|
||
Address correspondence to Christopher C. Goodnow, John Curtin School of Medical Research, Mills Rd., P.O. Box 334, The Australian National University, Canberra 2601, Australia. Phone: 61-2-6125-3621; Fax: 61-2-6125-8512; email: Chris.Goodnow{at}anu.edu.au
| Abstract |
|---|
|
|
|---|
Key Words: diabetes mellitus type I autoimmune diseases clonal deletion immune tolerance thymus
| Introduction |
|---|
|
|
|---|
A major advance establishing the significance of thymic tolerance to organ-specific gene products has come through the study of autoimmune polyendocrine syndrome 1 (APS1), a rare monogenic human disorder caused by homozygous mutations in autoimmune regulator (AIRE; references 20 and 21). Clinical manifestations of APS1 include a constellation of organ-specific autoimmune diseases (22). Autoimmune thyroid disease occurs as part of the spectrum in
13% of APS1 patients, and type 1 diabetes is present at a similar rate, potentially dependent on the MHC. The Aire protein localizes in nuclear speckles (23, 24), interacts with CBP (transcriptional coactivator CREB-binding protein; reference 25), and is able to activate transcription in luciferase assays (25, 26). Aire is expressed most highly in scattered thymic medullary epithelial cells (23, 27, 28). Aire knockout mice develop a range of organ-specific autoimmune manifestations comparable to human APS1 (27, 29). Anderson et al. (29) showed that autoimmunity is conferred by transplantation of an Aire-deficient thymus, and thymic medullary epithelial cells isolated from Aire knockout mice had lost promiscuous expression of a large number of organ-specific mRNAs including proinsulin mRNA. Liston et al. (30) showed that the thymus in Aire knockout mice had lost the ability to delete high avidity CD4+ T cells recognizing a transgenic antigen controlled by the insulin promoter.
So far, no information exists regarding Aire's role in thymic expression of thyroid-specific antigens, despite the fact that autoimmune thyroid disease is the most common autoimmune disease and subclinical thyroiditis occurs in up to 10% of women. Moreover, it is unknown if Aire-dependent thymic deletion is a well-buffered process that is only disrupted in this rare monogenic autoimmune disease, or alternatively, if it is a process prone to failure through the actions of more subtle, quantitative reductions in the pathway as are more likely to occur in common polygenic autoimmune diseases. Here, we show that Aire is essential for thymic expression and thymic deletion to antigen under islet- and thyroid-specific promoters, but not under a systemic promoter, and that Aire-induced elimination of forbidden clones of organ-specific cells is exquisitely sensitive to small functional reductions.
| Materials and Methods |
|---|
|
|
|---|
Immunofluorescence Analysis.
Rat anti-AIRE mAbs were produced in the Monoclonal Antibody Facility at Walter and Eliza Hall Institute of Medical Research by standard polyethylene glycol fusion. Clone 5H12 (IgG2c) was generated to a 21amino acid peptide corresponding to the 20 COOH-terminal amino acids of Aire with a C residue at the NH2 terminus for KLH conjugation. Thymi frozen in OCT compound were sectioned (8 µm), stained with rat anti-Aire mAb and rabbit anti-cytokeratin (DakoCytomation), followed by Alexa 488 antirat IgG and Alexa 568conjugated antirabbit IgG, and mounted with fluorescent mounting medium (DakoCytomation). Images were acquired on a confocal microscope (MRC 1024; Bio-Rad Laboratories) with a three-line Kr/Ar laser (excitation lines 488, 568, and 647 nm).
HEL Expression on Pancreatic ß Cells and in Serum.
Pancreatic islets were extracted from mice using a protocol modified from Bowen et al. (35), by infusing the common bile duct with Liberase R1 (Boehringer) and hand-picking islets. From purified islets, a single cell suspension was prepared by incubation with 0.25% trypsin (Boehringer) in HBSS at 37°C for 10 min, and stained with HyHEL9-tricolor. Serum HEL measurement was performed by capture on Ig-HEL-Tg spleen cells (36), staining with HyHEL9-tricolor (37), and flow cytometry as described in Zhang et al. (38).
Thymic Stroma Preparation.
Thymic stroma was enriched from the thymus of 612-wk-old transgenic mice as described previously (39). After enzymatic enrichment, CD45 thymic stromal cells were purified using CD45 microbeads (Miltenyi Biotec) and the AutoMACS system (Miltenyi Biotec), as per the manufacturer's recommendations. Purity was >98% as assessed by staining with FITC-conjugated anti-CD45.2 (clone 104; BD Biosciences).
HEL mRNA Measurement.
RNA was purified using the Trizol reagent (Invitrogen) and reverse transcribed into cDNA using oligo-dT and Superscript III (Invitrogen), as per the manufacturer's recommendations. Quantitative real-time PCR was performed using the Applied Biosystems Sybr Green master-mix system, primers for HEL (caacacccaggctacaaacc and gtttccatcgctgacgatct), insulin I (aaaggctctttacctggtgtgtgg and actgatccacaatgccacgcttct), or ß actin (cgtgaaaagatgacccagatca and tggtacgaccagaggcatacag), and an ABI SDS7700 real-time PCR analyzer (Applied Biosystems). Cycle conditions were as follows: HEL: 95°C for 15 min followed by 40 cycles at 94°C for 15 s, 65°C for 30 s, and 72°C for 30 s; ß actin/insulin: 95°C 15 min followed by 40 cycles at 94°C for 15 s, 60°C for 30 s, and 72°C for 30 s. Units of relative expression were calculated using the exponential of the difference in the cycle number at which the HEL and ß actin reactions crossed the threshold value, relative to the nontransgenic sample.
Flow Cytometry.
612-wk-old mice were analyzed as described previously (40) using the following antibodies: 1G12 anti-clonotype (41) culture supernatant followed by rat antimouse IgG1 allophycocyanin; antiCD8
-PerCP; antiCD4-FITC or PE, antiCD3-PE, and antiCD69-PE (all from BD Biosciences); and antiCD5-FITC and antiCD25-PE (both from Caltag). Pancreatic islet cells were stained using HyHEL9-TC (purified and conjugated in our laboratory), with ß islet cells distinguished by forward and side scatter.
Diabetes Incidence Study.
Urine glucose was tested using Testape/Glucostix at biweekly intervals or when the cage was wet. Mice with two successive positive Testapes were called diabetic, killed, and diabetes was confirmed by blood glucose measurement using a standard glucometer. Nondiabetic mice were culled at 24 wk. From each mouse, the pancreas was fixed in 10% formalin, paraffin embedded, and stained with hematoxylin and eosin.
Statistical Analysis.
A Student's t test was used for all statistical analyses referred to in the text, except for the diabetes incidence study, which was analyzed by a log rank test and fitting to the cox proportional hazards model. Results were considered significant if P < 0.05.
| Results |
|---|
|
|
|---|
|
|
|
Impact of Aire Dose-dependent Thymic Activation of the Insulin Promoter on Thymic Deletion.
Next, we asked whether or not the intermediate decrease in thymic HEL mRNA in heterozygous Aire+/0 insHEL transgenic mice had any significant impact on the efficiency of thymic deletion. A large cohort of Aire mutant and control mice were bred to be doubly transgenic for the insHEL transgene and the 3A9 TCR transgene, which causes most developing T cells to carry a well-characterized TCR recognizing HEL46-61/I-Ak. HEL-reactive T cells were tracked through thymic development using a clonotypic antibody to the 3A9 TCR, 1G12, and a variety of developmental markers (Figs. 4 6). The results of this analysis showed a profound defect in thymic deletion in Aire-null homozygotes and an intermediate defect in Aire heterozygotes, thus mirroring the mRNA data. By staining for the most mature subset of CD4+ CD8 1G12hi CD69 thymocytes (Fig. 4 B), the number of cells in this subset was dramatically reduced in B10.Br double transgenic thymus to 3% of those in TCR-only controls with no insHEL transgene (Fig. 5 B). Mutation of one or both Aire copies interfered with deletion of mature cells, their frequencies rising 370% in Aire+/0 (P < 0.005 vs. B10.Br double transgenic mice) and 1,900% in Aire0/0 mice (P < 1011 vs. B10.Br double transgenic mice) compared with Aire+/+ controls.
|
|
|
Consequence of Heterozygous or Homozygous Aire Mutation on Circulating Islet-reactive T Cells and Diabetes.
The defective negative selection in the thymus of Aire+/0 and Aire0/0 insHEL double transgenic mice is accompanied by higher numbers of HEL-reactive CD4+ T cells in the spleen compared with B10.Br (Aire+/+) double transgenic mice (Figs. 4 C and 5 C). Compared with double transgenic control mice, the frequency of 1G12+ CD4+ cells was increased by 300% in Aire+/0 mice (P < 0.0005) and 700% in Aire0/0 mice (P < 106). The small number of HEL-reactive CD4+ T cells that escape thymic deletion in control insHEL double transgenic mice initiate subclinical insulitis. Comparable insulitis was also observed in Aire+/0 and Aire0/0 double transgenic mice (unpublished data). In the presence of both functioning copies of Aire, this insulitis rarely progresses to autoimmune diabetes (24% for B10.Br insHEL double transgenic mice and 23% for Aire+/+ sibling insHEL double transgenic mice). However, loss of a single copy of Aire increased the diabetes incidence in insHEL:TCR mice to 55%. Diabetes incidence rose to 67% in mice missing both copies of Aire (Fig. 7).
|
|
40% of Aire mutant double transgenic animals die between birth and weaning. The fact that the losses are confined to mice with high frequencies of islet-reactive T cells makes it likely that mortality is due to acute insulin deficiency, although the rapid cannibalism makes it difficult to determine the cause of death.
Essential Role for Aire in Thymic Tolerance to Thyroid-specific Antigen.
Because the action of Aire in tolerance to thyroid-specific or systemic autoantigens is not known, we next investigated how complete or partial Aire deficiency affected thymic deletion in transgenic mice expressing HEL controlled by the thyroglobulin (TgHEL) or H-2Kb (H-2kHEL) promoters. 3A9 TCR transgenic Aire0/0 mice were bred to the TgHEL and H-2kHEL strains, and progeny were backcrossed to produce Aire0/0 and Aire+/0 double transgenic mice. The TgHEL transgenic strain produces membrane-bound HEL protein at high levels in the thyroid epithelium, undetectable levels of sHEL present in the circulation (32, 33), and protein expression is readily detected by immunofluorescence in scattered thymic epithelial cells, primarily in the medulla (unpublished data). Interestingly, detectable levels of endogenous thyroglobulin mRNA have been detected in cortical epithelial cells, albeit at lower levels than medullary epithelial cells (42). It is unknown whether cortical transcripts of endogenous thyroglobulin are productive and tolerogenic. The H-2kHEL strain expresses membrane-bound HEL in all tissues, with high expression on radioresistant cells and thymocytes (34).
In the thymus of Aire+/+ TgHEL:TCR mice, double positive (DP) and single positive (SP) cells were deleted to a greater degree than in corresponding insHEL double transgenic mice (Figs. 4, A and B, and 5, A and B), consistent with higher levels of HEL protein in thymic medullary epithelial cells of TgHEL mice. Thymic deletion in TgHEL double transgenic mice was completely abolished by homozygous loss of Aire, so that the number of CD4+ CD8+ DP cells and CD4+ CD8 1G12hi CD69 mature thymocytes became indistinguishable from TCR transgenic controls with no HEL transgene (Fig. 5, A and B). Peripheral CD4+ T cells bearing the HEL-reactive TCR were also greatly increased in Aire0/0 TgHEL double transgenic mice (Fig. 5 C), although not attaining the levels of TCR-only controls presumably because of peripheral tolerance mechanisms that are Aire independent. In Aire+/0 heterozygotes, thymic deletion of DP cells was also significantly less efficient, with DP cell numbers intermediate between Aire+/+ and Aire0/0 TgHEL double transgenic counterparts (Fig. 5 A). Although the loss of one copy of Aire decreased the efficiency of deletion to TgHEL, the process nevertheless reached completion during the progression from DP to mature CD4+ CD8 1G12hi CD69 cells (Fig. 5 B) because these were reduced to 0.9% of TCR control numbers in Aire+/0 animals (compared with 0.4% of TCR controls in Aire+/+ TgHEL double transgenic mice).
In contrast to the striking failure of thymic deletion to antigen controlled by islet- or thyroid-specific promoters, Aire deficiency had no effect on thymic deletion toward the systemically expressed H-2kHEL (Figs. 4 and 5). It is unlikely that this reflects saturation of thymic deletion in these double transgenic mice, as a marked increase in DP cells in H-2KHEL double transgenic mice occurs when thymic deletion is impaired by non-MHC genes from the nonobese diabetic strain yields (unpublished data).
| Discussion |
|---|
|
|
|---|
The data here provide direct evidence that Aire's primary function is to induce ectopic expression of organ-specific gene products in thymic medullary epithelium, but not in the peripheral organ or other ectopic sites. The data establish that the thymic activity of Aire crosses the species barrier between rat and mouse and that sequences within the 600-bp insulin promoter fragment are sufficient for this activity. The ß cellspecific transcription factor Pdx-1 binds to elements within this insulin promoter fragment and plays a key role in promoting expression in pancreatic islet ß cells. Ectopic expression of Pdx-1 in Isl-1overexpressing cells is sufficient to activate insulin gene expression in other epithelial cell types (43). The Aire-induced activity of the promoter in the thymus suggests the following two testable hypotheses: (a) Aire substitutes for Pdx-1 in the thymus, or (b) Aire acts by inducing Pdx-1 in thymic epithelial cells.
The data establish a critical role for Aire in thymic deletion to thyroid-specific gene products. Transgenic mice carrying HEL antigen controlled by the thyroglobulin promoter display higher levels of antigen in thymic medullary epithelium, and thymic deletion is concomitantly much greater than in corresponding insHEL animals. Despite this greater activity in Aire+/+ animals, thymic deletion was more completely abolished by homozygous loss of Aire (Figs. 4 and 5). This finding explains the high incidence of thyroiditis and thyroglobulin-specific autoantibodies in APS1 patients (44) and Aire-deficient mice (29). In contrast, thymic deletion to HEL controlled by the H-2K promoter was entirely unaffected by loss of Aire. There are two possible interpretations of this result: (a) Any role for Aire in epithelial differentiation or antigen presentation might be masked in these animals by the high levels of expression or expression on nonepithelial cells, or (b) the function of Aire is limited solely to inducing organ-specific mRNAs in thymic medullary epithelium. Although we cannot exclude the first possibility, the latter is favored by the data here and by evidence that thymic deletion to the H-2Kcontrolled antigen is not saturated based on its sensitivity to genetic defects caused by non-MHC genes from the nonobese diabetic mouse (unpublished data).
Based on the strictly recessive inheritance pattern of APS1, it might have been concluded that Aire-induced thymic deletion is an efficient, highly buffered mechanism that is only disrupted in rare individuals homozygous for severe loss of function mutations. The findings here show that this tolerance mechanism is in fact prone to failure as a result of small quantitative genetic effects. Heterozygosity for the targeted Aire mutation caused a marked decrease in thymic expression of the insulin promoter construct and the endogenous insulin promoter, indicating a semi-dominant effect at this level of gene action. The targeted allele truncates the encoded Aire protein at amino acid 218 at the end of exon 5 with a neomycin cassette eliminating exon 6 (27), thus mirroring the most frequent human R257X nonsense mutation. The targeted allele nevertheless appears to be a null mutation because immunohistochemical staining of homozygous mutant tissues failed to detect immunoreactivity with a polyclonal antibody raised to a segment encoded by exon 4 (27). Nevertheless, it cannot be ruled out that the residual fragment might have a subtle dominant negative effect because the NH2-terminal portion is stable in vitro (unpublished data) and contains a nuclear localization signal and an HRS/ASS domain responsible for homodimerization. The immunofluorescence analysis of heterozygotes shown in Fig. 1 establishes that the reduced insulin promoter activity is not due to a reduction in numbers of Aire-expressing cells, but may reflect a reduction in the amount of Aire protein per cell.
The Aire gene dosagedependent loss of insHEL mRNA in the thymus was mirrored by a semi-dominant failure of thymic deletion in insHEL:3A9 TCR double transgenic animals, resulting in a 300% increase in HEL-specific CD4 T cells escaping the thymus in heterozygotes and a 700% increase in homozygotes (Fig. 5 C). The fact that thymic deletion efficiency parallels insHEL mRNA expression in thymic epithelial cells argues that the primary role of Aire is to induce thymic expression of organ-specific mRNAs, rather than an indirect role in antigen presentation by these cells. The demonstration of gene dosedependent effects on thymic expression of the endogenous insulin gene, and on thymic deletion induced by the thyroglobulin promoter, excludes the possibility that the transgene is uniquely sensitive to gene dose because of insertion site or elements missing from the promoter fragment, and indicates that dosage sensitivity is likely to be a general characteristic of Aire-induced thymic expression.
The peripheral consequence of this semi-dominant defect in thymic deletion was a clear increase in susceptibility to autoimmune islet destruction in insHEL:3A9 TCR double transgenic mice. The occurrence of diabetes in Aire heterozygous double transgenic mice (55%) appears to be intermediate between that of the Aire0/0 mice (65%) and of wild-type controls (25%). However, although the incidence in both the heterozygous and knockout strains are significantly greater than that of wild-type siblings, demonstrating the exquisite sensitivity of thymic tolerance to small changes in Aire expression, the difference between the Aire+/0 and Aire0/0 strains is not significant. One interpretation of this result is that susceptibility to diabetes in this model follows a bipolar distribution rather than a linear progression, and that the "autoimmune threshold" has already been crossed by the loss of one copy of Aire. Preweaning mortality is elevated in Aire+/0 and Aire0/0 double transgenic animals (Table I), and although the basis for mortality could not be determined, the fact that it is concentrated exclusively in the double transgenic pups, where there are very large numbers of islet-reactive CD4+ T cells made in the thymus, suggests an autoimmune basis for these neonatal deaths. Although this is the simplest interpretation of the data, we nevertheless cannot exclude more complicated explanations such as increased frequency of cyotoxic T cells or failure of regulatory T cells. It is striking that the Aire mutation acts semi-dominantly in terms of thymic expression, thymic deletion, and autoimmunity in the sensitized background of insHEL:3A9 TCR double transgenic mice. It is likely that the direction of the immune system against the pancreas results in borderline autoimmunity, where even a small failure in thymic deletion is able to induce the cascade to autoimmunity.
Aire heterozygosity had contrasting effects on thymic deletion induced by insulin- or thyroglobulin-regulated HEL, indicating that quantitative changes in Aire activity may only allow increasing numbers of T cells to escape deletion within a defined "risk zone" of TCR avidity and thymic peptide/MHC density. Thymic expression in Aire+/0 insHEL animals falls below levels needed to prevent escape of 3A9 T cells to the periphery. In comparison, more HEL is expressed in the thymus of TgHEL animals, and although thymic deletion of DP cells is markedly less efficient in TgHEL Aire+/0 heterozygotes than in Aire+/+ counterparts (Fig. 5 A), it nevertheless remains more efficient than in the DP compartment of Aire+/+ insHEL animals. At the TCRhi CD69 CD4 SP stage, thymic deletion in TgHEL Aire heterozygotes has progressed to levels comparable to wild-type controls. This contrast suggests that deletion to organ-specific antigens depends on probabilistic contacts with rare cells displaying sufficient autoantigen to induce apoptosis. When antigen/MHC densities fall, the frequency of apoptosis-inducing contacts falls proportionally as reflected in the intermediate reduction in DP cells in TgHEL Aire+/0 thymi. However, it is only when antigen/MHC densities lie within a limiting risk zone, as exists in insHEL:3A9 TCR animals, that the frequency of above threshold contacts falls so low that significant numbers of high avidity T cells successfully complete their maturation and escape the thymus. The comparatively long process of T cell positive selection and maturation in the thymic medulla may exist primarily to maximize the chance of rare apoptosis-inducing contacts and thus minimize the effects of quantitative variation in Aire-induced expression of organ-specific antigens.
Based on the data of Anderson et al. (29) and for the thyroglobulin promoter here, a large number of organ-specific gene products are likely to depend on Aire for thymic expression. For each of these there will be a range of potential epitopes, depending on the MHC haplotype, and a diversity of TCR avidities produced in the thymus against each of these peptide/MHC epitopes. Hence, it seems likely that appreciable numbers of forbidden clones in any individual may fall into the risk zone for the quantitative defects in thymic deletion observed in the insHELx3A9TCR combination. Consistent with this view, the strongest inherited susceptibility locus in human type 1 diabetes other than the MHC maps to a common variant of the insulin gene promoter that decreases thymic expression by two- to threefold (18, 19). Similarly, mice with fewer copies of the proinsulin gene and lower thymic proinsulin mRNA display heightened spontaneous T cell reactivity to proinsulin in vitro (18, 19, 45). Although differences in insulin promoter efficiency could act directly on ß cells by forcing them to compensate, leading to ß cell stress and autoimmunization, the data here provide a firm basis for the view that subtle reductions in thymic insulin mRNA may indeed increase the frequency of insulin-reactive T cells escaping thymic deletion and predispose to diabetes. Along similar lines, mice missing one copy of the myelin protein P0 gene have half the normal P0 mRNA in the thymus and exhibit heightened in vitro T cell recall responses that are determined by the thymus P0 genotype in grafting experiments (46). Finally, there is an intermediate effect of myelin basic protein gene heterozygosity on thymic deletion at specific ages in transgenic mice expressing a high avidity myelin basic proteinreactive TCR (47). The findings here draw these different observations together by showing that the specialized process of Aire-induced thymic deletion to organ-specific gene products is exquisitely sensitive to quantitative perturbations.
The sensitivity of the Aire-induced deletion process to quantitative effects establishes this pathway as a prime target for quantitative trait genes, providing a firm biological basis to guide the design of future gene association studies in more common organ-specific autoimmune diseases. The original studies analyzing the penetrance of APS1 found no evidence for polyendocrine disease in heterozygotes, as an analysis of 58 patients showed a sibling penetrance of 2425%, consistent with a fully recessive inheritance (48), although there are reports of patients with mutations in both copies of AIRE and autoimmunity, but without the full APS1 clinical disease (49). It is therefore unlikely that mutation in a single copy of AIRE can be sufficient to lead to the unique clinical manifestations in APS1 syndrome. However, no direct studies have been done on the incidence of single autoimmune diseases in human heterozygotes for AIRE mutations, although there are anecdotal reports of autoimmunity that do not meet the criteria for APS1 in AIRE heterozygotes (50). The only systematic evaluation of carriers of AIRE mutations analyzed eight parents of APS1 patients and found that five had subclinical immune disorders (51).
Moderate elevation in the frequency of forbidden clones escaping the thymus, as observed here in Aire heterozygotes, may alone be insufficient to precipitate the MHC-independent polyendocrine autoimmune disease typical of APS1, but may nevertheless be sufficient to precipitate single autoimmune diseases in conjunction with other susceptibility factors. Additive interactions between genetic loci are difficult to detect by genome-wide scans without a specific hypothesis because of the problems of correction for multiple testing and complicating effects of population stratification. Based on the growing understanding of the pathway for thymic deletion to organ-specific antigens, the data here provide a firm basis for testing specific interactions between candidate genes, including Aire, polymorphisms in organ-specific genes such as insulin (18, 19), MHC haplotypes that may present specific autoantigens less efficiently, variants in genes that modulate TCR signaling or TCR apoptosis induction such as CD28, CTLA4, or Bim, and other yet to be defined components of the Aire-induced thymic deletion pathway. By the same token, it is reasonable to predict that a relatively modest increase in AIRE activity, if this could be induced by some means, would markedly lower the incidence of type 1 diabetes and other organ-specific autoimmune diseases even in individuals with wild-type AIRE. For both of these reasons, it will be important for future work to define the other components in the pathway for AIRE-induced thymic deletion.
| Acknowledgments |
|---|
A. Liston is a recipient of an Australian Postgraduate Award. S. Lesage is a recipient of a Canadian Institutes of Heath Research scholarship. We acknowledge the funding for the Center of Excellence of Disease Genetics of the Academy of Finland and the Sigrid Juselius Foundation. This work was supported by grants from the Juvenile Diabetes Research Foundation and the National Health and Medical Research Council.
The authors have no conflicting financial interests.
Submitted: 25 March 2004
Accepted: 24 August 2004
| References |
|---|
|
|
|---|
1 Ohashi, P.S., S. Oehen, K. Buerki, H. Pircher, C.T. Ohashi, B. Odermatt, B. Malissen, R.M. Zinkernagel, and H. Hengartner. 1991. Ablation of "tolerance" and induction of diabetes by virus infection in viral antigen transgenic mice. Cell. 65:305317.[CrossRef][Medline]
2 Hernandez, J., S. Aung, W.L. Redmond, and L.A. Sherman. 2001. Phenotypic and functional analysis of CD8+ T cells undergoing peripheral deletion in response to cross-presentation of self-antigen. J. Exp. Med. 194:707717.
3 Lambolez, F., K. Jooss, F. Vasseur, and A. Sarukhan. 2002. Tolerance induction to self antigens by peripheral dendritic cells. Eur. J. Immunol. 32:25882597.[CrossRef][Medline]
4 Greenwald, R.J., V.A. Boussiotis, R.B. Lorsbach, A.K. Abbas, and A.H. Sharpe. 2001. CTLA-4 regulates induction of anergy in vivo. Immunity. 14:145155.[CrossRef][Medline]
5 Shevach, E. 2002. CD4+CD25+ suppressor T cells: more questions than answers. Nat. Rev. Immunol. 2:389400.[Medline]
6 Le Douarin, N., C. Corbel, A. Bandeira, V. Thomas-Vaslin, Y. Modigliani, A. Coutinho, and J. Salaun. 1996. Evidence for a thymus-dependent form of tolerance that is not based on elimination or anergy of reactive T cells. Immunol. Rev. 149:3553.[CrossRef][Medline]
7 Fritz, R.B., and M.L. Zhao. 1996. Thymic expression of myelin basic protein (MBP). Activation of MBP-specific T cells by thymic cells in the absence of exogenous MBP. J. Immunol. 157:52495253.[Abstract]
8 Kojima, K., M. Reindl, H. Lassmann, H. Wekerle, and C. Linington. 1997. The thymus and self-tolerance: co-existence of encephalitogenic S100 beta-specific T cells and their nominal autoantigen in the normal adult rat thymus. Int. Immunol. 9:897904.
9 Kirchner, T., S. Tzartos, F. Hoppe, B. Schalke, H. Wekerle, and H.K. Muller-Hermelink. 1988. Pathogenesis of myasthenia gravis. Acetylcholine receptor-related antigenic determinants in tumor-free thymuses and thymic epithelial tumors. Am. J. Pathol. 130:268280.[Abstract]
10 Egwuagu, C.E., P. Charukamnoetkanok, and I. Gery. 1997. Thymic expression of autoantigens correlates with resistance to autoimmune disease. J. Immunol. 159:31093112.[Abstract]
11 Martens, H., B. Goxe, and V. Geenen. 1996. The thymic repertoire of neuroendocrine self-antigens: physiological implications in T-cell life and death. Immunol. Today. 17:312317.[CrossRef][Medline]
12 Hanahan, D. 1998. Peripheral-antigen-expressing cells in thymic medulla: factors in self-tolerance and autoimmunity. Curr. Opin. Immunol. 10:656662.[CrossRef][Medline]
13 Heath, V.L., N.C. Moore, S.M. Parnell, and D.W. Mason. 1998. Intrathymic expression of genes involved in organ specific autoimmune disease. J. Autoimmun. 11:309318.[CrossRef][Medline]
14 Werdelin, O., U. Cordes, and T. Jensen. 1998. Aberrant expression of tissue-specific proteins in the thymus: a hypothesis for the development of central tolerance. Scand. J. Immunol. 47:95100.[CrossRef][Medline]
15 Sospedra, M., X. Ferrer-Francesch, O. Dominguez, M. Juan, M. Foz-Sala, and R. Pujol-Borrell. 1998. Transcription of a broad range of self-antigens in human thymus suggests a role for central mechanisms in tolerance toward peripheral antigens. J. Immunol. 161:59185929.
16 Klein, L., M. Klugmann, K.A. Nave, V.K. Tuohy, and B. Kyewski. 2000. Shaping of the autoreactive T-cell repertoire by a splice variant of self protein expressed in thymic epithelial cells. Nat. Med. 6:5661.[CrossRef][Medline]
17 Anderson, A.C., L.B. Nicholson, K.L. Legge, V. Turchin, H. Zaghouani, and V.K. Kuchroo. 2000. High frequency of autoreactive myelin proteolipid protein-specific T cells in the periphery of naive mice: mechanisms of selection of the self-reactive repertoire. J. Exp. Med. 191:761770.
18 Vafiadis, P., S.T. Bennett, J.A. Todd, J. Nadeau, R. Grabs, C.G. Goodyer, S. Wickramasinghe, E. Colle, and C. Polychronakos. 1997. Insulin expression in human thymus is modulated by INS VNTR alleles at the IDDM2 locus. Nat. Genet. 15:289292.[CrossRef][Medline]
19 Pugliese, A., M. Zeller, A. Fernandez Jr., L.J. Zalcberg, R.J. Bartlett, C. Ricordi, M. Pietropaolo, G.S. Eisenbarth, S.T. Bennett, and D.D. Patel. 1997. The insulin gene is transcribed in the human thymus and transcription levels correlated with allelic variation at the INS VNTR-IDDM2 susceptibility locus for type 1 diabetes. Nat. Genet. 15:293297.[CrossRef][Medline]
20 Nagamine, K., P. Peterson, H.S. Scott, J. Kudoh, S. Minoshima, M. Heino, K.J. Krohn, M.D. Lalioti, P.E. Mullis, S.E. Antonarakis, et al. 1997. Positional cloning of the APECED gene. Nat. Genet. 17:393398.[CrossRef][Medline]
21 The Finnish-German APECED Consortium. 1997. An autoimmune disease, APECED, caused by mutations in a novel gene featuring two PHD-type zinc-finger domains. Nat. Genet. 17:399403.[CrossRef][Medline]
22 Betterle, C., N.A. Greggio, and M. Volpato. 1998. Clinical review 93: autoimmune polyglandular syndrome type 1. J. Clin. Endocrinol. Metab. 83:10491055.
23 Heino, M., P. Peterson, J. Kudoh, K. Nagamine, A. Lagerstedt, V. Ovod, A. Ranki, I. Rantala, M. Nieminen, J. Tuukkanen, et al. 1999. Autoimmune regulator is expressed in the cells regulating immune tolerance in thymus medulla. Biochem. Biophys. Res. Commun. 257:821825.[CrossRef][Medline]
24 Heino, M., P. Peterson, N. Sillanpaa, S. Guerin, L. Wu, G. Anderson, H.S. Scott, S.E. Antonarakis, J. Kudoh, N. Shimizu, et al. 2000. RNA and protein expression of the murine autoimmune regulator gene (Aire) in normal, RelB-deficient and in NOD mouse. Eur. J. Immunol. 30:18841893.[CrossRef][Medline]
25 Pitkanen, J., V. Doucas, T. Sternsdorf, T. Nakajima, S. Aratani, K. Jensen, H. Will, P. Vahamurto, J. Ollila, M. Vihinen, et al. 2000. The autoimmune regulator protein has transcriptional transactivating properties and interacts with the common coactivator CREB-binding protein. J. Biol. Chem. 275:1680216809.
26 Bjorses, P., M. Halonen, J.J. Palvimo, M. Kolmer, J. Aaltonen, P. Ellonen, J. Perheentupa, I. Ulmanen, and L. Peltonen. 2000. Mutations in the AIRE gene: effects on subcellular location and transactivation function of the autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy protein. Am. J. Hum. Genet. 66:378392.[CrossRef][Medline]
27 Ramsey, C., O. Winqvist, L. Puhakka, M. Halonen, A. Moro, O. Kampe, P. Eskelin, M. Pelto-Huikko, and L. Peltonen. 2002. Aire deficient mice develop multiple features of APECED phenotype and show altered immune response. Hum. Mol. Genet. 11:397409.
28 Bjorses, P., M. Pelto-Huikko, J. Kaukonen, J. Aaltonen, L. Peltonen, and I. Ulmanen. 1999. Localization of the APECED protein in distinct nuclear structures. Hum. Mol. Genet. 8:259266.
29 Anderson, M.S., E.S. Venanzi, L. Klein, Z. Chen, S. Berzins, S.J. Turley, H. Von Boehmer, R. Bronson, A. Dierich, C. Benoist, and D. Mathis. 2002. Projection of an immunological self-shadow within the thymus by the Aire protein. Science. 298:13951401.
30 Liston, A., S. Lesage, J. Wilson, L. Peltonen, and C.C. Goodnow. 2003. Aire regulates negative selection of organ-specific T cells. Nat. Immunol. 4:350354.[CrossRef][Medline]
31 Ho, W.Y., M.P. Cooke, C.C. Goodnow, and M.M. Davis. 1994. Resting and anergic B cells are defective in CD28-dependent costimulation of naive CD4+ T cells. J. Exp. Med. 179:15391549.
32 Akkaraju, S., W.Y. Ho, D. Leong, K. Canaan, M.M. Davis, and C.C. Goodnow. 1997. A range of CD4 T cell tolerance: partial inactivation to organ-specific antigen allows nondestructive thyroiditis or insulitis. Immunity. 7:255271.[CrossRef][Medline]
33 Akkaraju, S., K. Canaan, and C.C. Goodnow. 1997. Self-reactive B cells are not eliminated or inactivated by autoantigen expressed on thyroid epithelial cells. J. Exp. Med. 186:20052012.
34 Hartley, S.B., J. Crosbie, R. Brink, A.B. Kantor, A. Basten, and C.C. Goodnow. 1991. Elimination from peripheral lymphoid tissues of self-reactive B lymphocytes recognizing membrane-bound antigens. Nature. 353:765769.[CrossRef][Medline]
35 Bowen, K.M., L. Andrus, and K.J. Lafferty. 1980. Successful allotransplantation of mouse pancreatic islets to nonimmunosuppressed recipients. Diabetes. 29:98104.
36 Goodnow, C.C., J. Crosbie, S. Adelstein, T.B. Lavoie, S.J. Smith-Gill, R.A. Brink, H. Pritchard-Briscoe, J.S. Wotherspoon, R.H. Loblay, K. Raphael, et al. 1988. Altered immunoglobulin expression and functional silencing of self-reactive B lymphocytes in transgenic mice. Nature. 334:676682.[CrossRef][Medline]
37 Smith-Gill, S.J., A.C. Wilson, M. Potter, E.M. Prager, R.J. Feldmann, and C.R. Mainhart. 1982. Mapping the antigenic epitope for a monoclonal antibody against lysozyme. J. Immunol. 128:314322.[Abstract]
38 Zhang, M., M.S. Vacchio, B.P. Vistica, S. Lesage, C.E. Egwuagu, C.R. Yu, M.P. Gelderman, M.C. Kennedy, E.F. Wawrousek, and I. Gery. 2003. T cell tolerance to a neo-self antigen expressed by thymic epithelial cells: the soluble form is more effective than the membrane-bound form. J. Immunol. 170:39543962.
39 Gray, D.H., A.P. Chidgey, and R.L. Boyd. 2002. Analysis of thymic stromal cell populations using flow cytometry. J. Immunol. Methods. 260:1528.[CrossRef][Medline]
40 Lesage, S., S.B. Hartley, S. Akkaraju, J. Wilson, M. Townsend, and C.C. Goodnow. 2002. Failure to censor forbidden clone of CD4 T cells in autoimmune diabetes. J. Exp. Med. 196:11751188.
41 Van Parijs, L., D.A. Peterson, and A.K. Abbas. 1998. The Fas/Fas ligand pathway and Bcl-2 regulate T cell responses to model self and foreign antigens. Immunity. 8:265274.[CrossRef][Medline]
42 Derbinski, J., A. Schulte, B. Kyewski, and L. Klein. 2001. Promiscuous gene expression in medullary thymic epithelial cells mirrors the peripheral self. Nat. Immunol. 2:10321039.[CrossRef][Medline]
43 Kojima, H., T. Nakamura, Y. Fujita, A. Kishi, M. Fujimiya, S. Yamada, M. Kudo, Y. Nishio, H. Maegawa, M. Haneda, et al. 2002. Combined expression of pancreatic duodenal homeobox 1 and islet factor 1 induces immature enterocytes to produce insulin. Diabetes. 51:13981408.
44 Perniola, R., A. Falorni, M.G. Clemente, F. Forini, E. Accogli, and G. Lobreglio. 2000. Organ-specific and non-organ-specific autoantibodies in children and young adults with autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED). Eur. J. Endocrinol. 143:497503.[Abstract]
45 Chentoufi, A.A., and C. Polychronakos. 2002. Insulin expression levels in the thymus modulate insulin-specific autoreactive T-cell tolerance: the mechanism by which the IDDM2 locus may predispose to diabetes. Diabetes. 51:13831390.
46 Miyamoto, K., S. Miyake, M. Schachner, and T. Yamamura. 2003. Heterozygous null mutation of myelin P0 protein enhances susceptibility to autoimmune neuritis targeting P0 peptide. Eur. J. Immunol. 33:656665.[CrossRef][Medline]
47 Huseby, E.S., B. Sather, P.G. Huseby, and J. Goverman. 2001. Age-dependent T cell tolerance and autoimmunity to myelin basic protein. Immunity. 14:471481.[CrossRef][Medline]
48 Ahonen, P. 1985. Autoimmune polyendocrinopathycandidosisectodermal dystrophy (APECED): autosomal recessive inheritance. Clin. Genet. 27:535542.[Medline]
49 Boe, A.S., P.M. Knappskog, A.G. Myhre, J.I. Sorheim, E.S. Husebye, A. Soderbergh, F. Rorsman, M. Halonen, O. Ekwall, P. Bjorses, and O. Kampe. 2002. Mutational analysis of the autoimmune regulator (AIRE) gene in sporadic autoimmune Addison's disease can reveal patients with unidentified autoimmune polyendocrine syndrome type I. Eur. J. Endocrinol. 146:519522.[Abstract]
50 Buzi, F., R. Badolato, C. Mazza, S. Giliani, L.D. Notarangelo, G. Radetti, and A. Plebani. 2003. Autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy syndrome: time to review diagnostic criteria? J. Clin. Endocrinol. Metab. 88:31463148.
51 Sediva, A., D. Cihakova, and J. Lebl. 2002. Immunological findings in patients with autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED) and their family members: are heterozygotes subclinically affected? J. Pediatr. Endocrinol. Metab. 15:14911496.[Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|