 |
Introduction
|
|---|
The gut serves as a portal of entry for a myriad of pathogens. Several mechanisms of protection have evolved to protect the gut from microbes, including effector T cells and antibody-secreting cells (ASCs). IgA ASCs are of particular importance because IgA antibodies are secreted across the gut epithelium into the intestinal lumen where they can neutralize pathogens and toxins (1, 2). The gastrointestinal tract of the neonate is particularly vulnerable to infection because the newborn is immunologically naive for the first several days of life, until effector T cells and ASCs are generated and disseminated throughout the body.
The adaptive immune system of the mother can provide passive protection to the suckling newborn through antibodies ingested in the mother's milk (3, 4). During late pregnancy and lactation, maternal IgA ASCs primed in the gut and respiratory tract, home to the mammary gland (57), secreting antibody into the milk for passage to the gastrointestinal tract of the nursing neonate (8). Secretory IgA is resistant to gastrointestinal enzymes, allowing the passage of functional IgA through the infant's gastrointestinal tract (9). The transfer of maternal antibodies to the nursing neonate provides transient immune protection to pathogens previously encountered by the mother, and contributes to the dramatically reduced infant mortality levels in children who are breast fed compared with those who are formula fed in developing countries (10).
The participation of chemoattractants in the mammary gland IgA response is suggested by early studies reporting chemotactic activity for IgA ASCs in mouse colostrum (11). It is now clear that chemoattractant cytokines (chemokines) play a vital role in lymphocyte trafficking, and participate as key players in the multistep processes of lymphocyte recruitment from the blood into tissues (12). Recent studies have led to the hypothesis that the epithelial chemokines CCL25 and CCL28 mediate IgA ASC trafficking to gastrointestinal and respiratory mucosal sites (1315). The role of these or other chemokines in IgA ASC migration to the mammary gland has not been examined. In regard to mammary gland homing, CCL28 is a particularly attractive candidate because most IgA ASCs in the body express the CCL28 receptor CCR10, migrate to CCL28 in vitro (13, 14), and CCL28 is found in milk (16).
In this report, we show that CCL28 is up-regulated in the mammary gland during lactation, and demonstrate that antibodies to CCL28 inhibit the accumulation of IgA-producing cells in the mammary gland, providing direct evidence that CCL28 can control local mucosal IgA ASC responses. Finally, we show that CCL28-mediated IgA ASC accumulation is required for efficient transfer of maternal IgA antibodies to the suckling neonate.
 |
Materials and Methods
|
|---|
PCR.
Total RNA was collected from the mammary gland of BALB/c mice (the fourth abdominal mammary gland was used in all experiments) at various stages of pregnancy and lactation using the RNeasy kit (QIAGEN). All PCR reactions were performed using an RNA PCR core kit (Applied Biosystems) according to the manufacturer's recommendations. The following primers were used: CCL28: sense ATGCAGCAAGCAGGGCTCACACTC, antisense ACGAGAGGCTTCGTGCCTGTGTGT; GAPHD: sense CCATGGAGAAGGCTGGGG, antisense CAAAGTTGTCATGGATGACC; CCR10: sense CCCGAAAGCCTCACGCAGACTG, antisense GGAGCAGCCTCCGCAGGTCCCGGCGG; and CCR3: sense TCCACTGTACTCCCTGGTGT, antisense GACTGCAGGAAAACTCTCCA. PCR product was run on a 1.5% agarose gel and visualized with ethidium bromide staining.
Chemotaxis and Cell Staining.
Small intestine lamina propria lymphocytes and mammary gland lymphocytes were isolated by collagenase digestion of the tissue (after removal of Peyer's patches and lymph nodes, respectively) as described previously (14). All tissues were collected from lactating mice 9 d postpartum. Chemotaxis assays were performed and migrated lymphocytes were enumerated using a bead-counting method as described previously (14). IgA ASCs were identified and defined as described previously (14). CCL28Ig binding was performed in the presence of 5 µg normal goat IgG using a mCCL28-hIgG chimera detected with PE-conjugated donkey antihuman IgG (Jackson ImmunoResearch Laboratories) as described previously (14). Negative controls were performed by inhibiting CCL28Ig binding with 5 µg polyclonal goat anti-mCCL28 (R&D Systems). The following rat antimouse antibodies were used for staining: B220 (RA3-6B2), IgA (C10-3), and TCR-ß (H57-597; all from BD Biosciences). Flow cytometry was performed on a FACSCalibur (BD Biosciences) using CELLQuest software.
In Vivo Anti-CCL28 Blockade.
Female BALB/c mice in their first pregnancy were used in all experiments. In antibody-blocking experiments 100 µg of monoclonal anti-CCL28 (R&D Systems) or IgG2b isotype control antibody was injected i.p. on days 1, 3, 5, and 7 postpartum. Mouse milk was collected on days 1 and 9. Anesthetized mice were injected i.p. with 2 U oxytocin (Sigma-Aldrich) and milk was collected using a suction powered milking apparatus, similar to that described previously (17). Milk was then centrifuged at 14,000 RPM for 5 min at room temperature, the fat was discarded, and the whey portion of the milk was stored at 20°C until use.
Immunohistology.
8-µm frozen sections were fixed in cold acetone for 10 min. After drying, slides were stained with FITC-labeled anti-IgA and PE-labeled antiTCR-ß. Staining was visualized using confocal microscopy. IgA staining lymphocytes were counted by photographing random mammary gland sections and visually analyzing photographs for the number of stained cells/field of view. Cell numbers were then scaled to reflect the number of cells/mm2 of mammary gland tissue and data were expressed as mean ± SEM. Multiple tissue sections from each of five mice were examined per treatment group.
ELISA.
ELISA plates (Nunc) were coated with 2 µg/ml of capture antibody diluted in PBS and coated overnight at 4°C. Milk samples were diluted in blocking buffer and incubated in ELISA plates for 2 h at room temperature. Alkaline phosphataseconjugated secondary antibodies were used as detection reagents. Antibody concentrations were determined by constructing a standard curve of known values and calculating the microgram/milliliter of antibody in milk or the microgram/milligram of antibody in feces. Milk from five or more mice was used to determine antibody levels for each treatment group. 18 and 23 neonates were used to determine IgA levels in the feces of pups nursing on control- and anti-CCL28treated mothers, respectively. Data are expressed as mean ± SEM.
Statistical Methods.
Student's t test was used to analyze the results, and P < 0.01 was considered significant.
 |
Results and Discussion
|
|---|
CCL28 Is Up-regulated in the Mammary Gland during Lactation.
Few lymphocytes are present in the mammary glands of virgin mice and IgA ASCs are rare. IgA ASCs begin to appear late in pregnancy and increase dramatically in number soon after the start of lactation. By the third week of lactation, the number of IgA ASCs has increased by several hundredfold (6, 18). We determined if the level of CCL28 expression in the mammary gland correlates with the accumulation of IgA ASCs. In contrast to constitutive mucosal expression reported for salivary gland and colon (19), we found that CCL28 expression in the mammary gland is tightly regulated and intimately associated with the process of lactation. CCL28 message is not detected by semiquantitative RT-PCR in the mammary gland of virgin mice (Fig. 1). CCL28 message is slightly up-regulated during late pregnancy and early lactation, correlating with the beginning of IgA ASC accumulation. Approximately 48 h after the start of lactation, CCL28 expression rises dramatically and high levels of chemokine mRNA are maintained throughout lactation (Fig. 1). This remarkable up-regulation of CCL28 correlates well with the time course of IgA ASC appearance and accumulation.
E. Wilson is supported by a National Research Service Award (5F32HD042356). This work was also supported by National Institutes of Health (grants AI47822 and GM37734), by the FACS Core facility of the Stanford Digestive Disease Center (under DK56339), and a Merit Award from the Veterans Administration to E.C. Butcher.
The authors have no conflicting financial interests.
1 Williams, R.C., and R.J. Gibbons. 1972. Inhibition of bacterial adherence by secretory immunoglobulin A: a mechanism of antigen disposal. Science. 177:697699.[Abstract/Free Full Text]
2 Russell, M.W., M. Kilian, and M.E. Lamm. 1999. Biological activities of IgA. Mucosal Immunology. P.L. Ogra, J. Mestecky, M.E. Lamm, W. Strober, J. Bienenstock, and J.R. McGhee, editors. Academic Press, San Diego. 225240.
3 Holmgren, J., L.A. Hanson, B. Carlson, B.S. Lindblad, and J. Rahimtoola. 1976. Neutralizing antibodies against Escherichia coli and Vibrio cholerae enterotoxins in human milk from a developing country. Scand. J. Immunol. 5:867871.[CrossRef][Medline]
4 Stoliar, O.A., R.P. Pelley, E. Kaniecki-Green, M.H. Kkaus, and C.C. Carpenter. 1976. Secretory IgA against enterotoxins in breast-milk. Lancet. 1:12581261.[Medline]
5 Roux, M.E., M. McWilliams, J.M. Phillips-Quagliata, P. Weisz-Carrington, and M.E. Lamm. 1977. Origin of IgA-secreting plasma cells in the mammary gland. J. Exp. Med. 146:13111322.[Abstract/Free Full Text]
6 Tanneau, G.M., L. Hibrand-Saint Oyant, C.C. Chevaleyre, and H.P. Salmon. 1999. Differential recruitment of T- and IgA B-lymphocytes in the developing mammary gland in relation to homing receptors and vascular addressins. J. Histochem. Cytochem. 47:15811592.[Abstract/Free Full Text]
7 Hanson, L.A., and E. Telemo. 1999. Immunobiology and epidemiology of breastfeeding in relation to prevention of infections from a global perspective. Mucosal Immunology. P.L. Ogra, J. Mestecky, M.E. Lamm, W. Strober, J. Bienenstock, and J.R. McGhee, editors. Academic Press, San Diego. 15011510.
8 Goldblum, R.M., S. Ahlstedt, B. Carlsson, L.A. Hanson, U. Jodal, G. Lidin-Janson, and A. Sohl-Akerlund. 1975. Antibody-forming cells in human colostrum after oral immunisation. Nature. 257:797798.[CrossRef][Medline]
9 Lindh, E. 1975. Increased risistance of immunoglobulin A dimers to proteolytic degradation after binding of secretory component. J. Immunol. 114:284286.[Abstract/Free Full Text]
10 Feachem, R.G., and M.A. Koblinski. 1984. Interventions for the control of diarrhoeal diseases among young children: promotion of breastfeeding. Bull. World Health Organ. 62:271291.[Medline]
11 Czinn, S.J., and M.E. Lamm. 1986. Selective chemotaxis of subsets of B lymphocytes from gut-associated lymphoid tissue and its implications for the recruitment of mucosal plasma cells. J. Immunol. 136:36073611.[Abstract]
12 Butcher, E.C., and L.J. Picker. 1996. Lymphocyte homing and homeostasis. Science. 272:6066.[Abstract]
13 Kunkel, E.J., C.H. Kim, N.H. Lazarus, M.A. Vierra, D. Soler, E.P. Bowman, and E.C. Butcher. 2003. CCR10 expression is a common feature of circulating and mucosal epithelial tissue IgA Ab-secreting cells. J. Clin. Invest. 111:10011010.[CrossRef][Medline]
14 Lazarus, N.H., E.J. Kunkel, B. Johnston, E. Wilson, K.R. Youngman, and E.C. Butcher. 2003. A common mucosal chemokine (mucosae-associated epithelial chemokine/CCL28) selectively attracts IgA plasmablasts. J. Immunol. 170:37993805.[Abstract/Free Full Text]
15 Pabst, O., L. Ohl, M. Wendland, M.A. Wurbel, E. Kremmer, B. Malissen, and R. Forster. 2004. Chemokine receptor CCR9 contributes to the localization of plasma cells to the small intestine. J. Exp. Med. 199:411416.[Abstract/Free Full Text]
16 Hieshima, K., H. Ohtani, M. Shibano, D. Izawa, T. Nakayama, Y. Kawasaki, F. Shiba, M. Shiota, F. Katou, T. Saito, and O. Yoshie. 2003. CCL28 has dual roles in mucosal immunity as a chemokine with broad-spectrum antimicrobial activity. J. Immunol. 170:14521461.[Abstract/Free Full Text]
17 Nagasawa, H. 1979. A device for milk collection from mice. Lab. Anim. Sci. 29:633635.[Medline]
18 Weisz-Carrington, P., M.E. Roux, and M.E. Lamm. 1977. Plasma cells and epithelial immunoglobulins in the mouse mammary gland during pregnancy and lactation. J. Immunol. 119:13061307.[Abstract/Free Full Text]
19 Pan, J., E.J. Kunkel, U. Gosslar, N. Lazarus, P. Langdon, K. Broadwell, M.A. Vierra, M.C. Genovese, E.C. Butcher, and D. Soler. 2000. A novel chemokine ligand for CCR10 and CCR3 expressed by epithelial cells in mucosal tissues. J. Immunol. 165:29432949.[Abstract/Free Full Text]
20 Zabel, B.A., W.W. Agace, J.J. Campbell, H.M. Heath, D. Parent, A.I. Roberts, E.C. Ebert, N. Kassam, S. Qin, M. Zovko, et al. 1999. Human G proteincoupled receptor GPR-9-6/CC chemokine receptor 9 is selectively expressed on intestinal homing T lymphocytes, mucosal lymphocytes, and thymocytes and is required for thymus-expressed chemokine-mediated chemotaxis. J. Exp. Med. 190:12411256.[Abstract/Free Full Text]
21 Bowman, E.P., N.A. Kuklin, K.R. Youngman, N.H. Lazarus, E.J. Kunkel, J. Pan, H.B. Greenberg, and E.C. Butcher. 2002. The intestinal chemokine thymus-expressed chemokine (CCL25) attracts IgA antibody-secreting cells. J. Exp. Med. 195:269275.[Abstract/Free Full Text]
22 Kunkel, E.J., and E.C. Butcher. 2003. Plasma-cell homing. Nat. Rev. Immunol. 3:822829.[CrossRef][Medline]
23 Nakayama, T., K. Hieshima, D. Izawa, Y. Tatsumi, A. Kanamaru, and O. Yoshie. 2003. Cutting edge: profile of chemokine receptor expression on human plasma cells accounts for their efficient recruitment to target tissues. J. Immunol. 170:11361140.[Abstract/Free Full Text]
24 Halsey, J.F., C.S. Mitchell, and S.J. McKenzie. 1983. The origins of secretory IgA in milk: a shift during lactation from a serum origin to local synthesis in the mammary gland. Ann. N. Y. Acad. Sci. 409:452460.[CrossRef][Medline]
25 Halsey, J.F., C. Mitchell, R. Meyer, and J.J. Cebra. 1982. Metabolism of immunoglobulin A in lactating mice: origins of immunoglobulin A in milk. Eur. J. Immunol. 12:107112.[Medline]
26 Kunkel, E.J., and E.C. Butcher. 2002. Chemokines and the tissue-specific migration of lymphocytes. Immunity. 16:14.[CrossRef][Medline]
27 McDermott, M.R., and J. Bienenstock. 1979. Evidence for a common mucosal immunologic system. I. Migration of B immunoblasts into intestinal, respiratory, and genital tissues. J. Immunol. 122:18921898.[Abstract/Free Full Text]
28 Czerkinsky, C., S.J. Prince, S.M. Michalek, S. Jackson, M.W. Russell, Z. Moldoveanu, J.R. McGhee, and J. Mestecky. 1987. IgA antibody-producing cells in peripheral blood after antigen ingestion: evidence for a common mucosal immune system in humans. Proc. Natl. Acad. Sci. USA. 84:24492453.[Abstract/Free Full Text]