|
||
ARTICLE |
CORRESPONDENCE David Tscharke: davidT{at}qimr.edu.au or Jonathan Yewdell: jyewdell{at}niaid.nih.gov
|
|
|---|
In the late 1700s, Edward Jenner published the seminal observation that infection with animal poxviruses protects humans against smallpox (1). Though similar practices had been followed for centuries by other societies around the world, Jenner was the first to apply the scientific method to evaluating efficacy. In so doing, he laid the foundations for both the eradication of smallpox and for the discipline of immunology.
Despite its historic origins, current understanding of the molecular basis for cross-protection between heterologous poxviruses is woefully incomplete. This is particularly the case for antigens recognized by T cells, although they are assumed to play an important role in immunity (24). The neglect stems partly from the daunting size of poxvirus genomes and from the lack of a pressing need to understand poxvirus immunology after the eradication of smallpox (2). Recent improvements in molecular methods and determinant prediction have made genome size less of an obstacle. The specter of variola virus (VARV), the causative agent of smallpox, being used as a bioweapon has eliminated complacency about human poxvirus immunity (5). The current live vaccinia virus (VACV)-based smallpox vaccine, while remarkably effective, is associated with mild to severe complications and safer alternatives are required.
As a consequence, identification of human T cell determinants of VACV, the current smallpox vaccine, is now underway. To date, papers have been limited to a few determinants presented by a single restricting class I molecule (68). Although this work is important for characterizing human responses to safer vaccines, the biological relevance of responses to these determinants cannot be tested. Fortunately, there are animal models to shed light on the problem of cross-protection between heterologous poxviruses. For example, just as VACV protects humans against smallpox, this same virus protects mice against mousepox (9, 10).
Mousepox is caused by ectromelia virus (ECTV), a mouse pathogen closely related to VACV and VARV (11, 12). Current understanding of smallpox pathogenicity owes much to pioneering work with mousepox (13, 14) and more recent work has taught us much about immunity in systemic poxvirus disease (1517). Alternative models for lethal poxvirus disease in mice have also been exploited, including intranasal VACV (6, 8, 1820) and cowpox virus (CPXV; reference 21) infection. Although the specificities of T cells that contribute to protection of humans against smallpox and mice against various poxviruses will not be identical due to differences in antigen processing and presentation and T cell receptor repertoires, the basic principles underlying protection are likely to be similar. Due to the sophistication of the mouse model for immunity, many important questions about the basic immunology of poxvirus protection are best addressed at this time in mouse models. These include assessment of the importance of individual effector mechanisms and the degree and mechanism of protection afforded by smallpox vaccine candidates.
A critical step in refining the mouse model is to define poxvirus determinants recognized by CD8+ T cells and determine their role in protective immunity. Here, we provide the original description of poxvirus determinants recognized by mouse CD8+ T cells, and their biological relevance in protection against lethal poxvirus infections.
![]()
Results
Top
Abstract
Results
Discussion
Materials and Methods
References
Identification of VACV CD8+ T cell determinants in mice
To identify immunogenic VACV gene products, we generated an expression library of 258 predicted open reading frames (ORFs) and highly transfectable cells (human 293 cells) expressing H-2Kb or Db. Cells transfected with individual plasmids were tested for their ability to induce IFN-
expression in CD8+ T cells derived from C57BL/6 mice infected i.p. with VACV 7 d previously (Fig. 1 a). Five antigenic VACV ORFs were discovered, three restricted by H-2Kb and two by H-2Db (Table I). For two ORFs, A19L and A47L, this is the first empirical evidence that they are expressed during infection. Ironically, of the known genes, two (B8R and K3L) are involved in virus evasion of host interferon responses (22). Whether this apparent targeting of immune modulators by CD8+ T cells is a general phenomenon or a quirk of the mouse model used requires more determinants to be mapped in mice and other species.
|
|
Synthetic peptides for each of the five mapped determinants were antigenic at <1010 M (Fig. 1 b) when tested for their ability to activate primary VACV-specific CD8+ T cells. Peptide-specific CD8+ T cell cultures were generated by in vitro stimulation of splenocytes from VACV-infected mice over several weeks. Cultures stimulated with the five peptides were found to recognize VACV-infected DC2.4 cells and VACV-infected 293 expressing the correct restriction element (unpublished data). Similar cultures recognized 293 cells expressing the appropriate restriction element transfected with the source VACV gene, but not another gene, or the source gene where the wrong restriction element was present (unpublished data). This strongly suggests that the peptides identified represent bona fide virus-encoded determinants generated by antigen processing pathways and not spuriously cross-reacting peptides. We note that the odds of this latter possibility increase with increasing genome size of the immunogen and might prove to be particularly relevant to poxviruses and other large DNA viruses.
Contribution of mapped determinants to total response
We determined the contribution of these determinants to the total acute (day 7; Fig. 2 a) and memory (day 21; Fig. 2 b) CD8+ T cell response to VACV by intracellular cytokine staining (ICS) of splenocytes tested ex vivo. Uninfected mice failed to detectably respond to any of the peptides (unpublished data). 7 d after i.p. infection, B8R20-27 elicited a response from 1015% of all splenic CD8+ T cells, amounting to a staggering 107 cells in the spleen alone. Other determinants elicited a more modest response; in general, K3L6-15 was the next strongest followed by A47L138-146, A42R88-96, and A19L47-55. Occasionally, in individual mice, the order of K3L6-15 and A47L138-146 was swapped in the immunodominance (ID) hierarchy, but A19L47-55 was always at the bottom. The stability of the VACV ID hierarchy in individual mice is similar to that seen with influenza virus (23). Comparing determinant-specific responses with the total VACV-specific response shows that B8R20-27, the immunodominant determinant (IDD), alone stimulates >25% of the total response. When combined with the four subdominant determinants (SDDs), this accounts for up to 40% of the total response.
|
30% of the total anti-VACV memory CD8+ T cell response.
Route of infection affects ID
Smallpox vaccination has been performed for centuries by dermal scarification, whose simplicity probably contributed to smallpox eradication. To our surprise, after scarification with VACV, B8R20-27-specific responses were enhanced, whereas responses to SDDs were depressed (Fig. 3 a). Indeed, in most mice, responses to the two weakest SDDs were reduced to the limit of detection. The enhanced response to B8R20-27 is strikingly demonstrated by comparison to the total VACV-specific response; after dermal scarification, >50% of CD8+ T cells are specific for B8R20-27. To test this apparent suppression of SDD responses more rigorously, the ratio of the sum of the SDD-specific responses to the IDD-specific response was calculated using data from individual mice from several experiments to provide a larger sample size (Fig. 3 b). The mean of this ratio was significantly different (P = 0.0013) between mice infected by the i.p. and dermal routes. Finally, responses to all determinants contribute nearly 60% of the total primary CD8+ T cell response induced by scarification.
|
|
|
2% of all CD8+ T cells, whereas responses to K3L6-15 were lower and those to A47L138-146 and A42R88-96 were at background levels. The lack of response to the latter two determinants cannot be attributed to genetic variation in the determinants in the MVA strain we used as determined by DNA sequencing. The total VACV-specific response was slightly lower after MVA infection than WR infection, but higher than in Dryvax-immunized mice (unpublished data). We also screened the VACV ORF library with splenocytes from MVA-infected mice, but no new CD8+ T cell determinantbearing gene products were identified (unpublished data). These data demonstrate that first, the presence of conserved determinants in conserved ORFs predicted to be expressed provides no guarantee of immunogenicity and, second, the ID hierarchy can be affected by genomic differences in poxviruses not predicted to effect the expression of determinants.
Responses to mapped determinants are found in mice immunized with attenuated VACVs
The striking difference in ID hierarchies between WR and MVA could stem from the attenuation of MVA, which, in contrast with WR/Dryvax, is capable of only marginal replication in mammalian cells in vitro and in vivo (27, 28). To examine the relationship between virus attenuation and ID hierarchy, we infected mice with a VACV that only expresses the essential viral structural gene A17L in the presence of IPTG (iA17L; reference 29) and, therefore, cannot replicate in vivo. This virus, like many recombinant VACVs, also lacks thymidine kinase and so a thymidine kinasedeficient VACV (VACV-TK; reference 30) is shown as a control for this experiment. VACV-TK is replication competent but less pathogenic than WR in vivo (31), and several thymidine kinasedeficient VACVs have been found to have similar ID hierarchies to WR (unpublished data). Despite being unable to replicate in vivo, iA17L generated an ID hierarchy highly similar to TK (Fig. 4 c) or WR (Figs. 2 a and 4, a and b). We conclude that attenuation per se does not lead to significant alterations in ID hierarchy to poxviruses and cannot account for the alterations between CD8+ T cell responses to VACV and MVA.
Identification of VACV-CD8+ T cell determinants by ECTV and CPXV
The protection afforded by the smallpox vaccine relies on cross-reactivity between VACV and VARV. To examine cross-reactivity of poxvirus-specific CD8+ T cell determinants in a mouse system, we extended our characterization of CD8+ T cell responses to include ECTV and CPXV (Fig. 5). B8R20-27 maintained IDD status in responses to both viruses but generated weaker responses when compared with VACV, raising the possibility of other dominant determinants in these viruses. ECTV failed to induce reliable responses to A42R88-96 or K3L6-15. The latter was expected from genomic analysis (Table II). The anti-ECTV response to A47L138-146 was of interest due to a predicted sequence change in the determinant in the second residue (A to T). Using a synthetic version of the altered peptide we confirmed its cross-reactivity with ECTV and VACV-specific CD8+ T cells (unpublished data).
|
Vaccination with the immunodominant VACV determinant leads to partial protection against mousepox
Finally, we examined the ability of CD8+ T cells primed by immunization with DC exposed to the IDD B8R20-27, to protect against lethal ECTV challenge. In a first experiment, we found that B8R20-27-pulsed DCs induced low but measurable CD8+ T cell responses (unpublished data) and protection from intranasal challenge with ECTV that was significant (P = 0.0279), but incomplete (Fig. 6 a). This protection was confirmed in a second experiment controlled with groups of mice immunized with TK VACV and DCs pulsed with an irrelevant peptide (P = 0.0196; Fig. 6 b). These data demonstrate that the IDD, B8R20-27, not only cross-reacts amongst poxvirus species but is also cross-protective.
|
| Discussion |
|---|
|
|
|---|
The identification of the immunogenic determinants in poxviruses should greatly facilitate development of the mouse model for smallpox vaccination and also the utility of mouse poxvirus infections for understanding viral immunity. The latter point is underscored by our observation that the ID hierarchy varies with the route of infection, the first observation of its kind to our knowledge. It will be of great interest to determine the underlying mechanism. It could reflect route-dependent differences in the identity of antigen-presenting cells that activate CD8+ T cells, the nature of antigen presented (e.g., direct vs. cross-priming), or the repertoire of CD8+ T cells that interact with antigen-presenting cells in the locale where priming occurs. Understanding route-dependent effects on immunogenicity is critical to interpreting vaccine trials such as the recent paper comparing intramuscular immunization with MVA to standard scarification with Dryvax (33).
We found that the ID hierarchy amongst SDDs was greatly altered in mice immunized with MVA compared with WR. Furthermore, responses to two VACV determinants that were always detectable in mice infected by the i.p. route with WR were at background levels when MVA was used. Experiments with another highly attenuated VACV (iA17L) demonstrate that the results found with MVA cannot be attributed per se to decreased replication in vivo. Sequence database searches found these two determinants and their genes intact and expected to be expressed in two separate isolates of MVA, one of which is derived from the same source as our MVA stock. Furthermore, DNA sequencing of our virus stock revealed no alterations in the determinants. It is more likely that the altered ID hierarchy is related to one or more of the many genomic deletions and other changes in MVA compared with WR (34). It is possible that MVA encodes a novel IDD that suppresses other responses via immunodomination (23). Alternatively, genes encoding the cryptic determinants may not be expressed at immunogenic levels by MVA in vivo. Irrespective of the cause, the finding that responses were not predictable on the basis of sequence information challenges assumptions about conservation of CD8+ T cell responses between related viruses and underscores the need for empirical data. It also raises the important issue of the degree of overlap between cellular immune responses to Dryvax and potential smallpox vaccine replacements.
Using the VACV/ECTV model, we identify the first VACV-CD8+ T cell determinant that may mediate cross-protection against a lethal systemic disease with a heterologous poxvirus. This extends prior studies with individual CD8+ T cell determinants using VACV challenge models in HLA-A2 transgenic mice (6, 8) and shows the potential of CD8+ T cells to mediate protection against poxvirus disease. Immunization with B8R20-27 synthetic peptide provided incomplete protection in our challenge model, but we note that the number of CD8+ T cells induced by peptide vaccination was at least 50-fold less than after VACV infection, and inducing higher CD8+ T cell responses could well provide better protection. Furthermore, although our data show a potential basis for cross-protection between orthopoxviruses, more work is needed to understand the roles of CD8+ T cells and other effector mechanisms in the context of current VACV-based vaccines.
| Materials and Methods |
|---|
|
|
|---|
Synthetic peptides
Peptides were synthesized as described previously (36) by A & A Labs, at the John Curtin School of Medical Research Biomolecular Resources Facility (Australian National University, Canberra, Australia) or purchased as crude material from Mimotopes or Pepscan Systems B.V. Peptides were resuspended at 420 mg/ml in 100% DMSO and diluted to required concentrations in PBS, PBS with 0.05% NP-40, or RPMI 1640. Peptides for use as radiolabeled probes were purified to >95% homogeneity by reversed phase HPLC, and composition was ascertained by amino acid analysis, sequencing, and/or mass spectrometry analysis. Radiolabeling was done using the chloramine T method (37).
Enrichment of splenic DCs
DCs were enriched from C57BL/6 mouse spleens essentially as described previously (38). In brief, spleen fragments were digested for 20 min at room temperature with collagenase-DNase and treated for 5 min with EDTA. Low-density cells (including DCs) were selected by centrifugation in a Hepes-buffered balanced salt solution, pH 7.2, with 3% FCS and Nycodenz at a density of 1.077 g/cm3 (Nycomed). The DC-enriched fraction was cultured overnight at 37°C with 5% CO2 in DMEM (high glucose) with 10% FBS and 100 ng/ml LPS. The nonadherent population from this culture was collected. Enriched DCs were incubated with peptide at 1 µM for 2 h before washing and resuspension in PBS.
Mice, infections, and immunizations
Specific pathogen-free C57BL/6 mice were obtained from Taconic, Animal Resource Centre (Perth, Australia), and Animal Services Division, John Curtin School of Medical Research. Mice were housed, and experiments were done according to the relevant ethics requirements. In most experiments, mice were infected i.p. with 1065 x 107 PFU of VACV, depending on virus strain. For dermal scarification, 10 scratches were made at the base of the tail in a crosshatch pattern using a 21 gauge needle and a drop of VACV at 107 PFU/ml applied for 1 min before the excess was removed with a tissue. For subcutaneous infections, 103 PFU ECTV and 106 PFU CPXV and VACV were injected in the shanks of mice. Except where stated, mice were euthanized 7 d after infection and spleens taken for analysis of CD8+ T cell responses. For DC immunization, 2.5 x 105 peptide-coated, spleen-derived DCs suspended in PBS were injected intravenously. For ECTV challenge, DC-immunized or control mice were anesthetized and infected intranasally with 300 PFU of ECTV in 20 µl of PBS. Mice were monitored for signs of illness twice daily, and moribund animals euthanized.
It was noted that C57BL/6 mice available in Australia (from two sources) made very high VACV-specific responses (Figs. 25). Mice available in the USA had lower total VACV-specific responses in the spleen (2025% of CD8+ T cells; unpublished data), similar to other published studies (20, 39). The relative contribution of the mapped determinants to the total CD8+ T cell response was very similar irrespective of country or source of mice.
Generation of VACV ORF library
Primary PCR products (and associated information) representing 266 predicted ORFs of VACV, made for a project investigating VACV proteinprotein interactions by yeast 2-hybrid (40), were a gift from B. Moss (NIAID, Bethesda, MD). These were reamplified by PCR using Platinum Pfx (Invitrogen) and the primers 5'-CACCGAATTCCAGCTGACCACC-3' and 5'-TATTCGGATCCCCGGGAATTGC-3' and cloned into the eukaryotic expression vector pcDNA3.1D/V5-His-TOPO (Invitrogen) according to the manufacturer's instructions. Clones were screened by cleavage of miniprep DNA (Wizard SV 96; Promega) with BamHI (site underlined in the aforementioned primer sequence) and separation on 1.2% agarose gels. This initial library was edited, with 12 duplicated ORFs being removed and four ORFs (known to exist but missing) being added (A13L, A14.5L, A44L, and A48R); ORFs were PCR amplified directly from crude virus stocks and cloned as described before. The complete library comprised 258 unique clones each representing a single predicted VACV ORF. The 5' end (
600 bp) of each ORF clone was sequenced using ABI BigDye Terminators reagents and an ABI PRISM 3100 genetic analyzer (Applied Biosystems). Clones with early terminations or frame shifts were removed and remade. Transfection grade (low endotoxin) DNA for each clone was produced by Aldevron.
Generation of 293 cells expressing mouse MHC genes
The complete coding sequences for H-2Kb and Db were amplified by PCR from recombinant VACV encoding these products and cloned into pcDNA3.1D/V5-His-TOPO as described before. The following primers were used: Kb, 5'-CACCATGGTACCGTGCACGCTG-3' and TCACGCTAGAGAATGAGGGTC; and Db, 5'-CACCATGGGGGCGATGGCTC-3' and 5'-TCACGCTTTACAATCTCGGAG-3'. All clones were verified by sequencing and comparison to GenBank/EMBL/DDBJ accession nos.: Kb, U47328; and Db, U47325. To make stable cell lines, plasmids were cleaved with SmaI and transfected into a single well of a six-well dish of 293A cells using Lipofectamine 2000 reagent according to the manufacturer's instructions (Invitrogen). After overnight incubation (37°C, 9% CO2), cells were harvested and six serial 1:5 dilutions were made in a fresh six-well plate in medium supplemented with 0.5 mg/ml G418 (Biofluids). After several weeks of selection and growth in G418-containing medium, transfectants were cloned by limiting dilution (H-2 Kb) or FACS followed by single cell deposition (H-2 Db, FACStar Plus; BD Biosciences). Potential H-2expressing clones were selected by staining with mAbs (HB176 supernatant followed by rabbit antimouse Ig-FITC for Kb and direct FITC conjugates for Db; BD Biosciences) and analysis on a FACSCalibur (BD Biosciences). The clones selected were 293KbC2 and 293DbA5 and were maintained in 0.5 mg/ml G418. Expression of H-2 antigens was found to be stable for many passages in nonselecting medium.
Transfections in 96-well format and harvesting transfectants
293KbC2 or 293DbA5 cells were seeded in flat-bottom 96-well plates between 5 and 8 x 104 cells/well the night before transfection. Diluted Lipofectamine 2000 (25 µl/well of 1:50 dilution) was arrayed in 96-well plates and mixed with plasmid DNA (25 µl at 0.01 µg/ml). These transfection mixes were left at room temperature for 30 min before being used to replace medium on the 293Kb/Db cells. After 2 h at 37°C with 5% CO2, 100 µl of fresh D10 was added to each well and the plates returned to 37°C overnight. For T cell stimulations, transfected cells were harvested by washing wells with 50 µl PBS and incubating them with 20 µl trypsin for several minutes. Cells were collected with 100 µl D10 and moved to U-bottom 96-well plates. Plates were spun, medium and trypsin were removed, and transfectants were resuspended with suspensions of splenocytes or CD8+ T cells to begin stimulations.
Stimulations and ICS
Splenocytes (0.21 x 106) or CD8+ T cells (105, CD8a+ T Cell Isolation Kit; Miltenyi Biotec) were incubated with the following: (a) transfected cells (see previous paragraph), (b) synthetic peptides, (c) DC2.4 pulsed with synthetic peptides at various concentrations, or (d) DC2.4 infected with VACV (see Viruses and cell lines) in the wells of a 96-well plate at 37°C and 5% CO2. Synthetic peptides (if used) were added to a final concentration of 0.5 µM; cells (except those transfected in 96-well format) were used at 12 x 105 cells per well. 10 µg/ml brefeldin A was added after 1 h, and the incubation continued for another 34 h. Plates were spun, medium was removed, and cells were resuspended in 50 µl of
-CD8-PE (clone 536.7; BD Biosciences; some experiments used FITC or PE-Cy5) and incubated on ice for 20 min. Cells were washed, resuspended in 50 µl of 1% paraformaldehyde, and incubated at room temperature for 20 min before another two washes and staining with
-IFN-
allophycocyanin (clone XMG1.2; BD Biosciences; some experiments used FITC or PE) overnight in PBS with 0.5% saponin at 4°C. Cells were washed once before acquisition and analysis of fluorescence using a FACSCalibur (BD Biosciences). Analysis was done using Flowjo software (Tree Star Inc.); events were gated for live lymphocytes on FSC x SSC followed by CD8+ cells using CD8 x SSC and displayed as CD8 x IFN-
. Data was recorded as IFN-
+, CD8+ cells as a percentage of total CD8+ cells. Backgrounds as determined using irrelevant peptides, cells transfected with irrelevant constructs or uninfected cells were usually in the order of 0.1% and were subtracted from the values presented for test samples.
MHC binding assays
Quantitative assays to measure the binding of peptides to soluble class I molecules are based on the inhibition of binding of a radiolabeled standard peptide (37). In brief, 110 nM radiolabeled peptide was coincubated at room temperature with 1 µM to 1 nM of purified class I molecules (from EL-4) in the presence of 1 µM of human ß2-microglobulin (Scripps Laboratories) and a cocktail of protease inhibitors. The radiolabeled peptides were used, and their average IC50s were RGYVFQGL, 3.1 nM and SGPSNTYPEI, 4.4 nM for Kb and Db, respectively (41). After a 2-d incubation, binding of the radiolabeled peptide to the corresponding MHC class I molecule was determined by capturing MHCpeptide complexes on Greiner Lumitrac 600 microplates (Greiner Bio-one) coated with the W6/32 antibody, and measuring bound cpm using the TopCount microscintillation counter (Packard Instrument Co.). In the case of competitive assays, the concentration of peptide yielding 50% inhibition of the binding of the radiolabeled probe peptide was calculated (IC50). Peptides were typically tested in three or more independent experiments. Under the conditions used, where [label] < [MHC] and IC50
[MHC], the measured IC50 values are reasonable approximations of the true Kd values (42).
Sequence comparison
ORF and determinant conservation between poxviruses was done with the aid of poxvirus orthologous clusters (43) maintained at the University of Victoria, Victoria, BC Canada and accessed through the Poxvirus Bioinformatics Resource (www.poxvirus.org).
Statistical analysis
Statistical analysis was done with the aid of Prism software (Graphpad). For comparing the means of responses or ratios, Student's t tests were used. For Kaplan-Meier survival analyses, p-values were generated using the log-rank test to compare survival curves. Differences were considered significant if p-values were <0.05.
| Acknowledgments |
|---|
This work was funded by the NIAID-National Institutes of Health (NIH) intramural program and grants from the NHMRC (Australia) to D. Tscharke (Howard Florey Centenary Fellowship, no. 224273) and G. Karupiah (no. 153836), the Howard Hughes Medical Institute (to G. Karupiah), and NIAID-NIH to A. Sette and J. Sidney (R01 grant no. AI56268 and contract no. N01-AI-40023).
The authors have no conflicting financial interests.
Submitted: 16 September 2004
Accepted: 22 November 2004
| References |
|---|
|
|
|---|
1 Jenner, E. 1798. An Enquiry into the Causes and Effects of the Variolae Vaccinae, a Disease Discovered in Some of the Western Counties of England, Particularly Gloucestershire, and Known by the Name of the Cow Pox, 1st ed. Law Murray & Highly, London, England.
2 Fenner, F., D. Henderson, I. Arita, Z. Jezek, and I. Ladnyi. 1988. Smallpox and Its Eradication. World Health Organization, Geneva. 1460 pp.
3 Ennis, F.A., J. Cruz, W.E. Demkowicz, A.L. Rothman, and D.J. McClain. 2002. Primary induction of human CD8+ cytotoxic T lymphocytes and interferon-
-producing T cells after smallpox vaccination. J. Infect. Dis. 185:16571659.[CrossRef][Medline]
4 Combadiere, B., A. Boissonnas, G. Carcelain, E. Lefranc, A. Samri, F. Bricaire, P. Debre, and B. Autran. 2004. Distinct time effects of vaccination on long-term proliferative and IFN-
producing T cell memory to smallpox in humans. J. Exp. Med. 199:15851593.
5 Lane, H.C., J.L. Montagne, and A.S. Fauci. 2001. Bioterrorism: a clear and present danger. Nat. Med. 7:12711273.[CrossRef][Medline]
6 Drexler, I., C. Staib, W. Kastenmuller, S. Stevanovic, B. Schmidt, F.A. Lemonnier, H.G. Rammensee, D.H. Busch, H. Bernhard, V. Erfle, and G. Sutter. 2003. Identification of vaccinia virus epitope-specific HLA-A*0201-restricted T cells and comparative analysis of smallpox vaccines. Proc. Natl. Acad. Sci. USA. 100:217222.
7 Terajima, M., J. Cruz, G. Raines, E.D. Kilpatrick, J.S. Kennedy, A.L. Rothman, and F.A. Ennis. 2003. Quantitation of CD8+ T cell responses to newly identified HLA-A*0201restricted T cell epitopes conserved among vaccinia and variola (smallpox) viruses. J. Exp. Med. 197:927932.
8 Snyder, J.T., I.M. Belyakov, A. Dzutsev, F. Lemonnier, and J.A. Berzofsky. 2004. Protection against lethal vaccinia virus challenge in HLA-A2 transgenic mice by immunization with a single CD8+ T-cell peptide epitope of vaccinia and variola viruses. J. Virol. 78:70527060.
9 Burnet, F.M., and W.C. Boake. 1945. The relationship between the virus of infectious ectromelia of mice and vaccinia virus. J. Immunol. 53:113.
10 Fenner, F. 1947. Studies in infectious ectromelia of mice. I. Immunization of mice against ectromelia with living vaccinia virus. Aust. J. Exp. Biol. Med. Sci. 25:257274.
11 Marchal, J. 1930. Infectious ectromelia. A hitherto undescribed virus disease of mice. J. Pathol. Bacteriol. 33:713728.[CrossRef]
12 Fenner, F. 1948. The pathogenesis of the acute exanthems. An interpretation based on experimental investigations with mousepox (infectious ectromelia of mice). Lancet. 252:915920.[CrossRef]
13 Fenner, F. 1949. Mouse-pox (infectious ectromelia of mice): a review. J. Immunol. 63:341373.
14 Blanden, R.V. 1970. Mechanisms of recovery from a generalized viral infection: mousepox. I. The effects of anti-thymocyte serum. J. Exp. Med. 132:10351054.[Abstract]
15 Karupiah, G., T.N. Fredrickson, K.L. Holmes, L.H. Khairallah, and R.M.L. Buller. 1993. Importance of interferons in recovery from mousepox. J. Virol. 67:42144226.
16 Karupiah, G., R.M. Buller, N. Van Rooijen, C.J. Duarte, and J. Chen. 1996. Different roles for CD4+ and CD8+ T lymphocytes and macrophage subsets in the control of a generalized virus infection. J. Virol. 70:83018309.[Abstract]
17 Chaudhri, G., V. Panchanathan, R.M.L. Buller, A.J.M. van den Eertwegh, E. Claassen, J. Zhou, R. de Chazal, J.D. Laman, and G. Karupiah. 2004. Polarized type 1 cytokine response and cell-mediated immunity determine genetic resistance to mousepox. Proc. Natl. Acad. Sci. USA. 101:90579062.
18 Belyakov, I.M., P. Earl, A. Dzutsev, V.A. Kuznetsov, M. Lemon, L.S. Wyatt, J.T. Snyder, J.D. Ahlers, G. Franchini, B. Moss, and J.A. Berzofsky. 2003. Shared modes of protection against poxvirus infection by attenuated and conventional smallpox vaccine viruses. Proc. Natl. Acad. Sci. USA. 100:94589463.
19 Wyatt, L.S., P.L. Earl, L.A. Eller, and B. Moss. 2004. Highly attenuated smallpox vaccine protects mice with and without immune deficiencies against pathogenic vaccinia virus challenge. Proc. Natl. Acad. Sci. USA. 101:45904595.
20 Xu, R., A.J. Johnson, D. Liggitt, and M.J. Bevan. 2004. Cellular and humoral immunity against vaccinia virus infection of mice. J. Immunol. 172:62656271.
21 Bray, M., M. Martinez, D.F. Smee, D. Kefauver, E. Thompson, and J.W. Huggins. 2000. Cidofovir protects mice against lethal aerosol or intranasal cowpox virus challenge. J. Infect. Dis. 181:1019.[CrossRef][Medline]
22 Seet, B.T., J.B. Johnston, C.R. Brunetti, J.W. Barrett, H. Everett, C. Cameron, J. Sypula, S.H. Nazarian, A. Lucas, and G. McFadden. 2003. Poxviruses and immune evasion. Annu. Rev. Immunol. 21:377423.[CrossRef][Medline]
23 Yewdell, J.W., and J.R. Bennink. 1999. Immunodominance in major histocompatibility complex class I-restricted T lymphocyte responses. Annu. Rev. Immunol. 17:5188.[CrossRef][Medline]
24 Chen, W., L.C. Anton, J.R. Bennink, and J.W. Yewdell. 2000. Dissecting the multifactorial causes of immunodominance in class I-restricted T cell responses to viruses. Immunity. 12:8393.[CrossRef][Medline]
25 Parker, R.F., L.H. Bronson, and R.H. Green. 1941. Further studies of the infectious unit of vaccinia. J. Exp. Med. 74:263281.[Abstract]
26 McCurdy, L.H., B.D. Larkin, J.E. Martin, and B.S. Graham. 2004. Modified vaccinia ankara: potential as an alternative smallpox vaccine. Clin. Infect. Dis. 38:17491753.[CrossRef][Medline]
27 Sutter, G., and B. Moss. 1992. Nonreplicating vaccinia vector efficiently expresses recombinant genes. Proc. Natl. Acad. Sci. USA. 89:1084710851.
28 Ramirez, J.C., M.M. Gherardi, and M. Esteban. 2000. Biology of attenuated modified vaccinia virus Ankara recombinant vector in mice: virus fate and activation of B- and T-cell immune responses in comparison with the Western Reserve strain and advantages as a vaccine. J. Virol. 74:923933.
29 Wolffe, E.J., D.M. Moore, P.J. Peters, and B. Moss. 1996. Vaccinia virus A17L open reading frame encodes an essential component of nascent viral membranes that is required to initiate morphogenesis. J. Virol. 70:27972808.[Abstract]
30 Chakrabarti, S., K. Brechling, and B. Moss. 1985. Vaccinia virus expression vector: coexpression of ß-galactosidase provides visual screening of recombinant virus plaques. Mol. Cell. Biol. 5:34033409.
31 Buller, R.M., G.L. Smith, K. Cremer, A.L. Notkins, and B. Moss. 1985. Decreased virulence of recombinant vaccinia virus expression vectors is associated with a thymidine kinase-negative phenotype. Nature. 317:813815.[CrossRef][Medline]
32 Blasco, R., N.B. Cole, and B. Moss. 1991. Sequence analysis, expression, and deletion of a vaccinia virus gene encoding a homolog of profilin, a eukaryotic actin-binding protein. J. Virol. 65:45984608.
33 Earl, P.L., J.L. Americo, L.S. Wyatt, L.A. Eller, J.C. Whitbeck, G.H. Cohen, R.J. Eisenberg, C.J. Hartmann, D.L. Jackson, D.A. Kulesh, et al. 2004. Immunogenicity of a highly attenuated MVA smallpox vaccine and protection against monkeypox. Nature. 428:182185.[CrossRef][Medline]
34 Antoine, G., F. Scheiflinger, F. Dorner, and F.G. Falkner. 1998. The complete genomic sequence of the modified vaccinia Ankara strain: comparison with other orthopoxviruses. Virology. 244:365396.[CrossRef][Medline]
35 Shen, Z., G. Reznikoff, G. Dranoff, and K.L. Rock. 1997. Cloned dendritic cells can present exogenous antigens on both MHC class I and class II molecules. J. Immunol. 158:27232730.[Abstract]
36 Dzuris, J.L., J. Sidney, E. Appella, R.W. Chesnut, D.I. Watkins, and A. Sette. 2000. Conserved MHC class I peptide binding motif between humans and rhesus macaques. J. Immunol. 164:283291.
37 Sidney, J., S. Southwood, C. Oseroff, M.F. Del Guercio, A. Sette, and H. Grey. 1998. Measurement of MHC/peptide interactions by gel filtration. Current Protocols in Immunology. John Wiley & Sons, Inc., Hoboken, NJ. 18.13.1118.13.19.
38 Vremec, D., M. Zorbas, R. Scollay, D.J. Saunders, C.F. Ardavin, L. Wu, and K. Shortman. 1992. The surface phenotype of dendritic cells purified from mouse thymus and spleen: investigation of the CD8 expression by a subpopulation of dendritic cells. J. Exp. Med. 176:4758.
39 Basta, S., W. Chen, J.R. Bennink, and J.W. Yewdell. 2002. Inhibitory effects of cytomegalovirus proteins US2 and US11 point to contributions from direct priming and cross-priming in induction of vaccinia virus-specific CD8+ T cells. J. Immunol. 168:54035408.
40 McCraith, S., T. Holtzman, B. Moss, and S. Fields. 2000. Genome-wide analysis of vaccinia virus protein-protein interactions. Proc. Natl. Acad. Sci. USA. 97:48794884.
41 Vitiello, A., L. Yuan, R.W. Chesnut, J. Sidney, S. Southwood, P. Farness, M.R. Jackson, P.A. Peterson, and A. Sette. 1996. Immunodominance analysis of CTL responses to influenza PR8 virus reveals two new dominant and subdominant Kb-restricted epitopes. J. Immunol. 157:55555562.[Abstract]
42 Sette, A., J. Sidney, M.-F. Del Guercio, S. Southwood, J. Ruppert, C. Dahlberg, H.M. Grey, and R.T. Kudo. 1994. Peptide binding to the most frequent HLA-A class I alleles measured by quantitative molecular binding assays. Mol. Immunol. 31:813822.[CrossRef][Medline]
43 Upton, C., S. Slack, A.L. Hunter, A. Ehlers, and R.L. Roper. 2003. Poxvirus orthologous clusters: toward defining the minimum essential poxvirus genome. J. Virol. 77:75907600.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|