Published online 28 December 2004 doi:10.1084/jem.20041912
Rockefeller University Press, 0022-1007 $8.00
JEM, Volume 201, Number 1, 95-104
Identification of poxvirus CD8+ T cell determinants to enable rational design and characterization of smallpox vaccines
David C. Tscharke1,2,
Gunasegaran Karupiah3,
Jie Zhou3,
Tara Palmore1,
Kari R. Irvine1,
S.M. Mansour Haeryfar1,
Shanicka Williams1,
John Sidney4,
Alessandro Sette4,
Jack R. Bennink1, and
Jonathan W. Yewdell1
1 Laboratory of Viral Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892
2 EBV Biology Laboratory, Division of Immunology and Infectious Diseases, Queensland Institute of Medical Research, Herston, QLD 4006, Australia
3 Division of Immunology and Genetics, John Curtin School of Medical Research, Australian National University, Canberra, ACT 2601, Australia
4 Division of Translational Immunology and Biodefense, La Jolla Institute for Allergy and Immunology, San Diego, CA 92121
CORRESPONDENCE David Tscharke: davidT{at}qimr.edu.au or Jonathan Yewdell: jyewdell{at}niaid.nih.gov
The large size of poxvirus genomes has stymied attempts to identify determinants recognized by CD8+ T cells and greatly impeded development of mouse smallpox vaccination models. Here, we use a vaccinia virus (VACV) expression library containing each of the predicted 258 open reading frames to identify five peptide determinants that account for approximately half of the VACV-specific CD8+ T cell response in C57BL/6 mice. We show that the primary immunodominance hierarchy is greatly affected by the route of VACV infection and the poxvirus strain used. Modified vaccinia virus ankara (MVA), a candidate replacement smallpox vaccine, failed to induce responses to two of the defined determinants. This could not be predicted by genomic comparison of viruses and is not due strictly to limited MVA replication in mice. Several determinants are immunogenic in cowpox and ectromelia (mousepox) virus infections, and immunization with the immunodominant determinant provided significant protection against lethal mousepox. These findings have important implications for understanding poxvirus immunity in animal models and bench-marking immune responses to poxvirus vaccines in humans.
Abbreviations used: CPXV, cowpox virus; ECTV, ectromelia virus; ICS, intracellular cytokine staining; ID, immunodominance; IDD, immunodominant determinant; MVA, modified vaccinia virus ankara; ORF, open reading frame; SDD, subdominant determinant; VACV, vaccinia virus; VARV, variola virus.
In the late 1700s, Edward Jenner published the seminal observation that infection with animal poxviruses protects humans against smallpox (1). Though similar practices had been followed for centuries by other societies around the world, Jenner was the first to apply the scientific method to evaluating efficacy. In so doing, he laid the foundations for both the eradication of smallpox and for the discipline of immunology.
Despite its historic origins, current understanding of the molecular basis for cross-protection between heterologous poxviruses is woefully incomplete. This is particularly the case for antigens recognized by T cells, although they are assumed to play an important role in immunity (24). The neglect stems partly from the daunting size of poxvirus genomes and from the lack of a pressing need to understand poxvirus immunology after the eradication of smallpox (2). Recent improvements in molecular methods and determinant prediction have made genome size less of an obstacle. The specter of variola virus (VARV), the causative agent of smallpox, being used as a bioweapon has eliminated complacency about human poxvirus immunity (5). The current live vaccinia virus (VACV)-based smallpox vaccine, while remarkably effective, is associated with mild to severe complications and safer alternatives are required.
As a consequence, identification of human T cell determinants of VACV, the current smallpox vaccine, is now underway. To date, papers have been limited to a few determinants presented by a single restricting class I molecule (68). Although this work is important for characterizing human responses to safer vaccines, the biological relevance of responses to these determinants cannot be tested. Fortunately, there are animal models to shed light on the problem of cross-protection between heterologous poxviruses. For example, just as VACV protects humans against smallpox, this same virus protects mice against mousepox (9, 10).
Mousepox is caused by ectromelia virus (ECTV), a mouse pathogen closely related to VACV and VARV (11, 12). Current understanding of smallpox pathogenicity owes much to pioneering work with mousepox (13, 14) and more recent work has taught us much about immunity in systemic poxvirus disease (1517). Alternative models for lethal poxvirus disease in mice have also been exploited, including intranasal VACV (6, 8, 1820) and cowpox virus (CPXV; reference 21) infection. Although the specificities of T cells that contribute to protection of humans against smallpox and mice against various poxviruses will not be identical due to differences in antigen processing and presentation and T cell receptor repertoires, the basic principles underlying protection are likely to be similar. Due to the sophistication of the mouse model for immunity, many important questions about the basic immunology of poxvirus protection are best addressed at this time in mouse models. These include assessment of the importance of individual effector mechanisms and the degree and mechanism of protection afforded by smallpox vaccine candidates.
A critical step in refining the mouse model is to define poxvirus determinants recognized by CD8+ T cells and determine their role in protective immunity. Here, we provide the original description of poxvirus determinants recognized by mouse CD8+ T cells, and their biological relevance in protection against lethal poxvirus infections.
 |
Results
|
|---|
Identification of VACV CD8+ T cell determinants in mice
To identify immunogenic VACV gene products, we generated an expression library of 258 predicted open reading frames (ORFs) and highly transfectable cells (human 293 cells) expressing H-2Kb or Db. Cells transfected with individual plasmids were tested for their ability to induce IFN-
expression in CD8+ T cells derived from C57BL/6 mice infected i.p. with VACV 7 d previously (Fig. 1 a). Five antigenic VACV ORFs were discovered, three restricted by H-2Kb and two by H-2Db (Table I). For two ORFs, A19L and A47L, this is the first empirical evidence that they are expressed during infection. Ironically, of the known genes, two (B8R and K3L) are involved in virus evasion of host interferon responses (22). Whether this apparent targeting of immune modulators by CD8+ T cells is a general phenomenon or a quirk of the mouse model used requires more determinants to be mapped in mice and other species.
Antigenic VACV ORFs were analyzed in silico for peptides matching the relevant class I peptide-binding motif. Synthetic peptides for predicted determinants were tested for their ability to bind the relevant class I allomorph and to activate CD8+ T cells from VACV-infected mice (Table I). None of the predicted A42R peptides were immunogenic, which led to testing subclones expressing gene fragments (residues 148, 182, 75end, and 107end) and ultimately a second round of in silico prediction resulting in identification of YAPVSPIVI as the determinant.
Synthetic peptides for each of the five mapped determinants were antigenic at <1010 M (Fig. 1 b) when tested for their ability to activate primary VACV-specific CD8+ T cells. Peptide-specific CD8+ T cell cultures were generated by in vitro stimulation of splenocytes from VACV-infected mice over several weeks. Cultures stimulated with the five peptides were found to recognize VACV-infected DC2.4 cells and VACV-infected 293 expressing the correct restriction element (unpublished data). Similar cultures recognized 293 cells expressing the appropriate restriction element transfected with the source VACV gene, but not another gene, or the source gene where the wrong restriction element was present (unpublished data). This strongly suggests that the peptides identified represent bona fide virus-encoded determinants generated by antigen processing pathways and not spuriously cross-reacting peptides. We note that the odds of this latter possibility increase with increasing genome size of the immunogen and might prove to be particularly relevant to poxviruses and other large DNA viruses.
Contribution of mapped determinants to total response
We determined the contribution of these determinants to the total acute (day 7; Fig. 2 a) and memory (day 21; Fig. 2 b) CD8+ T cell response to VACV by intracellular cytokine staining (ICS) of splenocytes tested ex vivo. Uninfected mice failed to detectably respond to any of the peptides (unpublished data). 7 d after i.p. infection, B8R20-27 elicited a response from 1015% of all splenic CD8+ T cells, amounting to a staggering 107 cells in the spleen alone. Other determinants elicited a more modest response; in general, K3L6-15 was the next strongest followed by A47L138-146, A42R88-96, and A19L47-55. Occasionally, in individual mice, the order of K3L6-15 and A47L138-146 was swapped in the immunodominance (ID) hierarchy, but A19L47-55 was always at the bottom. The stability of the VACV ID hierarchy in individual mice is similar to that seen with influenza virus (23). Comparing determinant-specific responses with the total VACV-specific response shows that B8R20-27, the immunodominant determinant (IDD), alone stimulates >25% of the total response. When combined with the four subdominant determinants (SDDs), this accounts for up to 40% of the total response.
As expected, CD8+ T cell numbers decreased in memory CD8+ T cells, which were also measured ex vivo by ICS. The ID hierarchy was slightly altered, due to a less pronounced decrease in A47L138-146-specific CD8+ T cells. Similar relative sparing of CD8+ T cells specific for SDDs in memory has been observed previously (24). Altogether, the CD8+ T cells specific for the defined determinants account for
30% of the total anti-VACV memory CD8+ T cell response.
Route of infection affects ID
Smallpox vaccination has been performed for centuries by dermal scarification, whose simplicity probably contributed to smallpox eradication. To our surprise, after scarification with VACV, B8R20-27-specific responses were enhanced, whereas responses to SDDs were depressed (Fig. 3 a). Indeed, in most mice, responses to the two weakest SDDs were reduced to the limit of detection. The enhanced response to B8R20-27 is strikingly demonstrated by comparison to the total VACV-specific response; after dermal scarification, >50% of CD8+ T cells are specific for B8R20-27. To test this apparent suppression of SDD responses more rigorously, the ratio of the sum of the SDD-specific responses to the IDD-specific response was calculated using data from individual mice from several experiments to provide a larger sample size (Fig. 3 b). The mean of this ratio was significantly different (P = 0.0013) between mice infected by the i.p. and dermal routes. Finally, responses to all determinants contribute nearly 60% of the total primary CD8+ T cell response induced by scarification.
Dryvax immunized mice respond to all mapped determinants
Until this point, we had exclusively used the WR strain of VACV, which was derived from the New York City Board of Health (NYCBH) vaccine strain by serial passage in mice and tissue culture (25). Dryvax (Wyeth Laboratories), the smallpox vaccine currently available in the USA, is the NYCBH strain propagated on the skin of calves. All determinants were immunogenic in mice infected i.p. with Dryvax. The ID hierarchy was similar to that found with WR; the only determinant with responses that differed significantly was K3L6-15 (P = 0.0158; Fig. 4 a). A screen of the VACV ORF library performed with splenocytes from Dryvax immunized mice failed to identify novel determinants (unpublished data).

View larger version (14K):
[in this window]
[in a new window]
|
Figure 4. CD8+ T cell responses to VACV determinants after immunization with different strains. Mice were immunized i.p. with 106 WR (a and b), 106 PFU of Dryvax (a), 5 x 107 FFU of MVA (b), and 5 x 106 PFU of iA17L and 106 PFU Vsc8 (TK) (c), and CD8+ T cell responses to peptides were measured by ICS after 7 d. Data are percent of splenic CD8+ T cells that produce IFN- in ex vivo stimulations with the peptides derived from the VACV genes shown. Means and SEM of four (a and b) and three (c) mice are plotted; all data have been independently replicated.
| |
Conservation of immunogenic proteins and determinants across poxvirus strains and species
We searched databases for the presence of immunogenic ORFs in VACV strain modified vaccinia virus ankara (MVA); ECTV strains Naval and Moscow; CPXV strains Brighton red and GRI-90; and VARV strains Bangladesh, India, and VARV minor. Results for different strains from the same species (with the exception of VACV) were identical, so only data from a representative strain of each are included in Table II. All poxviruses have a range of broken, truncated, or otherwise incomplete ORFs, whose annotations are inconsistent. Therefore, where immunogenic ORFs were not annotated (e.g. B8R in the original MVA sequence), we looked for conservation of the sequence encoding the determinants in the genome. In the case of B8R in MVA, the determinant is encoded upstream of the inactivating truncation of the ORF and a more recent sequence has included this ORF in the annotation. Because the promoter sequences are conserved, the determinant should be expressed. On the other hand, K3L function is not conserved in ECTV and while the determinant encoding sequence is present, there are sequence changes in the promoter region that could interfere with expression.
ID hierarchy is altered in MVA-immunized mice
MVA is a highly attenuated strain of VACV being developed as a smallpox vaccine replacement (26) and is a potential vector for recombinant vaccines (27). To determine if conservation of genes/determinants in published poxvirus genomes equates with conservation of CD8+ T cells' immunogenicity and dominance hierarchy, we measured CD8+ T cell responses to i.p. infection with MVA (Fig. 4 b). Though B8R20-27 maintained its IDD status, responses to the SDDs were greatly altered relative to WR. Responses to all SDDs were significantly different in MVA compared with WR-infected mice (P < 0.0006 for A47L138-146, A42R88-96, and K3L6-15 and P = 0.014 for A19L47-55). A19L47-55, usually the weakest determinant, was the second strongest after MVA immunization at
2% of all CD8+ T cells, whereas responses to K3L6-15 were lower and those to A47L138-146 and A42R88-96 were at background levels. The lack of response to the latter two determinants cannot be attributed to genetic variation in the determinants in the MVA strain we used as determined by DNA sequencing. The total VACV-specific response was slightly lower after MVA infection than WR infection, but higher than in Dryvax-immunized mice (unpublished data). We also screened the VACV ORF library with splenocytes from MVA-infected mice, but no new CD8+ T cell determinantbearing gene products were identified (unpublished data).
These data demonstrate that first, the presence of conserved determinants in conserved ORFs predicted to be expressed provides no guarantee of immunogenicity and, second, the ID hierarchy can be affected by genomic differences in poxviruses not predicted to effect the expression of determinants.
Responses to mapped determinants are found in mice immunized with attenuated VACVs
The striking difference in ID hierarchies between WR and MVA could stem from the attenuation of MVA, which, in contrast with WR/Dryvax, is capable of only marginal replication in mammalian cells in vitro and in vivo (27, 28). To examine the relationship between virus attenuation and ID hierarchy, we infected mice with a VACV that only expresses the essential viral structural gene A17L in the presence of IPTG (iA17L; reference 29) and, therefore, cannot replicate in vivo. This virus, like many recombinant VACVs, also lacks thymidine kinase and so a thymidine kinasedeficient VACV (VACV-TK; reference 30) is shown as a control for this experiment. VACV-TK is replication competent but less pathogenic than WR in vivo (31), and several thymidine kinasedeficient VACVs have been found to have similar ID hierarchies to WR (unpublished data). Despite being unable to replicate in vivo, iA17L generated an ID hierarchy highly similar to TK (Fig. 4 c) or WR (Figs. 2 a and 4, a and b). We conclude that attenuation per se does not lead to significant alterations in ID hierarchy to poxviruses and cannot account for the alterations between CD8+ T cell responses to VACV and MVA.
Identification of VACV-CD8+ T cell determinants by ECTV and CPXV
The protection afforded by the smallpox vaccine relies on cross-reactivity between VACV and VARV. To examine cross-reactivity of poxvirus-specific CD8+ T cell determinants in a mouse system, we extended our characterization of CD8+ T cell responses to include ECTV and CPXV (Fig. 5). B8R20-27 maintained IDD status in responses to both viruses but generated weaker responses when compared with VACV, raising the possibility of other dominant determinants in these viruses. ECTV failed to induce reliable responses to A42R88-96 or K3L6-15. The latter was expected from genomic analysis (Table II). The anti-ECTV response to A47L138-146 was of interest due to a predicted sequence change in the determinant in the second residue (A to T). Using a synthetic version of the altered peptide we confirmed its cross-reactivity with ECTV and VACV-specific CD8+ T cells (unpublished data).

View larger version (15K):
[in this window]
[in a new window]
|
Figure 5. Responses to VACV CD8+ T cell determinants after ECTV and CPXV infection. Mice were immunized s.c. in the rear leg shank with 103 PFU of ECTV (black bar), VACV strain WR (diagonally striped bar), and CPXV (white bar) and CD8+ T cell responses to peptides were measured by ICS after 7 d (VACV and CPXV) and 8 d (ECTV). Data are percent of splenic CD8+ T cells that produce IFN- in ex vivo stimulations with the individual peptides shown and are means and SEM of groups of four mice. Experiment was repeated with similar results.
| |
For CPXV infection, B8R20-27, A47L138-146, and K3L6-15 consistently generated responses in individuals, whereas A19L47-55 responses were at the limits of detection. The difficulty to demonstrate A42R88-96 immunogenicity in these experiments may be a reflection of the subcutaneous route of infection, as responses to this determinant were also equivocal after VACV infection by dermal scarification.
Vaccination with the immunodominant VACV determinant leads to partial protection against mousepox
Finally, we examined the ability of CD8+ T cells primed by immunization with DC exposed to the IDD B8R20-27, to protect against lethal ECTV challenge. In a first experiment, we found that B8R20-27-pulsed DCs induced low but measurable CD8+ T cell responses (unpublished data) and protection from intranasal challenge with ECTV that was significant (P = 0.0279), but incomplete (Fig. 6 a). This protection was confirmed in a second experiment controlled with groups of mice immunized with TK VACV and DCs pulsed with an irrelevant peptide (P = 0.0196; Fig. 6 b). These data demonstrate that the IDD, B8R20-27, not only cross-reacts amongst poxvirus species but is also cross-protective.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 6. Immunization with peptides and mousepox challenge. (a) Unimmunized mice (n = 5) or mice immunized with DCs pulsed with B8R20-27 3 wk previously (n = 8) were challenged with 300 PFU ECTV intranasally and monitored for survival. (b) Groups of 10 mice immunized with VACV TK or DCs pulsed with B8R20-27 or herpes simplex virus gB498505 were challenged as in panel a. In both experiments, splenic DCs were matured with LPS overnight before pulsing with peptides and 5 x 105 cells were administered i.v. per mouse. After challenge mice killed when moribund were counted as mortality events, p-values were generated by comparison of survival curves using the log-rank test.
| |
 |
Discussion
|
|---|
The large coding capacity of poxvirus genomes presents a challenge for determinant mapping. Consequently, it is tempting to use various criteria to winnow the number of genes to be considered. Virus late genes are often excluded in determinant screens (6, 7). VACV-determinant mapping projects also use conservation between orthopoxviruses as a determinant selection criteria (68). Our results show that both criteria are seriously flawed. We discovered an immunogenic determinant in A42R, considered to be a late gene product (32). In addition, we provide several examples in which the immunogenicity of determinants in poxviruses cannot be predicted from the conservation of their sequence and integrity of their source ORFs according to sequences in the available databases. Furthermore, conserved determinants may easily be missed because fragments of known genes are not always included in annotations of poxvirus genome, as was the case for the B8R20-27 determinant from B8R in the original MVA sequence. Finally, practical considerations aside, a complete understanding of cross-protection requires knowledge not only of the determinants two viruses have in common, but the ones that are unique to each infection.
The identification of the immunogenic determinants in poxviruses should greatly facilitate development of the mouse model for smallpox vaccination and also the utility of mouse poxvirus infections for understanding viral immunity. The latter point is underscored by our observation that the ID hierarchy varies with the route of infection, the first observation of its kind to our knowledge. It will be of great interest to determine the underlying mechanism. It could reflect route-dependent differences in the identity of antigen-presenting cells that activate CD8+ T cells, the nature of antigen presented (e.g., direct vs. cross-priming), or the repertoire of CD8+ T cells that interact with antigen-presenting cells in the locale where priming occurs. Understanding route-dependent effects on immunogenicity is critical to interpreting vaccine trials such as the recent paper comparing intramuscular immunization with MVA to standard scarification with Dryvax (33).
We found that the ID hierarchy amongst SDDs was greatly altered in mice immunized with MVA compared with WR. Furthermore, responses to two VACV determinants that were always detectable in mice infected by the i.p. route with WR were at background levels when MVA was used. Experiments with another highly attenuated VACV (iA17L) demonstrate that the results found with MVA cannot be attributed per se to decreased replication in vivo. Sequence database searches found these two determinants and their genes intact and expected to be expressed in two separate isolates of MVA, one of which is derived from the same source as our MVA stock. Furthermore, DNA sequencing of our virus stock revealed no alterations in the determinants. It is more likely that the altered ID hierarchy is related to one or more of the many genomic deletions and other changes in MVA compared with WR (34). It is possible that MVA encodes a novel IDD that suppresses other responses via immunodomination (23). Alternatively, genes encoding the cryptic determinants may not be expressed at immunogenic levels by MVA in vivo. Irrespective of the cause, the finding that responses were not predictable on the basis of sequence information challenges assumptions about conservation of CD8+ T cell responses between related viruses and underscores the need for empirical data. It also raises the important issue of the degree of overlap between cellular immune responses to Dryvax and potential smallpox vaccine replacements.
Using the VACV/ECTV model, we identify the first VACV-CD8+ T cell determinant that may mediate cross-protection against a lethal systemic disease with a heterologous poxvirus. This extends prior studies with individual CD8+ T cell determinants using VACV challenge models in HLA-A2 transgenic mice (6, 8) and shows the potential of CD8+ T cells to mediate protection against poxvirus disease. Immunization with B8R20-27 synthetic peptide provided incomplete protection in our challenge model, but we note that the number of CD8+ T cells induced by peptide vaccination was at least 50-fold less than after VACV infection, and inducing higher CD8+ T cell responses could well provide better protection. Furthermore, although our data show a potential basis for cross-protection between orthopoxviruses, more work is needed to understand the roles of CD8+ T cells and other effector mechanisms in the context of current VACV-based vaccines.
 |
Materials and Methods
|
|---|
Viruses and cell lines
VACV strains WR, MVA, Vsc8 (30), and iA17L (29); ECTV strain Moscow; and CPXV strain Brighton were grown and titrated using standard methods. Dryvax smallpox vaccine was obtained from the Centers for Disease Control, Atlanta. Titred stocks of MVA and titration of Dryvax were provided by L. Wyatt (National Institute of Infectious Diseases [NIAID], Bethesda, MD). 293A cells were maintained in Dulbecco's Modified Eagle Medium with 10% FBS (D10). DC2.4 (35) and EL-4 were maintained in D10 or RPMI 1640 medium with 10% FBS (R10). All media was from Invitrogen. For use as stimulators in CD8+ T cells assays, 15 x 106 DC2.4 were infected with VACV at 510 PFU/cell in <200 µl of PBS at 37°C for 3060 min with occasional shaking. After this initial incubation, 9 ml R10 was added, and the incubation continued until a total time after infection of at least 4 h. Infected cells were spun and washed, and the appropriate number was added to T cell assays.
Synthetic peptides
Peptides were synthesized as described previously (36) by A & A Labs, at the John Curtin School of Medical Research Biomolecular Resources Facility (Australian National University, Canberra, Australia) or purchased as crude material from Mimotopes or Pepscan Systems B.V. Peptides were resuspended at 420 mg/ml in 100% DMSO and diluted to required concentrations in PBS, PBS with 0.05% NP-40, or RPMI 1640. Peptides for use as radiolabeled probes were purified to >95% homogeneity by reversed phase HPLC, and composition was ascertained by amino acid analysis, sequencing, and/or mass spectrometry analysis. Radiolabeling was done using the chloramine T method (37).
Enrichment of splenic DCs
DCs were enriched from C57BL/6 mouse spleens essentially as described previously (38). In brief, spleen fragments were digested for 20 min at room temperature with collagenase-DNase and treated for 5 min with EDTA. Low-density cells (including DCs) were selected by centrifugation in a Hepes-buffered balanced salt solution, pH 7.2, with 3% FCS and Nycodenz at a density of 1.077 g/cm3 (Nycomed). The DC-enriched fraction was cultured overnight at 37°C with 5% CO2 in DMEM (high glucose) with 10% FBS and 100 ng/ml LPS. The nonadherent population from this culture was collected. Enriched DCs were incubated with peptide at 1 µM for 2 h before washing and resuspension in PBS.
Mice, infections, and immunizations
Specific pathogen-free C57BL/6 mice were obtained from Taconic, Animal Resource Centre (Perth, Australia), and Animal Services Division, John Curtin School of Medical Research. Mice were housed, and experiments were done according to the relevant ethics requirements. In most experiments, mice were infected i.p. with 1065 x 107 PFU of VACV, depending on virus strain. For dermal scarification, 10 scratches were made at the base of the tail in a crosshatch pattern using a 21 gauge needle and a drop of VACV at 107 PFU/ml applied for 1 min before the excess was removed with a tissue. For subcutaneous infections, 103 PFU ECTV and 106 PFU CPXV and VACV were injected in the shanks of mice. Except where stated, mice were euthanized 7 d after infection and spleens taken for analysis of CD8+ T cell responses. For DC immunization, 2.5 x 105 peptide-coated, spleen-derived DCs suspended in PBS were injected intravenously. For ECTV challenge, DC-immunized or control mice were anesthetized and infected intranasally with 300 PFU of ECTV in 20 µl of PBS. Mice were monitored for signs of illness twice daily, and moribund animals euthanized.
It was noted that C57BL/6 mice available in Australia (from two sources) made very high VACV-specific responses (Figs. 25). Mice available in the USA had lower total VACV-specific responses in the spleen (2025% of CD8+ T cells; unpublished data), similar to other published studies (20, 39). The relative contribution of the mapped determinants to the total CD8+ T cell response was very similar irrespective of country or source of mice.
Generation of VACV ORF library
Primary PCR products (and associated information) representing 266 predicted ORFs of VACV, made for a project investigating VACV proteinprotein interactions by yeast 2-hybrid (40), were a gift from B. Moss (NIAID, Bethesda, MD). These were reamplified by PCR using Platinum Pfx (Invitrogen) and the primers 5'-CACCGAATTCCAGCTGACCACC-3' and 5'-TATTCGGATCCCCGGGAATTGC-3' and cloned into the eukaryotic expression vector pcDNA3.1D/V5-His-TOPO (Invitrogen) according to the manufacturer's instructions. Clones were screened by cleavage of miniprep DNA (Wizard SV 96; Promega) with BamHI (site underlined in the aforementioned primer sequence) and separation on 1.2% agarose gels. This initial library was edited, with 12 duplicated ORFs being removed and four ORFs (known to exist but missing) being added (A13L, A14.5L, A44L, and A48R); ORFs were PCR amplified directly from crude virus stocks and cloned as described before. The complete library comprised 258 unique clones each representing a single predicted VACV ORF. The 5' end (
600 bp) of each ORF clone was sequenced using ABI BigDye Terminators reagents and an ABI PRISM 3100 genetic analyzer (Applied Biosystems). Clones with early terminations or frame shifts were removed and remade. Transfection grade (low endotoxin) DNA for each clone was produced by Aldevron.
Generation of 293 cells expressing mouse MHC genes
The complete coding sequences for H-2Kb and Db were amplified by PCR from recombinant VACV encoding these products and cloned into pcDNA3.1D/V5-His-TOPO as described before. The following primers were used: Kb, 5'-CACCATGGTACCGTGCACGCTG-3' and TCACGCTAGAGAATGAGGGTC; and Db, 5'-CACCATGGGGGCGATGGCTC-3' and 5'-TCACGCTTTACAATCTCGGAG-3'. All clones were verified by sequencing and comparison to GenBank/EMBL/DDBJ accession nos.: Kb, U47328; and Db, U47325. To make stable cell lines, plasmids were cleaved with SmaI and transfected into a single well of a six-well dish of 293A cells using Lipofectamine 2000 reagent according to the manufacturer's instructions (Invitrogen). After overnight incubation (37°C, 9% CO2), cells were harvested and six serial 1:5 dilutions were made in a fresh six-well plate in medium supplemented with 0.5 mg/ml G418 (Biofluids). After several weeks of selection and growth in G418-containing medium, transfectants were cloned by limiting dilution (H-2 Kb) or FACS followed by single cell deposition (H-2 Db, FACStar Plus; BD Biosciences). Potential H-2expressing clones were selected by staining with mAbs (HB176 supernatant followed by rabbit antimouse Ig-FITC for Kb and direct FITC conjugates for Db; BD Biosciences) and analysis on a FACSCalibur (BD Biosciences). The clones selected were 293KbC2 and 293DbA5 and were maintained in 0.5 mg/ml G418. Expression of H-2 antigens was found to be stable for many passages in nonselecting medium.
Transfections in 96-well format and harvesting transfectants
293KbC2 or 293DbA5 cells were seeded in flat-bottom 96-well plates between 5 and 8 x 104 cells/well the night before transfection. Diluted Lipofectamine 2000 (25 µl/well of 1:50 dilution) was arrayed in 96-well plates and mixed with plasmid DNA (25 µl at 0.01 µg/ml). These transfection mixes were left at room temperature for 30 min before being used to replace medium on the 293Kb/Db cells. After 2 h at 37°C with 5% CO2, 100 µl of fresh D10 was added to each well and the plates returned to 37°C overnight. For T cell stimulations, transfected cells were harvested by washing wells with 50 µl PBS and incubating them with 20 µl trypsin for several minutes. Cells were collected with 100 µl D10 and moved to U-bottom 96-well plates. Plates were spun, medium and trypsin were removed, and transfectants were resuspended with suspensions of splenocytes or CD8+ T cells to begin stimulations.
Stimulations and ICS
Splenocytes (0.21 x 106) or CD8+ T cells (105, CD8a+ T Cell Isolation Kit; Miltenyi Biotec) were incubated with the following: (a) transfected cells (see previous paragraph), (b) synthetic peptides, (c) DC2.4 pulsed with synthetic peptides at various concentrations, or (d) DC2.4 infected with VACV (see Viruses and cell lines) in the wells of a 96-well plate at 37°C and 5% CO2. Synthetic peptides (if used) were added to a final concentration of 0.5 µM; cells (except those transfected in 96-well format) were used at 12 x 105 cells per well. 10 µg/ml brefeldin A was added after 1 h, and the incubation continued for another 34 h. Plates were spun, medium was removed, and cells were resuspended in 50 µl of
-CD8-PE (clone 536.7; BD Biosciences; some experiments used FITC or PE-Cy5) and incubated on ice for 20 min. Cells were washed, resuspended in 50 µl of 1% paraformaldehyde, and incubated at room temperature for 20 min before another two washes and staining with
-IFN-
allophycocyanin (clone XMG1.2; BD Biosciences; some experiments used FITC or PE) overnight in PBS with 0.5% saponin at 4°C. Cells were washed once before acquisition and analysis of fluorescence using a FACSCalibur (BD Biosciences). Analysis was done using Flowjo software (Tree Star Inc.); events were gated for live lymphocytes on FSC x SSC followed by CD8+ cells using CD8 x SSC and displayed as CD8 x IFN-
. Data was recorded as IFN-
+, CD8+ cells as a percentage of total CD8+ cells. Backgrounds as determined using irrelevant peptides, cells transfected with irrelevant constructs or uninfected cells were usually in the order of 0.1% and were subtracted from the values presented for test samples.
MHC binding assays
Quantitative assays to measure the binding of peptides to soluble class I molecules are based on the inhibition of binding of a radiolabeled standard peptide (37). In brief, 110 nM radiolabeled peptide was coincubated at room temperature with 1 µM to 1 nM of purified class I molecules (from EL-4) in the presence of 1 µM of human ß2-microglobulin (Scripps Laboratories) and a cocktail of protease inhibitors. The radiolabeled peptides were used, and their average IC50s were RGYVFQGL, 3.1 nM and SGPSNTYPEI, 4.4 nM for Kb and Db, respectively (41). After a 2-d incubation, binding of the radiolabeled peptide to the corresponding MHC class I molecule was determined by capturing MHCpeptide complexes on Greiner Lumitrac 600 microplates (Greiner Bio-one) coated with the W6/32 antibody, and measuring bound cpm using the TopCount microscintillation counter (Packard Instrument Co.). In the case of competitive assays, the concentration of peptide yielding 50% inhibition of the binding of the radiolabeled probe peptide was calculated (IC50). Peptides were typically tested in three or more independent experiments. Under the conditions used, where [label] < [MHC] and IC50
[MHC], the measured IC50 values are reasonable approximations of the true Kd values (42).
Sequence comparison
ORF and determinant conservation between poxviruses was done with the aid of poxvirus orthologous clusters (43) maintained at the University of Victoria, Victoria, BC Canada and accessed through the Poxvirus Bioinformatics Resource (www.poxvirus.org).
Statistical analysis
Statistical analysis was done with the aid of Prism software (Graphpad). For comparing the means of responses or ratios, Student's t tests were used. For Kaplan-Meier survival analyses, p-values were generated using the log-rank test to compare survival curves. Differences were considered significant if p-values were <0.05.
 |
Acknowledgments
|
|---|
We thank Dr. B. Moss for providing PCR products for the VACV ORF library and helpful discussions; Dr. L. Wyatt for titred stocks of MVA and Dryvax; C. Eigsti and the National Institute of Allergy and Infectious Diseases (NIAID) flow cytometry section for single cell sorting; and D. Tokarchick and L. Morrison for technical assistance.
This work was funded by the NIAID-National Institutes of Health (NIH) intramural program and grants from the NHMRC (Australia) to D. Tscharke (Howard Florey Centenary Fellowship, no. 224273) and G. Karupiah (no. 153836), the Howard Hughes Medical Institute (to G. Karupiah), and NIAID-NIH to A. Sette and J. Sidney (R01 grant no. AI56268 and contract no. N01-AI-40023).
The authors have no conflicting financial interests.
Submitted: 16 September 2004
Accepted: 22 November 2004
 |
References
|
|---|
- Jenner, E. 1798. An Enquiry into the Causes and Effects of the Variolae Vaccinae, a Disease Discovered in Some of the Western Counties of England, Particularly Gloucestershire, and Known by the Name of the Cow Pox, 1st ed. Law Murray & Highly, London, England.
- Fenner, F., D. Henderson, I. Arita, Z. Jezek, and I. Ladnyi. 1988. Smallpox and Its Eradication. World Health Organization, Geneva. 1460 pp.
- Ennis, F.A., J. Cruz, W.E. Demkowicz, A.L. Rothman, and D.J. McClain. 2002. Primary induction of human CD8+ cytotoxic T lymphocytes and interferon-
-producing T cells after smallpox vaccination. J. Infect. Dis. 185:16571659.[CrossRef][Medline]
- Combadiere, B., A. Boissonnas, G. Carcelain, E. Lefranc, A. Samri, F. Bricaire, P. Debre, and B. Autran. 2004. Distinct time effects of vaccination on long-term proliferative and IFN-
producing T cell memory to smallpox in humans. J. Exp. Med. 199:15851593.[Abstract/Free Full Text]
- Lane, H.C., J.L. Montagne, and A.S. Fauci. 2001. Bioterrorism: a clear and present danger. Nat. Med. 7:12711273.[CrossRef][Medline]
- Drexler, I., C. Staib, W. Kastenmuller, S. Stevanovic, B. Schmidt, F.A. Lemonnier, H.G. Rammensee, D.H. Busch, H. Bernhard, V. Erfle, and G. Sutter. 2003. Identification of vaccinia virus epitope-specific HLA-A*0201-restricted T cells and comparative analysis of smallpox vaccines. Proc. Natl. Acad. Sci. USA. 100:217222.[Abstract/Free Full Text]
- Terajima, M., J. Cruz, G. Raines, E.D. Kilpatrick, J.S. Kennedy, A.L. Rothman, and F.A. Ennis. 2003. Quantitation of CD8+ T cell responses to newly identified HLA-A*0201restricted T cell epitopes conserved among vaccinia and variola (smallpox) viruses. J. Exp. Med. 197:927932.[Abstract/Free Full Text]
- Snyder, J.T., I.M. Belyakov, A. Dzutsev, F. Lemonnier, and J.A. Berzofsky. 2004. Protection against lethal vaccinia virus challenge in HLA-A2 transgenic mice by immunization with a single CD8+ T-cell peptide epitope of vaccinia and variola viruses. J. Virol. 78:70527060.[Abstract/Free Full Text]
- Burnet, F.M., and W.C. Boake. 1945. The relationship between the virus of infectious ectromelia of mice and vaccinia virus. J. Immunol. 53:113.
- Fenner, F. 1947. Studies in infectious ectromelia of mice. I. Immunization of mice against ectromelia with living vaccinia virus. Aust. J. Exp. Biol. Med. Sci. 25:257274.
- Marchal, J. 1930. Infectious ectromelia. A hitherto undescribed virus disease of mice. J. Pathol. Bacteriol. 33:713728.[CrossRef]
- Fenner, F. 1948. The pathogenesis of the acute exanthems. An interpretation based on experimental investigations with mousepox (infectious ectromelia of mice). Lancet. 252:915920.[CrossRef]
- Fenner, F. 1949. Mouse-pox (infectious ectromelia of mice): a review. J. Immunol. 63:341373.[Abstract/Free Full Text]
- Blanden, R.V. 1970. Mechanisms of recovery from a generalized viral infection: mousepox. I. The effects of anti-thymocyte serum. J. Exp. Med. 132:10351054.[Abstract]
- Karupiah, G., T.N. Fredrickson, K.L. Holmes, L.H. Khairallah, and R.M.L. Buller. 1993. Importance of interferons in recovery from mousepox. J. Virol. 67:42144226.[Abstract/Free Full Text]
- Karupiah, G., R.M. Buller, N. Van Rooijen, C.J. Duarte, and J. Chen. 1996. Different roles for CD4+ and CD8+ T lymphocytes and macrophage subsets in the control of a generalized virus infection. J. Virol. 70:83018309.[Abstract]
- Chaudhri, G., V. Panchanathan, R.M.L. Buller, A.J.M. van den Eertwegh, E. Claassen, J. Zhou, R. de Chazal, J.D. Laman, and G. Karupiah. 2004. Polarized type 1 cytokine response and cell-mediated immunity determine genetic resistance to mousepox. Proc. Natl. Acad. Sci. USA. 101:90579062.[Abstract/Free Full Text]
- Belyakov, I.M., P. Earl, A. Dzutsev, V.A. Kuznetsov, M. Lemon, L.S. Wyatt, J.T. Snyder, J.D. Ahlers, G. Franchini, B. Moss, and J.A. Berzofsky. 2003. Shared modes of protection against poxvirus infection by attenuated and conventional smallpox vaccine viruses. Proc. Natl. Acad. Sci. USA. 100:94589463.[Abstract/Free Full Text]
- Wyatt, L.S., P.L. Earl, L.A. Eller, and B. Moss. 2004. Highly attenuated smallpox vaccine protects mice with and without immune deficiencies against pathogenic vaccinia virus challenge. Proc. Natl. Acad. Sci. USA. 101:45904595.[Abstract/Free Full Text]
- Xu, R., A.J. Johnson, D. Liggitt, and M.J. Bevan. 2004. Cellular and humoral immunity against vaccinia virus infection of mice. J. Immunol. 172:62656271.[Abstract/Free Full Text]
- Bray, M., M. Martinez, D.F. Smee, D. Kefauver, E. Thompson, and J.W. Huggins. 2000. Cidofovir protects mice against lethal aerosol or intranasal cowpox virus challenge. J. Infect. Dis. 181:1019.[CrossRef][Medline]
- Seet, B.T., J.B. Johnston, C.R. Brunetti, J.W. Barrett, H. Everett, C. Cameron, J. Sypula, S.H. Nazarian, A. Lucas, and G. McFadden. 2003. Poxviruses and immune evasion. Annu. Rev. Immunol. 21:377423.[CrossRef][Medline]
- Yewdell, J.W., and J.R. Bennink. 1999. Immunodominance in major histocompatibility complex class I-restricted T lymphocyte responses. Annu. Rev. Immunol. 17:5188.[CrossRef][Medline]
- Chen, W., L.C. Anton, J.R. Bennink, and J.W. Yewdell. 2000. Dissecting the multifactorial causes of immunodominance in class I-restricted T cell responses to viruses. Immunity. 12:8393.[CrossRef][Medline]
- Parker, R.F., L.H. Bronson, and R.H. Green. 1941. Further studies of the infectious unit of vaccinia. J. Exp. Med. 74:263281.[Abstract]
- McCurdy, L.H., B.D. Larkin, J.E. Martin, and B.S. Graham. 2004. Modified vaccinia ankara: potential as an alternative smallpox vaccine. Clin. Infect. Dis. 38:17491753.[CrossRef][Medline]
- Sutter, G., and B. Moss. 1992. Nonreplicating vaccinia vector efficiently expresses recombinant genes. Proc. Natl. Acad. Sci. USA. 89:1084710851.[Abstract/Free Full Text]
- Ramirez, J.C., M.M. Gherardi, and M. Esteban. 2000. Biology of attenuated modified vaccinia virus Ankara recombinant vector in mice: virus fate and activation of B- and T-cell immune responses in comparison with the Western Reserve strain and advantages as a vaccine. J. Virol. 74:923933.[Abstract/Free Full Text]
- Wolffe, E.J., D.M. Moore, P.J. Peters, and B. Moss. 1996. Vaccinia virus A17L open reading frame encodes an essential component of nascent viral membranes that is required to initiate morphogenesis. J. Virol. 70:27972808.[Abstract]
- Chakrabarti, S., K. Brechling, and B. Moss. 1985. Vaccinia virus expression vector: coexpression of ß-galactosidase provides visual screening of recombinant virus plaques. Mol. Cell. Biol. 5:34033409.[Abstract/Free Full Text]
- Buller, R.M., G.L. Smith, K. Cremer, A.L. Notkins, and B. Moss. 1985. Decreased virulence of recombinant vaccinia virus expression vectors is associated with a thymidine kinase-negative phenotype. Nature. 317:813815.[CrossRef][Medline]
- Blasco, R., N.B. Cole, and B. Moss. 1991. Sequence analysis, expression, and deletion of a vaccinia virus gene encoding a homolog of profilin, a eukaryotic actin-binding protein. J. Virol. 65:45984608.[Abstract/Free Full Text]
- Earl, P.L., J.L. Americo, L.S. Wyatt, L.A. Eller, J.C. Whitbeck, G.H. Cohen, R.J. Eisenberg, C.J. Hartmann, D.L. Jackson, D.A. Kulesh, et al. 2004. Immunogenicity of a highly attenuated MVA smallpox vaccine and protection against monkeypox. Nature. 428:182185.[CrossRef][Medline]
- Antoine, G., F. Scheiflinger, F. Dorner, and F.G. Falkner. 1998. The complete genomic sequence of the modified vaccinia Ankara strain: comparison with other orthopoxviruses. Virology. 244:365396.[CrossRef][Medline]
- Shen, Z., G. Reznikoff, G. Dranoff, and K.L. Rock. 1997. Cloned dendritic cells can present exogenous antigens on both MHC class I and class II molecules. J. Immunol. 158:27232730.[Abstract]
- Dzuris, J.L., J. Sidney, E. Appella, R.W. Chesnut, D.I. Watkins, and A. Sette. 2000. Conserved MHC class I peptide binding motif between humans and rhesus macaques. J. Immunol. 164:283291.[Abstract/Free Full Text]
- Sidney, J., S. Southwood, C. Oseroff, M.F. Del Guercio, A. Sette, and H. Grey. 1998. Measurement of MHC/peptide interactions by gel filtration. Current Protocols in Immunology. John Wiley & Sons, Inc., Hoboken, NJ. 18.13.1118.13.19.
- Vremec, D., M. Zorbas, R. Scollay, D.J. Saunders, C.F. Ardavin, L. Wu, and K. Shortman. 1992. The surface phenotype of dendritic cells purified from mouse thymus and spleen: investigation of the CD8 expression by a subpopulation of dendritic cells. J. Exp. Med. 176:4758.[Abstract/Free Full Text]
- Basta, S., W. Chen, J.R. Bennink, and J.W. Yewdell. 2002. Inhibitory effects of cytomegalovirus proteins US2 and US11 point to contributions from direct priming and cross-priming in induction of vaccinia virus-specific CD8+ T cells. J. Immunol. 168:54035408.[Abstract/Free Full Text]
- McCraith, S., T. Holtzman, B. Moss, and S. Fields. 2000. Genome-wide analysis of vaccinia virus protein-protein interactions. Proc. Natl. Acad. Sci. USA. 97:48794884.[Abstract/Free Full Text]
- Vitiello, A., L. Yuan, R.W. Chesnut, J. Sidney, S. Southwood, P. Farness, M.R. Jackson, P.A. Peterson, and A. Sette. 1996. Immunodominance analysis of CTL responses to influenza PR8 virus reveals two new dominant and subdominant Kb-restricted epitopes. J. Immunol. 157:55555562.[Abstract]
- Sette, A., J. Sidney, M.-F. Del Guercio, S. Southwood, J. Ruppert, C. Dahlberg, H.M. Grey, and R.T. Kudo. 1994. Peptide binding to the most frequent HLA-A class I alleles measured by quantitative molecular binding assays. Mol. Immunol. 31:813822.[CrossRef][Medline]
- Upton, C., S. Slack, A.L. Hunter, A. Ehlers, and R.L. Roper. 2003. Poxvirus orthologous clusters: toward defining the minimum essential poxvirus genome. J. Virol. 77:75907600.[Abstract/Free Full Text]

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
-
Salek-Ardakani, S., Moutaftsi, M., Crotty, S., Sette, A., Croft, M.
(2008). OX40 Drives Protective Vaccinia Virus-Specific CD8 T Cells. J. Immunol.
181: 7969-7976
[Abstract]
[Full Text]
-
Meyer, V. S., Kastenmuller, W., Gasteiger, G., Franz-Wachtel, M., Lamkemeyer, T., Rammensee, H.-G., Stevanovic, S., Sigurdardottir, D., Drexler, I.
(2008). Long-Term Immunity against Actual Poxviral HLA Ligands as Identified by Differential Stable Isotope Labeling. J. Immunol.
181: 6371-6383
[Abstract]
[Full Text]
-
Earl, P. L., Americo, J. L., Wyatt, L. S., Espenshade, O., Bassler, J., Gong, K., Lin, S., Peters, E., Rhodes, L. Jr, Spano, Y. E., Silvera, P. M., Moss, B.
(2008). Rapid protection in a monkeypox model by a single injection of a replication-deficient vaccinia virus. Proc. Natl. Acad. Sci. USA
105: 10889-10894
[Abstract]
[Full Text]
-
Jing, L., Davies, D. H., Chong, T. M., Chun, S., McClurkan, C. L., Huang, J., Story, B. T., Molina, D. M., Hirst, S., Felgner, P. L., Koelle, D. M.
(2008). An Extremely Diverse CD4 Response to Vaccinia Virus in Humans Is Revealed by Proteome-Wide T-Cell Profiling. J. Virol.
82: 7120-7134
[Abstract]
[Full Text]
-
Tellam, J., Smith, C., Rist, M., Webb, N., Cooper, L., Vuocolo, T., Connolly, G., Tscharke, D. C., Devoy, M. P., Khanna, R.
(2008). From the Cover: Regulation of protein translation through mRNA structure influences MHC class I loading and T cell recognition. Proc. Natl. Acad. Sci. USA
105: 9319-9324
[Abstract]
[Full Text]
-
Oseroff, C., Peters, B., Pasquetto, V., Moutaftsi, M., Sidney, J., Panchanathan, V., Tscharke, D. C., Maillere, B., Grey, H., Sette, A.
(2008). Dissociation between Epitope Hierarchy and Immunoprevalence in CD8 Responses to Vaccinia Virus Western Reserve. J. Immunol.
180: 7193-7202
[Abstract]
[Full Text]
-
Towne, C. F., York, I. A., Neijssen, J., Karow, M. L., Murphy, A. J., Valenzuela, D. M., Yancopoulos, G. D., Neefjes, J. J., Rock, K. L.
(2008). Puromycin-Sensitive Aminopeptidase Limits MHC Class I Presentation in Dendritic Cells but Does Not Affect CD8 T Cell Responses during Viral Infections. J. Immunol.
180: 1704-1712
[Abstract]
[Full Text]
-
Fuse, S., Zhang, W., Usherwood, E. J.
(2008). Control of Memory CD8+ T Cell Differentiation by CD80/CD86-CD28 Costimulation and Restoration by IL-2 during the Recall Response. J. Immunol.
180: 1148-1157
[Abstract]
[Full Text]
-
Kastenmuller, W., Gasteiger, G., Gronau, J. H., Baier, R., Ljapoci, R., Busch, D. H., Drexler, I.
(2007). Cross-competition of CD8+ T cells shapes the immunodominance hierarchy during boost vaccination. JEM
204: 2187-2198
[Abstract]
[Full Text]
-
Fischer, M. A., Tscharke, D. C., Donohue, K. B., Truckenmiller, M. E., Norbury, C. C.
(2007). Reduction of vector gene expression increases foreign antigen-specific CD8+ T-cell priming. J. Gen. Virol.
88: 2378-2386
[Abstract]
[Full Text]
-
Mitra-Kaushik, S., Cruz, J., Stern, L. J., Ennis, F. A., Terajima, M.
(2007). Human Cytotoxic CD4+ T Cells Recognize HLA-DR1-Restricted Epitopes on Vaccinia Virus Proteins A24R and D1R Conserved among Poxviruses. J. Immunol.
179: 1303-1312
[Abstract]
[Full Text]
-
Assarsson, E., Sidney, J., Oseroff, C., Pasquetto, V., Bui, H.-H., Frahm, N., Brander, C., Peters, B., Grey, H., Sette, A.
(2007). A Quantitative Analysis of the Variables Affecting the Repertoire of T Cell Specificities Recognized after Vaccinia Virus Infection. J. Immunol.
178: 7890-7901
[Abstract]
[Full Text]
-
Moutaftsi, M., Bui, H.-H., Peters, B., Sidney, J., Salek-Ardakani, S., Oseroff, C., Pasquetto, V., Crotty, S., Croft, M., Lefkowitz, E. J., Grey, H., Sette, A.
(2007). Vaccinia Virus-Specific CD4+ T Cell Responses Target a Set of Antigens Largely Distinct from Those Targeted by CD8+ T Cell Responses. J. Immunol.
178: 6814-6820
[Abstract]
[Full Text]
-
Towne, C. F., York, I. A., Watkin, L. B., Lazo, J. S., Rock, K. L.
(2007). Analysis of the Role of Bleomycin Hydrolase in Antigen Presentation and the Generation of CD8 T Cell Responses. J. Immunol.
178: 6923-6930
[Abstract]
[Full Text]
-
Belyakov, I. M., Isakov, D., Zhu, Q., Dzutsev, A., Berzofsky, J. A.
(2007). A Novel Functional CTL Avidity/Activity Compartmentalization to the Site of Mucosal Immunization Contributes to Protection of Macaques against Simian/Human Immunodeficiency Viral Depletion of Mucosal CD4+ T Cells. J. Immunol.
178: 7211-7221
[Abstract]
[Full Text]
-
Jing, L., Chong, T. M., Byrd, B., McClurkan, C. L., Huang, J., Story, B. T., Dunkley, K. M., Aldaz-Carroll, L., Eisenberg, R. J., Cohen, G. H., Kwok, W. W., Sette, A., Koelle, D. M.
(2007). Dominance and Diversity in the Primary Human CD4 T Cell Response to Replication-Competent Vaccinia Virus. J. Immunol.
178: 6374-6386
[Abstract]
[Full Text]
-
Fuse, S., Bellfy, S., Yagita, H., Usherwood, E. J.
(2007). CD8+ T Cell Dysfunction and Increase in Murine Gammaherpesvirus Latent Viral Burden in the Absence of 4-1BB Ligand. J. Immunol.
178: 5227-5236
[Abstract]
[Full Text]
-
Sakala, I. G., Chaudhri, G., Buller, R. M., Nuara, A. A., Bai, H., Chen, N., Karupiah, G.
(2007). Poxvirus-Encoded Gamma Interferon Binding Protein Dampens the Host Immune Response to Infection. J. Virol.
81: 3346-3353
[Abstract]
[Full Text]
-
Tellam, J., Fogg, M. H., Rist, M., Connolly, G., Tscharke, D., Webb, N., Heslop, L., Wang, F., Khanna, R.
(2007). Influence of translation efficiency of homologous viral proteins on the endogenous presentation of CD8+ T cell epitopes. JEM
204: 525-532
[Abstract]
[Full Text]
-
Firat, E., Saveanu, L., Aichele, P., Staeheli, P., Huai, J., Gaedicke, S., Nil, A., Besin, G., Kanzler, B., van Endert, P., Niedermann, G.
(2007). The Role of Endoplasmic Reticulum-Associated Aminopeptidase 1 in Immunity to Infection and in Cross-Presentation. J. Immunol.
178: 2241-2248
[Abstract]
[Full Text]
-
Sanchez, P. J., McWilliams, J. A., Haluszczak, C., Yagita, H., Kedl, R. M.
(2007). Combined TLR/CD40 Stimulation Mediates Potent Cellular Immunity by Regulating Dendritic Cell Expression of CD70 In Vivo. J. Immunol.
178: 1564-1572
[Abstract]
[Full Text]
-
Dasgupta, A., Hammarlund, E., Slifka, M. K., Fruh, K.
(2007). Cowpox Virus Evades CTL Recognition and Inhibits the Intracellular Transport of MHC Class I Molecules. J. Immunol.
178: 1654-1661
[Abstract]
[Full Text]
-
Cornberg, M., Sheridan, B. S., Saccoccio, F. M., Brehm, M. A., Selin, L. K.
(2007). Protection against Vaccinia Virus Challenge by CD8 Memory T Cells Resolved by Molecular Mimicry. J. Virol.
81: 934-944
[Abstract]
[Full Text]
-
Rolph, M. S., Young, T. R., Shum, B. O. V., Gorgun, C. Z., Schmitz-Peiffer, C., Ramshaw, I. A., Hotamisligil, G. S., Mackay, C. R.
(2006). Regulation of Dendritic Cell Function and T Cell Priming by the Fatty Acid-Binding Protein aP2. J. Immunol.
177: 7794-7801
[Abstract]
[Full Text]
-
Fang, M., Sigal, L. J.
(2006). Direct CD28 Costimulation Is Required for CD8+ T Cell-Mediated Resistance to an Acute Viral Disease in a Natural Host. J. Immunol.
177: 8027-8036
[Abstract]
[Full Text]
-
Belyakov, I. M., Isakov, D., Zhu, Q., Dzutsev, A., Klinman, D., Berzofsky, J. A.
(2006). Enhancement of CD8+ T Cell Immunity in the Lung by CpG Oligodeoxynucleotides Increases Protective Efficacy of a Modified Vaccinia Ankara Vaccine against Lethal Poxvirus Infection Even in a CD4-Deficient Host. J. Immunol.
177: 6336-6343
[Abstract]
[Full Text]
-
Tewari, K., Walent, J., Svaren, J., Zamoyska, R., Suresh, M.
(2006). Differential requirement for Lck during primary and memory CD8+ T cell responses. Proc. Natl. Acad. Sci. USA
103: 16388-16393
[Abstract]
[Full Text]
-
Tang, J., Murtadha, M., Schnell, M., Eisenlohr, L. C., Hooper, J., Flomenberg, P.
(2006). Human T-cell responses to vaccinia virus envelope proteins.. J. Virol.
80: 10010-10020
[Abstract]
[Full Text]
-
Obar, J. J., Fuse, S., Leung, E. K., Bellfy, S. C., Usherwood, E. J.
(2006). Gammaherpesvirus persistence alters key CD8 T-cell memory characteristics and enhances antiviral protection.. J. Virol.
80: 8303-8315
[Abstract]
[Full Text]
-
Chavan, R., Marfatia, K. A., An, I. C., Garber, D. A., Feinberg, M. B.
(2006). Expression of CCL20 and Granulocyte-Macrophage Colony-Stimulating Factor, but Not Flt3-L, from Modified Vaccinia Virus Ankara Enhances Antiviral Cellular and Humoral Immune Responses.. J. Virol.
80: 7676-7687
[Abstract]
[Full Text]
-
Yi, J. S., Holbrook, B. C., Michalek, R. D., Laniewski, N. G., Grayson, J. M.
(2006). Electron Transport Complex I Is Required for CD8+ T Cell Function. J. Immunol.
177: 852-862
[Abstract]
[Full Text]
-
Palmowski, M. J., Gileadi, U., Salio, M., Gallimore, A., Millrain, M., James, E., Addey, C., Scott, D., Dyson, J., Simpson, E., Cerundolo, V.
(2006). Role of Immunoproteasomes in Cross-Presentation. J. Immunol.
177: 983-990
[Abstract]
[Full Text]
-
Tscharke, D. C., Woo, W.-P., Sakala, I. G., Sidney, J., Sette, A., Moss, D. J., Bennink, J. R., Karupiah, G., Yewdell, J. W.
(2006). Poxvirus CD8+ T-Cell Determinants and Cross-Reactivity in BALB/c Mice.. J. Virol.
80: 6318-6323
[Abstract]
[Full Text]
-
York, I. A., Brehm, M. A., Zendzian, S., Towne, C. F., Rock, K. L.
(2006). Endoplasmic reticulum aminopeptidase 1 (ERAP1) trims MHC class I-presented peptides in vivo and plays an important role in immunodominance. Proc. Natl. Acad. Sci. USA
103: 9202-9207
[Abstract]
[Full Text]
-
Jackson, H., Dimopoulos, N., Mifsud, N. A., Tai, T. Y., Chen, Q., Svobodova, S., Browning, J., Luescher, I., Stockert, L., Old, L. J., Davis, I. D., Cebon, J., Chen, W.
(2006). Striking Immunodominance Hierarchy of Naturally Occurring CD8+ and CD4+ T Cell Responses to Tumor Antigen NY-ESO-1. J. Immunol.
176: 5908-5917
[Abstract]
[Full Text]
-
Munks, M. W., Gold, M. C., Zajac, A. L., Doom, C. M., Morello, C. S., Spector, D. H., Hill, A. B.
(2006). Genome-Wide Analysis Reveals a Highly Diverse CD8 T Cell Response to Murine Cytomegalovirus. J. Immunol.
176: 3760-3766
[Abstract]
[Full Text]
-
Clark, R. H., Kenyon, J. C., Bartlett, N. W., Tscharke, D. C., Smith, G. L.
(2006). Deletion of gene A41L enhances vaccinia virus immunogenicity and vac