator of type 2 immunity. J. Exp. Med. 202:10371042.
15 Taghon, T., M.A. Yui, R. Pant, R.A. Diamond, and E.V. Rothenberg. 2006. Developmental and molecular characterization of emerging beta- and gammadelta-selected pre-T cells in the adult mouse thymus. Immunity. 24:5364.[CrossRef][Medline]
16 Garbe, A.I., A. Krueger, F. Gounari, J.C. Zuniga-Pflucker, and H. von Boehmer. 2006. Differential synergy of Notch and T cell receptor signaling determines
ß versus 
lineage fate. J. Exp. Med. 203:15791590.
17 Ciofani, M., G.C. Knowles, D.L. Wiest, H. von Boehmer, and J.C. Zuniga-Pflucker. 2006. Stage-specific and differential Notch dependency at the alphabeta and gammadelta T lineage bifurcation. Immunity. 25:105116.[CrossRef][Medline]
18 Weng, A.P., J.M. Millholland, Y. Yashiro-Ohtani, M.L. Arcangeli, A. Lau, C. Wai, C. Del Bianco, C.G. Rodriguez, H. Sai, J. Tobias, et al. 2006. c-Myc is an important direct target of Notch1 in T-cell acute lymphoblastic leukemia/lymphoma. Genes Dev. 20:20962109.[CrossRef][Medline]
19 Surh, C.D., and J. Sprent. 1994. T-cell apoptosis detected in situ during positive and negative selection in the thymus. Nature. 372:100103.[CrossRef][Medline]
20 Deftos, M.L., E. Huang, E.W. Ojala, K.A. Forbush, and M.J. Bevan. 2000. Notch1 signaling promotes the maturation of CD4 and CD8 SP thymocytes. Immunity. 13:7384.[CrossRef][Medline]
21 Erman, B., T.I. Guinter, and A. Singer. 2004. Defined
ß T cell receptors with distinct ligand specificities do not require those ligands to signal double-negative thymocyte differentiation. J. Exp. Med. 199:17191724.
22 Borowski, C., X. Li, I. Aifantis, F. Gounari, and H. von Boehmer. 2004. Pre-TCR
and TCR
are not interchangeable partners of TCRß during T lymphocyte development. J. Exp. Med. 199:607615.
23 Ikawa, T., H. Kawamoto, A.W. Goldrath, and C. Murre. 2006. E proteins and Notch signaling cooperate to promote T cell lineage specification and commitment. J. Exp. Med. 203:13291342.
24 Schmitt, T.M., and J.C. Zuniga-Pflucker. 2002. Induction of T cell development from hematopoietic progenitor cells by delta-like-1 in vitro. Immunity. 17:749756.[CrossRef][Medline]
25 Aster, J.C., L. Xu, F.G. Karnell, V. Patriub, J.C. Pui, and W.S. Pear. 2000. Essential roles for ankyrin repeat and transactivation domains in induction of T-cell leukemia by Notch1. Mol. Cell. Biol. 20:75057515.
Related Article
ß lineage choice
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|