|
||
Address correspondence to Helen Turner, Center for Biomedical Research, 1301 Punchbowl St., University Tower 8, Honolulu, HI 96813. Phone: (808) 537-7927; Fax: (808) 537-7926; email: hturner{at}queens.org
| Abstract |
|---|
|
|
|---|
Key Words: calcium channels inflammation physical urticaria transient receptor potential vanilloid receptor
Cation channels of the transient receptor potential (vanilloid) (TRPV) family respond to various environmental inputs across both physiological and pathophysiological ranges. Six channels have been defined on the basis of similarity to the prototypical vanilloid receptor (TRPV1, VR-1) (1720). TRPV1 was expression cloned by virtue of its ability to confer responses to the nociomimetic lipid capsaicin upon an epithelial cell line and is activated after exposure to pathophysiological temperatures (>42°C) (18, 19). TRPV2 has a higher threshold than TRPV1 for heat activation (
The expression pattern of TRPV2, 3, and 4 apparently extends beyond sensory contexts, since TRPV2 transcripts have been noted in peripheral tissues (including components of the immune system) and TRPV3/4 conductances have been described in epithelia and keratinocytes (17). TRPV2 may be involved in initiating responses to noxious temperatures in nonsensory cell types. Alternately, distinct activation mechanisms for TRPV2 may exist in these peripheral tissue contexts. Interestingly, a signaling pathway that is initiated by IGF-1 or a neuropeptide receptor can cause activation of a murine TRPV2 homologue (2830).
We can also postulate the existence of a sensitizing mechanism for peripheral TRPV2, where a signaling event causes a decrease in the threshold temperature of the channel, bringing it into the physiological range. Such a mechanism exists for TRPV1, which gates at near physiological temperatures after cytosolic acidification or ethanol exposure (18, 31). A PKA pathway has also been proposed to regulate sensitization of TRPV1, although the components of this signaling module are unknown (32, 33). To date, a similar signaling module has not been shown to associate with or regulate TRPV2.
TRPVs confer environmental-sensing properties upon neurons and nonsensory cell types. Via TRPVs, this sensing may be coupled to calcium signals. In the current study, we hypothesized that expression of TRPVs in mast cells could confer direct sensitivity to the types of physical stimuli that activate mast cells during PU. We find various TRPV transcripts in transformed and primary mast cells. The expression and oligomerization of TRPV2 protein was confirmed in mast cells, and our data suggest that exposure to TRPV2 threshold temperatures couples to calcium entry and specific proinflammatory events. We describe a novel regulatory signaling module for TRPV2. TRPV2 apparently participates in a signaling module that comprises PKA and an adaptor protein with A kinase adapter protein (AKAP)-like properties. A PKA regulatory (PKAR) subunit binding protein, Acyl CoA binding domain protein (ACBD)3, is suggested as this adaptor that links TRPV2 and PKA. In summary, this study identifies a novel expression context, functional linkage, and regulatory signaling module for TRPV2. We conclude that TRPVs may transduce physical stimuli in mast cells, in parallel with TRPV expression in the sensory neurons with which dermal mast cells are associated. Therefore, TRPVs are potential targets for intervention in pathologies such as PU.
Antibodies and Reagents.
RT-PCR and Electrophoresis.
Northern Blots.
Immunoprecipitation and Western Blot.
Samples were boiled in Laemmli buffer, resolved by SDS-PAGE, and electrotransferred to PVDF. Membranes were blocked using 5% nonfat milk or BSA (1 h at RT). Primary antibodies were incubated with membrane for 16 h at 4°C. Developing antibodies were diluted to 0.1 µg/ml and incubated with membranes for 45 min. For cell surface biotinylation, intact cells were incubated (30 min at RT) with 1 mg/ml sulfo-NHS-biotin (Pierce Chemical Co.) in PBS, pH 8.0. Cells were washed four times in PBS/25 mM NH4Cl and then lysed/immunoprecipitated as above in the presence of 25 mM NH4Cl.
Blue-Native Electrophoresis.
Immunofluorescence.
Phosphorylation Assays.
Fura-2 Calcium Assay.
Serotonin Release Assay.
![]()
Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Mast cells respond to multiple stimuli, including immunological inputs, polybasic secretagogues, and physical cues (15). Direct responsiveness to physical (thermal, osmotic, and mechanical perturbation) stimuli has been described for mast cells in vitro and in vivo (1, 3, 68). Mast cell responses to these physical stimuli are causative in various urticarias that derive from inappropriate activation of cutaneous mast cells (1, 911). Physical urticarias (PU) involve wheal-flare reactions that follow brief exposure to applied cold, heat, pressure, or light in the UVA and short-wave visible ranges (9, 1214). These stimuli elicit release of histamine, serotonin, and other inflammatory mediators from cutaneous mast cells, causing an inflammatory reaction that is characterized by erythema, edema, and pruritis (9, 14). PU symptoms respond to H1-type antihistamines (9, 15). PU can be sporadic or may be associated with chronic (often idiopathic) urticarial disease (16). In contrast to acute allergic inflammations, an IgEFc
RImediated mechanism is not widely postulated for the PU, although this may be an important component of chronic urticarial responses (16). In the absence of a clear IgE dependence for the induction of PU, it would seem important to identify a signaling mechanism that can transduce acute physical stimuli into signals that are necessary and sufficient to induce mast cell activation.
52°C) and has no known similar sensitizing agents (17, 21). TRPV3 responds to warm temperatures (3135°C) and is sensitized by prior temperature elevation (17, 2224). Responsiveness to physiological temperatures (2433°C), hypo-osmolarity, and mechanical pressure, or shear stress, have been described for TRPV4 (17, 2527).
![]()
Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Cell Culture.
RBL2H3 cells and HEK293 stably transfected with pcDNA6TR (Invitrogen) were maintained in DMEM/10% fetal bovine serum/2 mM glutamine in humidified 5% CO2 at 37°C. For production of TRexHEK293 cells with inducible expression of TRPV2, parental cells were electroporated with the rat TRPV2 cDNA in pcDNA4TO. Clonal cell lines were selected by limiting dilution in 400 µg/ml zeocin (Invitrogen). TRPV2 expression was induced using 1 µg/ml tetracycline for 16 h at 37°C.
Rat TRPV2 cDNA was a gift from Dr. David Julius (University of California, San Francisco, San Francisco, CA). Rabbit polyclonal anti-TRPV2 was from Calbiochem. Goat polyclonal anti-PKAR subunit was from Chemicon. Rabbit polyclonal anti-ACBD3 (34) was a gift from Dr. V. Papadopoulos (Georgetown University, Washington DC). Antiphospho PKA substrate motif antibody was from Cell Signaling Technology. Anti-FLAG was from Sigma-Aldrich. HRP-conjugated secondary antibodies were from Amersham Biosciences. Hoechst and Alexa fluorophoreconjugated IgGs were from Molecular Probes. Lipidated, cell permeant, HT31 peptide (35) was from Promega.
RT-PCR on RBL2H3 poly A+ mRNA was performed using the following primers: (5'-3', forward/back): TRPV1, cggctttttgggaagggtg/tgtctctgggtctttgaactcgc; TRPV2, gaacctcaacttcataaagagacctcc/ccttggtagaactcatcggtgc; TRPV3, tcaggatgatgtgacagagaccc/cagcgaaggcaagcagaatc; TRPV4, tggacggactgctctcctacttg/tcatccttgggctggaagaac; TRPV5, ccatcctccagcaaaaactactacag/gaaacgcattaggtctccaaaaatc; and TRPV6, cctttgctgcctgtgtgggtag/ttggtggtaacaataagttccagtagag.
Multiple tissue and immune system Northern blots were purchased from CLONTECH Laboratories, Inc. and probed according to the manufacturer's instructions. Multiple cell line Northern blots were produced using 1 µg/lane poly A+ mRNA. The TRPV2 cDNA probe comprised a 353-bp HincII-NotI fragment.
Cells were pelleted (2000 g, 2 min) and washed once in ice cold PBS. Approximately 107 cells were lysed (in ice for 30 min) in 350 µl of lysis buffer (50 mM Hepes, pH 7.4, 75 mM NaCl, 20 mM NaF, 10 mM iodoacetamide, 0.5% [wt/vol] Triton X-100, 1 mM PMSF, 500 µg/ml aprotinin, 1.0 mg/ml leupeptin, and 2.0 mg/ml chymostatin). Lysates were clarified (10,000 g, 5 min). For preparation of total protein, lysates were acetone precipitated. For immunoprecipitation, supernatants were tumbled (at 4°C for 2 h) with the indicated antibody, covalently coupled (dimethylpimelidate/ethanolamine) to protein GSepharose.
Blue-Native (BN)PAGE was adapted from Schagger and Von Jagow (36) and Schamel et al. (37). Gradient gels (620%) were electrophoresed in BN sample buffer (5% [wt/vol] Coomassie-G250, 100 mM Bis-Tris, pH 7.0, 500 mM 6-aminocaproic acid). Anode buffer was 50 mM Bis-Tris, pH 7.0. Cathode buffer was 50 mM tricine/15 mM Bis-Tris, pH 7.0. For the first 90 min of resolving time (100 V/1 h then 600 V/16 h), Coomassie-G250 was included in the cathode buffer at 0.02% (wt/vol). Gels were electrotransferred and Western blotted.
Cells were fixed and permeabilized on glass coverslips (4% paraformaldehyde followed by 0.4% Triton X-100 for 20 min at RT). After blocking (0.7% fish skin gelatin), coverslips were sequentially incubated with primary and secondary antibodies and the indicated stains. Imaging was performed with an Olympus IX70 fluorescence inverted microscope with quadruple dichroic filter block and excitation filter set 88000 (Chroma) connected to an F-view monochrome CCD camera.
For metabolic labeling with 32Pi, RBL2H3 were incubated for 3 h in phosphate-free DMEM before addition of 250 µCi/ml 32P orthophosphate for 4 h. Cells were harvested and then lysed as described in the Immunoprecipitation and Western Blot section. Immunoprecipitation and SDS-PAGE were performed as described in the Immunoprecipitation and Western Blot section, and the resulting gel was autoradiographed. For in vitro phosphorylation assays, dried immunocomplexes were resuspended in a buffer containing 50 mM Tris, pH 7.4, 1 mM EDTA, 12 mM MgCl2, and 250 µM ATP. Additional components were added as indicated, (10 mM cAMP, 10 mM cGMP, 5 µCi 32P
ATP, 1 U/µl PKA or protein kinase G [PKG] [Promega]). Reactions were incubated at 30°C for 30 min, stopped by addition of reducing sample buffer, and then resolved by SDS-PAGE.
RBL2H3 were loaded with 4 µM Fura-2 a.m. (Molecular Probes) in Ringer buffer with 1 mM CaCl2,
330 mOsm, for 45 min at 37°C. After washing, bulk assay of calcium flux was performed as described (38). As a positive control, cells were stimulated with thapsigargin (1 µM) or ionomycin (500 nM) in the absence and presence of external calcium (not depicted).
Adherent RBL2H3 (2 x 104 cells/cm2) were incubated with 1 µCi/ml 3H hydroxytryptamine (New England Nuclear) for 16 h at 37°C. Monolayers were then washed once in Tyrode's buffer at 37°C, and cells were incubated with the indicated stimuli or vehicle in 250 µl/cm2 Tyrodes buffer for 45 min at 37°C. Reactions were stopped by quenching in ice cold PBS and counted in liquid scintillation cocktail.
![]()
Results
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TRPV Expression in Mast Cells.
Mast cells mount intense responses to environmental cues, including thermal, osmotic, and mechanical inputs (1, 3, 11). The correlation between these stimuli and the known activation mechanisms for TRPV channels is striking (17). We hypothesized that TRPVs may mediate calcium entry into mast cells in response to certain classes of physical stimulation. We analyzed TRPV mRNA representation in the model mast cell line RBL2H3. RT-PCR reactions were performed using primer pairs designed to selectively amplify each TRPV, and TRPM7, which is an abundant conductance in RBL2H3 (39). Fig. 1 A shows that transcripts for TRPV1, 2, 4, 6, and TRPM7 may be detected in RBL2H3 cells by RT-PCR. The identity of the PCR products was confirmed by excision, purification, and sequencing.
|
10-12 pg per ng poly A+ mRNA (n = 3). TRPV2 transcripts could also be detected in primary human cord bloodderived mast cells and human basophils (unpublished data). TRPV2 transcript levels in cord bloodderived mast cells are comparable with that found in primary human neutrophils, a previously defined context for TRPV2 (40).
TRPV2 Is Present in Mast Cells as a Cell Surface Oligomer with Tetrameric Stoichiometry.
We sought to confirm that TRPV2 protein is present and that TRPV2 exists in mast cells as a functional, cell surface, channel oligomer. Fig. 2 A shows that anti-TRPV2 recognizes a
90-kD protein doublet in lysates that were isolated from primary murine BMMCs. Moreover, a similar protein doublet may be immunoprecipitated from RBL2H3 and P815 mast cells using this anti-TRPV2. Migration analysis (not depicted) suggests that these two protein species have molecular weights of 94 and 87 kD. The presence of two mobility forms of TRPV2 may indicate differential posttranslational modification, including glycosylation or phosphorylation (see Fig. 4). Specificity of the anti-TRPV2 is evidenced by the two experiments shown in Fig. 2, B and C. Fig. 2 B demonstrates that preincubation with the antigenic peptide ablates immunoprecipitation of the TRPV2 doublet. Fig. 2 C shows that the anti-TRPV2 immunoprecipitates a protein doublet from a TRexHEK cell line that expresses a FLAG epitope-tagged version of TRPV2, under the control of a tetracycline-sensitive transcriptional repressor. The same doublet may be precipitated via either the NH2-terminal FLAG tag or the COOH-terminal anti-TRPV2 epitope.
|
We were able to surface biotinylate TRPV2 in a resting population of RBL2H3 (Fig. 2 E). To assess the proportion of RBL2H3 that this surface labeling represented, we performed fluorescence immunocytochemistry. Anti-TRPV2 immunoreactivity is present at the cell periphery in a subpopulation (1020%) of resting RBL2H3 (Fig. 2 F). Together, these data suggest that TRPV2 protein is expressed in transformed and primary mast cells. Moreover, the configuration and localization of mast cell TRPV2 are consistent with our expectations for a functional channel.
Functionally Coupled Responses to Noxious Temperatures in Mast Cells.
TRPV2 activates at 50°C, a temperature that elicits heat urticaria when used as a diagnostic challenge, in both endogenous (e.g., mammalian neurons) and overexpression systems (HEK cells or Xenopus oocytes). Prior to the cloning of TRPV2, heat-induced currents had been described in sensory neurons, and careful analysis of membrane integrity in these studies revealed that certain irreversible membrane events occur only when temperatures of >5960°C are attained (45). We assessed cell viability and proliferative capability of RBL2H3 and HEK 293 after both ramped and transient temperature elevation protocols. When peak temperatures were <5758°C, we did not observe detrimental acute effects on membrane integrity (assayed via Trypan blue exclusion) or proliferative ability of the cells (unpublished data).
We asked if transient elevation to the TRPV2 threshold temperature caused secretion of proinflammatory mediators from RBL2H3 mast cells. Fig. 3 A shows that ligation of the Fc
RI at 37°C induces serotonin release in RBL2H3 and that this release depends on the presence of external calcium during the stimulation period. Similarly, transient elevation to a peak temperature of 51°C but not 45°C evokes serotonin release that is also dependent on the presence of extracellular calcium. Secretory responses evoked by immunoreceptor stimulation and heat transients are both sensitive to the inhibitor ruthenium red, which has been shown to block TRPV channels, including TRPV2 (Fig. 3 B; references 21, 46). These data imply that brief elevation to the TRPV2 threshold temperature initiates a calcium influx pathway that couples to the degranulation mechanism in mast cells.
|
We applied ramped temperature increases to RBL2H3 and simultaneously monitored the attained temperature and Fura-2 fluorescence. Fig. 3 E shows the Fura-2 profile of multiple individual temperature ramps (n = 8) normalized to the attained temperature. At temperatures between 24 and 33°C, no significant increase in Fura-2 fluorescence is observed. Through the 3449°C range, the Fura-2 signal increases at a mean rate of 0.09 intensity unit °C1 (±0.013 U °C1, n = 8). In the 4954°C range, Fura-2 signal increases at a mean rate of 0.32 intensity unit/°C (±0.09 U °C1, n = 8). Thus the rate of calcium increase in these cells increases significantly (P < 0.0001) at two discrete points in the temperature ramp. The temperature/Fura-2 signal relationship in these cells is therefore consistent with the sequential opening of multiple channel species that have distinct threshold temperatures. We asked if such temperature/Fura-2 signal relationships could detect enhanced expression of a single channel species. We performed ramped temperature increases in TRexTRPV2 cells (Fig. 3 F). In cells with minimal TRPV2 expression, the Fura-2 signal increases at a rate of 0.0004, 0.004, and 0.007 U°C1 between the temperatures of 2238°C, 3448°C, and 4856°C, respectively. In cells with marked overexpression of TRPV2, the latter rate increases to 0.019 U°C1.
TRPV2 Is a Substrate for PKA-mediated Phosphorylation.
We reasoned that analysis of the proteinprotein interactions made by TRPV2 might give us insight into potential regulatory mechanisms that would be applicable to both mast cell and central nervous system expression contexts for TRPV2. PKA directly phosphorylates TRPV1 and the heat-sensitive potassium channel TREK (32, 33, 47), and in both cases, this phosphorylation modulates the electrophysiological properties of the channel. We asked if TRPV2 was also a substrate for regulatory phosphorylation via PKA in mast cells. We first established that PKA but not PKG could mediate the in vitro phosphorylation of TRPV2 (Fig. 4 A).
|
TRPV2 Associates Directly with PKARII in Mast Cells Via an AKAP.
The PKA-mediated phosphorylation of TRPV2 suggests that the channel is part of a signaling complex that contains PKA. We detected a protein species in anti-TRPV2 immunocomplexes that is immunoreactive with antibodies raised against the PKARII PKAR subunit (Fig. 5 A).
|
-helical region, is the contact area between the known AKAPs and PKAR subunits. Fig. 5 A shows that HT31 blocks association between TRPV2 and PKARII, implying that a specific AKAP bridges TRPV2 and PKA.
The PKA-binding Protein ACBD3 May Mediate the TRPV2PKA Interaction.
The ACBD3 protein (formerly PAP7) binds PKARI
and apparently recruits PKA to the peripheral benzodiazepine receptor (34, 49). Our yeast two-hybrid data (unpublished data) suggested that ACBD3 may bind to the NH2 terminus of TRPVs, and we proposed that ACBD3 might link TRPV2 and the PKAR subunit. Northern (not depicted) and Western analysis suggests that ACBD3 is widely expressed and is an abundant protein in the mast cell lines tested here (Fig. 5 B). Fig. 5 C shows that anti-TRPV2 immunocomplexes from RBL2H3 contain ACBD3. This interaction is unaffected by the HT31 peptide. Fig. 5 D shows that the presence of ACBD3 in anti-TRPV2 immunoprecipitates is due to the primary immunoprecipitation of TRPV2.
We asked if ACBD3 indeed interacted with the PKAR subunit in RBL2H3. RBL2H3 express both PKARI and PKARII (not depicted). Fig. 5 E shows that anti-PKARII
immunoprecipitates purified from RBL2H3 contain ACBD3. The presence of ACBD3 in PKARII
immunocomplexes is reduced in cells pretreated with a membrane-permeant form of the HT31 peptide, indicating an AKAP-like interaction. We were not able to capture ACBD3 or PKARI immunocomplexes from RBL2H3 with the available antibodies, and therefore we cannot assess whether ACBD3 associates with PKARI
.
| Discussion |
|---|
|
|
|---|
Mast cell TRPVs may contribute to PU where physical stimuli elicit wheal-flare reactions that are driven by cutaneous mast cells. Heat urticaria is evoked diagnostically by brief exposure of skin to temperatures of 4555°C, a stimulus that would be predicted to activate the TRPV1 and/or TRPV2 channels that may be present in cutaneous mast cells (50). Our data show that these stimuli can be functionally coupled to inflammatory mediator release in a model mast cell line. Future work may also reveal other functional linkages between physical stimuli, urticarial responses, and TRPVs in cutaneous mast cells. For example, dermatographism is a specific PU where mast celldependent wheal-flare reactions follow brief pressure to the dermis (9, 10, 14), whereas the diagnostic criterion for cold urticaria is the appearance of highly localized hives within a few minutes of cutaneous exposure to temperatures of 414°C. Transcripts for the pressure-activated TRPV4 and a potentially cold-gated TRP channel are present in model mast cells (unpublished data). Expression of a range of TRPV-type sensors, if they can be shown to couple to functionally significant downstream signaling pathways, may therefore confer sensitivity to a spectrum of physical stimuli. In addition to the potential for contribution to PU, it is possible that direct sensing of noxious physical stimuli by mast cells plays a role in the inflammatory responses that follow thermal wounding (3, 51).
Activating stimuli, but not necessarily activation mechanisms, have been described for TRPVs. An activation mechanism that involves direct physical sensing by the TRPV is apparently precluded by recent data showing that excised membrane patches containing TRPV4 do not retain responsiveness to activating temperatures for this channel (26). It seems likely that a second messenger-based signaling system is involved, and the diverse apparent regulation of TRPVs by lipid mediators may provide insight into this issue (17). The presence of a sensitizing mechanism could be important in understanding the role of TRPv2 in seemingly paradoxical, nonsensory expression contexts (e.g., lymphocytes). A PKA-mediated sensitization mechanism has been defined previously for TRPV1 and the heat-activated K+ channel, TREK. Our data suggest that a PKA signaling module acts directly on TRPV2. Future work will reveal which properties of the channel are affected by PKA phosphorylation. We observe a potentiation in heat-evoked calcium responses in forskolin-treated RBL2H3, which may reflect A kinasedependent modulation of TRPV2 channels (unpublished data). However, there may be considerable complexity in the relationship between PKA and TRPV2, since we can identify a regulated surface localization step (29, 30) in TRPV2 biosynthesis that is cAMP regulated (unpublished data). Therefore, forskolin potentiation of TRPV2 responses could be an effect of increased channel density at the cell surface.
We have identified a novel signaling protein that associates with TRPV2, the PKAR binding protein ACBD3 (49). This interaction is not exclusive, since ACBD3 has been described as an adaptor protein in the context of a mitochondrial complex that is assembled around the voltage-dependent anion channel (VDAC) (34, 49). ACBD3 interacts with VDAC via an intermediary protein, the peripheral benzodiazepine receptor (34, 49). We cannot yet state whether the TRPV2ACBD3 interaction is direct. In both TRPV2 and VDAC contexts, however, it appears that the role of ACBD3 is to recruit PKA into the channel microenvironment. ACBD3 appears to fulfill some of the functional criteria for classification as an AKAP. However, recruitment of the PKA catalytic subunit by ACBD3 has not been demonstrated in either system. AKAPs are proposed to contain a common structural motif, an amphipathic a-helix that mediates complex formation between the AKAP and PKAR subunit. We can identify several such motifs in the ACBD3 COOH terminus using helical wheel analysis (not depicted). Future mutational analysis will determine whether ACBD3 is indeed using this helical motif to interact with PKAR. It is clear that a PKA signaling module affects the activation properties of TRPV1, apparently contributing to the desensitization process (32, 33). Together with our present data, this observation raises the question of whether an ACBD3PKA module is common to both TRPV1 and TRPV2. To date, we have not been able to coprecipitate TRPV1 and ACBD3.
In summary, the present study suggests that TRPV cation channels, including TRPV2, may contribute to mast cell physiology and potentially to pathologies that result from inappropriate mast cell activation in response to physical stimuli. Regulation by cAMP/PKA signaling pathways may be a recurring theme among TRPV species and may affect TRPV functionality at multiple levels.
| Acknowledgments |
|---|
The authors acknowledge the support of the Charles E. Culpeper Biomedical Pilot Initiative (grant to H. Turner).
Submitted: 3 December 2003
Accepted: 28 May 2004
| References |
|---|
|
|
|---|
1 Church, M.K., Y. Okayama, and S. el-Lati. 1991. Mediator secretion from human skin mast cells provoked by immunological and non-immunological stimulation. Skin Pharmacol. 4:1524.[Medline]
2 Galli, S.J. 2000. Mast cells and basophils. Curr. Opin. Hematol. 7:3239.[CrossRef][Medline]
3 Noli, C., and A. Miolo. 2001. The mast cell in wound healing. Vet. Dermatol. 12:303313.[CrossRef][Medline]
4 Metcalfe, D.D., D. Baram, and Y.A. Mekori. 1997. Mast cells. Physiol. Rev. 77:10331079.
5 Sharma, B.B., J.R. Apgar, and F.T. Liu. 2002. Mast cells. Receptors, secretagogues, and signaling. Clin. Rev. Allergy Immunol. 22:119148.[CrossRef][Medline]
6 Eggleston, P.A., A. Kagey-Sobotka, and L.M. Lichtenstein. 1987. A comparison of the osmotic activation of basophils and human lung mast cells. Am. Rev. Respir. Dis. 135:10431048.[Medline]
7 Fredholm, B., and O. Hagermark. 1970. Studies on histamine release from skin and from peritoneal mast cells of the rat induced by heat. Acta Derm. Venereol. 50:273277.[Medline]
8 Silber, G., D. Proud, J. Warner, R. Naclerio, A. Kagey-Sobotka, L. Lichtenstein, and P. Eggleston. 1988. In vivo release of inflammatory mediators by hyperosmolar solutions. Am. Rev. Respir. Dis. 137:606612.[Medline]
9 Grabbe, J. 2001. Pathomechanisms in physical urticaria. J. Investig. Dermatol. Symp. Proc. 6:135136.[CrossRef][Medline]
10 Soter, N.A., and F. Austen. 1977. Urticaria, angioedema, and mediator release in humans in response to physical environmental stimuli. Fed. Proc. 36:17361741.[Medline]
11 Soter, N.A., and S.I. Wasserman. 1980. Physical urticaria/angioedema: an experimental model of mast cell activation in humans. J. Allergy Clin. Immunol. 66:358365.[CrossRef][Medline]
12 Claudy, A. 2001. Cold urticaria. J. Investig. Dermatol. Symp. Proc. 6:141142.[CrossRef][Medline]
13 Daman, L., P. Lieberman, M. Ganier, and K. Hashimoto. 1978. Localized heat urticaria. J. Allergy Clin. Immunol. 61:273278.[CrossRef][Medline]
14 Greaves, M.W. 1991. The physical urticarias. Clin. Exp. Allergy. 21:284289.[Medline]
15 Merk, H.F. 2001. Standard treatment: the role of antihistamines. J. Investig. Dermatol. Symp. Proc. 6:153156.[CrossRef][Medline]
16 Greaves, M.W. 2003. Chronic idiopathic urticaria. Curr. Opin. Allergy Clin. Immunol. 3:363368.[Medline]
17 Benham, C.D., M.J. Gunthorpe, and J.B. Davis. 2003. TRPV channels as temperature sensors. Cell Calcium. 33:479487.[CrossRef][Medline]
18 Caterina, M.J., M.A. Schumacher, M. Tominaga, T.A. Rosen, J.D. Levine, and D. Julius. 1997. The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature. 389:816824.[CrossRef][Medline]
19 Julius, D., and A.I. Basbaum. 2001. Molecular mechanisms of nociception. Nature. 413:203210.[CrossRef][Medline]
20 Nilius, B. 2003. From TRPs to SOCs, CCEs and CRACs: consensus and contraversies. Cell Calcium. 33:293298.[CrossRef][Medline]
21 Caterina, M.J., T.A. Rosen, M. Tominaga, A.J. Brake, and D. Julius. 1999. A capsaicin-receptor homologue with a high threshold for noxious heat. Nature. 398:436441.[CrossRef][Medline]
22 Peier, A.M., A.J. Reeve, D.A. Andersson, A. Moqrich, T.J. Earley, A.C. Hergarden, G.M. Story, S. Colley, J.B. Hogenesch, P. McIntyre, et al. 2002. A heat-sensitive TRP channel expressed in keratinocytes. Science. 296:20462049.
23 Smith, G.D., M.J. Gunthorpe, R.E. Kelsell, P.D. Hayes, P. Reilly, P. Facer, J.E. Wright, J.C. Jerman, J.P. Walhin, L. Ooi, et al. 2002. TRPV3 is a temperature-sensitive vanilloid receptor-like protein. Nature. 418:186190.[CrossRef][Medline]
24 Xu, H., I.S. Ramsey, S.A. Kotecha, M.M. Moran, J.A. Chong, D. Lawson, P. Ge, J. Lilly, I. Silos-Santiago, Y. Xie, et al. 2002. TRPV3 is a calcium-permeable temperature-sensitive cation channel. Nature. 418:181186.[CrossRef][Medline]
25 Guler, A.D., H. Lee, T. Iida, I. Shimizu, M. Tominaga, and M. Caterina. 2002. Heat-evoked activation of the ion channel, TRPV4. J. Neurosci. 22:64086414.
26 Watanabe, H., J. Vriens, S.H. Suh, C.D. Benham, G. Droogmans, and B. Nilius. 2002. Heat-evoked activation of TRPV4 channels in a HEK293 cell expression system and in native mouse aorta endothelial cells. J. Biol. Chem. 277:4704447051.
27 Alessandri-Haber, N., J.J. Yeh, A.E. Boyd, C.A. Parada, X. Chen, D.B. Reichling, and J.D. Levine. 2003. Hypotonicity induces TRPV4-mediated nociception in rat. Neuron. 39:497511.[CrossRef][Medline]
28 Boels, K., G. Glassmeier, D. Herrmann, I.B. Riedel, W. Hampe, I. Kojima, J.R. Schwarz, and H.C. Schaller. 2001. The neuropeptide head activator induces activation and translocation of the growth-factor-regulated Ca(2+)-permeable channel GRC. J. Cell Sci. 114:35993606.[Medline]
29 Iwata, Y., Y. Katanosaka, Y. Arai, K. Komamura, K. Miyatake, and M. Shigekawa. 2003. A novel mechanism of myocyte degeneration involving the Ca2+-permeable growth factor-regulated channel. J. Cell Biol. 161:957967.
30 Kanzaki, M., Y.Q. Zhang, H. Mashima, L. Li, H. Shibata, and I. Kojima. 1999. Translocation of a calcium-permeable cation channel induced by insulin-like growth factor-I. Nat. Cell Biol. 1:165170.[CrossRef][Medline]
31 Trevisani, M., D. Smart, M.J. Gunthorpe, M. Tognetto, M. Barbieri, B. Campi, S. Amadesi, J. Gray, J.C. Jerman, S.J. Brough, et al. 2002. Ethanol elicits and potentiates nociceptor responses via the vanilloid receptor-1. Nat. Neurosci. 5:546551.[CrossRef][Medline]
32 De Petrocellis, L., S. Harrison, T. Bisogno, M. Tognetto, I. Brandi, G.D. Smith, C. Creminon, J.B. Davis, P. Geppetti, and V. Di Marzo. 2001. The vanilloid receptor (VR1)-mediated effects of anandamide are potently enhanced by the cAMP-dependent protein kinase. J. Neurochem. 77:16601663.[CrossRef][Medline]
33 Rathee, P.K., C. Distler, O. Obreja, W. Neuhuber, G.K. Wang, S.Y. Wang, C. Nau, and M. Kress. 2002. PKA/AKAP/VR-1 module: a common link of Gs-mediated signaling to thermal hyperalgesia. J. Neurosci. 22:47404745.
34 Li, H., B. Degenhardt, D. Tobin, Z.X. Yao, K. Tasken, and V. Papadopoulos. 2001. Identification, localization, and function in steroidogenesis of PAP7: a peripheral-type benzodiazepine receptor- and PKA (RIalpha)-associated protein. Mol. Endocrinol. 15:22112228.
35 Vijayaraghavan, S., S.A. Goueli, M.P. Davey, and D.W. Carr. 1997. Protein kinase A-anchoring inhibitor peptides arrest mammalian sperm motility. J. Biol. Chem. 272:47474752.
36 Schagger, H., W.A. Cramer, and G. von Jagow. 1994. Analysis of molecular masses and oligomeric states of protein complexes by blue native electrophoresis and isolation of membrane protein complexes by two-dimensional native electrophoresis. Anal. Biochem. 217:220230.[CrossRef][Medline]
37 Schamel, W.W., and M. Reth. 2000. Monomeric and oligomeric complexes of the B cell antigen receptor. Immunity. 13:514.[CrossRef][Medline]
38 Turner, H., A. Fleig, A. Stokes, J.P. Kinet, and R. Penner. 2003. Discrimination of intracellular calcium store subcompartments using TRPV1 (transient receptor potential channel, vanilloid subfamily member 1) release channel activity. Biochem. J. 371:341350.[CrossRef][Medline]
39 Nadler, M.J., M.C. Hermosura, K. Inabe, A.L. Perraud, Q. Zhu, A.J. Stokes, T. Kurosaki, J.P. Kinet, R. Penner, A.M. Scharenberg, and A. Fleig. 2001. LTRPC7 is a Mg.ATP-regulated divalent cation channel required for cell viability. Nature. 411:590595.[CrossRef][Medline]
40 Heiner, I., J. Eisfeld, and A. Luckhoff. 2003. Role and regulation of TRP channels in neutrophil granulocytes. Cell Calcium. 33:533540.[CrossRef][Medline]
41 Minke, B., and B. Cook. 2002. TRP channel proteins and signal transduction. Physiol. Rev. 82:429472.
42 Rosenbaum, T., M. Awaya, and S.E. Gordon. 2002. Subunit modification and association in VR1 ion channels. BMC Neurosci. 3:4.[CrossRef][Medline]
43 van de Graaf, S.F., J.G. Hoenderop, D. Gkika, D. Lamers, J. Prenen, U. Rescher, V. Gerke, O. Staub, B. Nilius, and R.J. Bindels. 2003. Functional expression of the epithelial Ca(2+) channels (TRPV5 and TRPV6) requires association of the S100A10-annexin 2 complex. EMBO J. 22:14781487.[CrossRef][Medline]
44 Kedei, N., T. Szabo, J.D. Lile, J.J. Treanor, Z. Olah, M.J. Iadarola, and P.M. Blumberg. 2001. Analysis of the native quaternary structure of vanilloid receptor 1. J. Biol. Chem. 276:2861328619.
45 Cesare, P., A. Moriondo, V. Vellani, and P.A. McNaughton. 1999. Ion channels gated by heat. Proc. Natl. Acad. Sci. USA. 96:76587663.
46 Clapham, D.E., C. Montell, G. Schultz, and D. Julius. 2003. International union of pharmacology. XLIII. Compendium of voltage-gated ion channels: transient receptor potential channels. Pharmacol. Rev. 55:591596.
47 Maingret, F., I. Lauritzen, A.J. Patel, C. Heurteaux, R. Reyes, F. Lesage, M. Lazdunski, and E. Honore. 2000. TREK-1 is a heat-activated background K(+) channel. EMBO J. 19:24832491.[CrossRef][Medline]
48 Colledge, M., and J.D. Scott. 1999. AKAPs: from structure to function. Trends Cell Biol. 9:216221.[CrossRef][Medline]
49 Liu, J., H. Li, and V. Papadopoulos. 2003. PAP7, a PBR/PKA-RIalpha-associated protein: a new element in the relay of the hormonal induction of steroidogenesis. J. Steroid Biochem. Mol. Biol. 85:275283.[CrossRef][Medline]
50 Biro, T., M. Maurer, S. Modarres, N.E. Lewin, C. Brodie, G. Acs, P. Acs, R. Paus, and P.M. Blumberg. 1998. Characterization of functional vanilloid receptors expressed by mast cells. Blood. 91:13321340.
51 Lewin, G.R., A. Rueff, and L.M. Mendell. 1994. Peripheral and central mechanisms of NGF-induced hyperalgesia. Eur. J. Neurosci. 6:19031912.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|