|
||
Address correspondence to Sarah L. Rowland-Jones, MRC Human Immunology Unit, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Headington, Oxford OX3 9DS UK. Phone: 44-1865-222316; Fax: 44-1865-222502; email: sarah.rowland-jones{at}ndm.ox.ac.uk
| Abstract |
|---|
|
|
|---|
Key Words: HIV cytotoxic T lymphocytes (CTL) T cell receptor cross-reactivity apoptosis
| Introduction |
|---|
|
|
|---|
A critical component of the virus-specific CD8+ T cell response is the selection of CTL-bearing TCRs that efficiently recognize the infected target cell. In most individuals with HLAA2, infection with influenza A virus stimulates expansions of T cells expressing TCRs with remarkably similar sequences (14): the recent crystallization of one such TCRHLApeptide complex has revealed how the TCR fits over the exposed peptide main chain, and the complex is stablized by insertion of a conserved Arginine residue from the ß chain complementarity determining region 3 (CDR3) into a notch between the bound peptide and the
helix of HLAA2 (15). Similarly, most people with HLAB8 and EBV infection select a conserved TCR in the response to the EBNA-3A antigen (16). The structure of this TCR complexed with HLAB8 and the EBV peptide has shown how efficiently the conserved TCR interacts with its HLApeptide target, forming a network of interactions between the TCR and both peptide and HLA molecule and engendering conformational changes in the CDR loops (17). Previous studies of the TCR repertoire in the HIV-specific CTL response have shown oligoclonal TCR usage (18) but no common receptors in unrelated individuals (19, 20). Here we describe selection of a distinctive Vß13.2 TCR with remarkable ß chain conservation in CTL expansions that recognize an immunodominant epitope in HIV-1 nef from four HIV-infected individuals with HLAB8 and delayed disease progression. In contrast to the immunodominant TCRs described in influenza A and EBV infection, not all donors with HLAB8 and HIV-1 infection who make nef-specific responses select this TCR. The apparent link with delayed disease progression suggests that this TCR confers particular advantages to the host. We show that CTL using this TCR are more likely to proliferate in vitro and resist apoptosis than CTL specific for the same epitope from the same or other donors using other TCRs. Common "escape" variants in this epitope are frequently selected under CTL pressure, often early in infection (21): however Vß13.2-bearing CTL recognize these variants as efficiently as the index sequence (in contrast to B8 nef-specific T cells expressing other TCRs) and escape variants have not been selected in donors with the Vß13.2 TCR. The Vß13.2 TCR is shown to have a moderately high affinity for HLAB8 complexed with either the index or most common escape variant sequence. Taken together these data suggest that this unique TCR is expressed on CTL that are particularly well-equipped to control HIV replication and that this could be linked with good clinical outcome in individuals that have generated a response that includes the Vß13.2 TCR.
| Materials and Methods |
|---|
|
|
|---|
|
Antigens and Antibodies.
Peptides were synthesized by FMOC chemistry, and corresponded to previously defined and optimized CTL epitopes. Anti-CD8 (Peridinin chlorophyll protein) antibodies were purchased from Becton Dickinson. A panel of Vß antibodies was made available as part of the TCR mAB workshop by Dr. Margaret Callan (Weatherall Institute of Molecular Medicine). The hybridoma for the Vß13.2 antibody was a kind gift from Dr. Philippa Marrack (University of Colorado, Health Sciences Center, Denver, CO).
Cell Surface and Intracellular Staining.
Cell surface and intracellular stainings were performed on fresh or carefully thawed cryopreserved PBMCs. Titrated tetramers (PE conjugated) were added for 15 min at 37°C, followed by addition of a panel of titrated unconjugated Vß antibodies, after which rabbit antimouse FITC antibodies were added. The cells were then stimulated with antigenic peptides for 1 h at 37°C, then Brefeldin A was added and the cells were incubated overnight at 37°C. The next day the lymphocytes were washed in PBS, 0.5 mM EDTA, 1% BSA, fixed, and permeabilized in FACS Permeabilization buffer (Becton Dickinson). After washing, the cells were incubated with IFN
-APC and CD8-Peridinin chlorophyll protein antibodies for 15 min at room temperature. Cells were then washed and stored in Cell Fix buffer (Becton Dickinson) at 4°C until flow cytometry analysis was performed. Samples were analyzed on a Becton Dickinson FACSCalibur.
Enzyme-linked Immunospot Assays.
Synthetic peptides corresponding to previously defined and otpimized CTL epitopes were used at a concentration of 10 µM in IFN-
enzyme-linked immunospot assays to define CD8+ T cell responses directly ex vivo, as described previously (25). PHA was always included as a positive control.
Apoptosis Assays.
We compared the susceptibility of different T cell PBMC populations to apoptosis in overnight culture using the Tunel (terminal deoxynucleotidyl transferasemediated dUTP nick end labeling) assay that measures late apoptotic cells with DNA fragmentation (26). In brief, freshly obtained PBMC were stained with tetramer and CD8 (tri-color) followed by staining with TUNEL (FITC) according to the manufacturer's protocol (Roche).
Establishment of Clones.
CTL clones were established from PBMCs by using appropriate antigen-specific tetramers in combination with MACS anti-PE microbeads (Miltenyi Biotec). In brief, tetramers were added to 35 million PBMCs, then incubated at 37°C for 20 min. The cells were then washed with cold buffer and resuspended in 40µl of anti-PE beads, mixed well and incubated for 15 min at 48°C. The cells were then washed and resuspended in 500 µl cold buffer, and magnetic separation was performed according to the manufacturer's protocol (Miltenyi Biotec). Sorted tetramer-positive cells were counted and CTL cloning was performed by using a standard protocol as described previously (27).
CTL Lysis Assays.
CTL lysis assays were performed using standard 51Chromium release assays. In brief, HLA-matched B cell lines were labeled with 51Chromium for 1 h and then washed three times: target cells were then divided and pulsed with peptides at different concentrations. After another hour of incubation at 37°C, the peptide solution was then washed off and cells were counted and cocultured with CTL clones at appropriate effector to target (E/T) ratios in 96-well plates. The plates were incubated at 37°C for 4 h, supernatants were harvested, and then counted for radioactivity using a Beta-plate counter (WALLAC). Specific lysis was calculated from the formula: % lysis = (experimental counts media control)/(detergent control media control) x 100%.
To study the off-rate of the variant Q5 peptide, the assay was modified as follows: targets (B cell lines) were pulsed with 10 µM peptide and then washed twice and incubated for varying time periods, as shown. The cells were then harvested, labeled with Chromium, and washed before culturing with CTL clones.
T Cell Receptor Sequence Analysis.
RNA was extracted using Tri-Reagent from CTL clones or from FACS-sorted PBMC after staining with the FL8 tetramer and subjected to an RT-PCR amplification technique with a switching mechanism at the 5' end of the RNA transcripts (28). This was performed with C-region
primer: TCRAC: GTCCATAGACCTCATGTCTAGCACAG and a C-region ß primer: TCRBC: ATTCACCCACCAGCTCAGCTCCACG.
Sequencing was performed with gel-purified PCR products using the dideoxy chain-termination method on a Megabase 1000 in the Wellcome Trust Centre for Human Genetics and in the MRC Human Immunology Unit sequencing facility.
Confirmation of TCR CDR3 Sequence from Tetramer-sorted Cells.
FL8 tetramerpositive cells from donor 005 were sorted using anti-PE magnetic beads (Miltenyi Biotec). mRNA from sorted cells was extracted using a Microfast RNA isolation kit (Invitrogen) and cDNA was synthesized using a Smart PCR cDNA synthesis kit (CLONTECH Laboratories, Inc.). PCR was performed with a Vß13.2-specific primer: TGGTGAGGGTACAACTGCC and a 3' C-region primer Cß: AGGCGGCTGCTCAGGCAGTATCTGGAGTCA, with optimized cycles. The PCR products were then purified and put into TOPO TA cloning vectors (Invitrogen). Plasmid DNAs from 20 colonies containing inserts of the correct size were then sequenced in the MRC Human Immunology Unit sequencing facility.
TCR Affinity Measurement Using Surface Plasmon Resonance.
Residues 1201 and 1247 from the
- and ß-chains, respectively, were cloned into Pett22b+ (Novagen), where the
-chain was in frame with the COOH-terminal vector his6 tag. Residues
threonine 159 and ß threonine 174 were mutated to cysteines and the protein expressed in recA derivative BL21 (BLR) strain Escherichia Coli (Novagen) as inclusion bodies. Soluble TCR protein was refolded and purified as described (15) and diluted to 0.106, 0.313, 0.625, 1.25, 2.5, 5, 10, 20, 40, and 80 µM in Hepes-buffered saline (Biacore) and injected at a flow rate of 10 µl/min over Research Grade CM5 Sensor chip surfaces onto which
1,000 response units of B8-nef or B8nef-Q5 mutant proteins had been immobilized. Both pMHC class I proteins were enzymatically biotinylated on the COOH terminus and size purified on a Superdex 200 before immobilization on streptavidin-coupled flow cells. Simultaneous data collection from single TCR injections for both pMHCs allowed for direct comparison of binding parameters.
| Results |
|---|
|
|
|---|
Sequence Similarities in the Vß13.2 T Cell Receptors Used by Different Individuals in the B8 nef Response.
CTL clones were generated from all four donors and all but one expressed TCR Vß13.2. Vß usage in the non-Vß13.2 population was generally heterogeneous, but in donor 046 was dominated by usage of Vß6: a single Vß6-expressing clone was generated from this donor. The T cell receptor sequences of these clones were determined (Table II) and clones expressing identical Vß13.2 TCRs were found in samples taken at time-points between 4 and 6 mo apart in donors 005 and 200. The CDR3 was defined as starting at position 95 of Vß and finishing at the phenylalanine of the motif FGXG within Jß, as described previously (30). There was a surprising degree of homology in both the length and sequence of the ß-chain CDR3 region of CTL clones from these unrelated donors. A striking feature was the length of the CDR3 region, which unusually incorporated the entire Jß segment and was either 15 or 16 amino acids in length. Analysis of the
-chain sequences revealed no similar conservation. It proved very difficult to generate clones that did not use Vß13.2, but the single Vß6-expressing clone generated from donor 046 showed a shorter CDR3 loop, in keeping with the sequences of other TCRs, which have a median CDR3 length of 9.7 residues (31).
|
Vß13.2 Usage for B8-restricted CTL May Be Selected in Primary HIV-1 Infection But Is Not Seen in Rapid Progressors.
The B8 nef FL8 response is an immunodominant response in both acute primary HIV-1 infection (21) and during chronic infection (7): however, not all donors making this response selected a Vß13.2 TCR with a similarly long CDR3 region. We examined three donors with advanced HIV-1 disease progression: one was a rapid progressor from the King's College Hospital cohort and two were donors from the Oxford Clinic who remained asymptomatic but had progressed to a CD4+ T cell count of 200/mm3. All three donors generated a substantial population of FL8-specific cells measured using the B8-FL8 tetramer but no Vß13.2+ responding cells (Fig. 1). We then examined cells from patients who had been referred to the San Diego AIDS Treatment Center and were defined as having primary HIV-1 infection on the basis of a symptomatic viral illness after high risk sexual exposure to HIV with detectable plasma HIV RNA and nonreactive HIV antibody test or indeterminate Western blot assay. 5 out of 10 HLAB8+ donors with primary HIV-1 infection who had FL8 tetramer responses showed a variable degree of Vß13.2 usage (between 6 and 100%). However, when tetramer-staining cells were sorted and the TCR sequence was determined, only one donor had selected a Vß13.2 TCR with a similar CDR3 loop sequence to the four long-term survivors. Because most of these patients were given ART early in the course of HIV-1 infection it is not possible to correlate TCR usage with clinical outcome in this cohort: however, these data suggest that selection of a Vß13.2 TCR with a homologous CDR3 region is an uncommon event.
|
|
secretion (Fig. 3 a). However, the non-Vß13.2 population responded exclusively to the index epitope. This result was confirmed using an antibody against Vß6, which stains all the remaining non-Vß13.2 B8 nef tetramerpositive cells in donor 046. Only the non-Vß6 population responded to the Q5 variant, whereas both Vß6-positive and -negative populations secreted IFN-
in response to the index peptide (unpublished data). We generated Vß13.2-expressing CTL clones from all four donors and these were able to respond to variant peptides Q5, T5, N5, and M5: however, a single CTL clone from donor 046 that did not express the Vß13.2 TCR recognized only the index variant (Fig. 3 b). Peptide titrations revealed significant differences between 046 clones with and without the Vß13.2 TCR in their ability to recognize the most common Q5 variant (Fig. 3 c). Further studies using three additional non-Vß13.2 FL8-specific CTL clones generated from some of the seroconverter donors showed recognition only of the index variant and not of peptides with substitutions (Q, T, and M) for lysine at position 5 (unpublished data).
|
Taken together, these data show that the Vß13.2 TCR has the ability to recognize the most common database variants that would otherwise escape the dominant FL8 CTL response. In the absence of a selective advantage for viral variants expressing mutations in the P5 position of the FL8 epitope, we predicted that there would be limited sequence variation in this region in viral isolates from donors with the Vß13.2 TCR. In keeping with this hypothesis, sequence analysis of proviral DNA in all four long-term surviving donors showed only the index sequence at the FL8 epitope.
The Vß13.2 TCR Shows Moderately Strong Affinity for Both the Index and Q5 Variant of the FL8 Epitope.
Recent biochemical and structural data for the immunodominant Vß17 TCR (JM22) responding to an influenza matrix peptide presented by HLAA2 have shown that this TCR has an affinity at the higher end of the range exhibited for TCR binding to peptideHLA (15, 33). We used surface plasmon resonance analysis to determine the binding affinity of the Vß13.2 TCR for HLAB8 complexed with both the index FL8 peptide and the Q5 variant. Analysis of equilibrium-binding data by direct nonlinear curve fitting of the 1:1 Langmuir-binding equation and by Scatchard plots indicated that the KD values for the wild-type and Q5 mutant epitopes were 3.4 and 13.1 µM, respectively, at 25°C (Fig. 4). This demonstrates that the binding affinities of the Vß13.2 TCR for both index and variant peptides are in the middle of the range of TCR-binding affinities reported for functional TCRMHC class I recognition (34). Similar studies were undertaken using the Vß6 TCR generated from donor 046, which showed a lower affinity for the index peptide (35 µM) and an affinity for HLAB8 complexed with the Q5 variant peptide likely to be outside the range for T cell recognition (66 µM).
|
| Discussion |
|---|
|
|
|---|
The capacity of HIV to mutate in order to escape CTL recognition from the earliest stages of infection has been well described in both human studies (21, 35) and in the simian immunodeficiency virus (SIV)infected macaque model (36). The ability of emerging viral variants to evade dominant CTL responses may pose a significant problem for vaccine strategies (37). Indeed the impact of HLA-associated selection pressure on viral evolution has recently been demonstrated at the population level (38), clearly demonstrating the potential of CTL selection to shape the emerging viral quasispecies. The immunodominant CTL response to the FL8 epitope has been detected shortly after seroconversion and was associated with the emergence of viral variants with coding changes in the epitope over the ensuing 6 mo (21). The majority of epitope variants had changes at position 5 of the epitope that were poorly recognized by the patient's own CTL. The findings of Price and colleagues suggest that although the FL8 epitope is highly immunogenic, the effectiveness of the response is limited by the ability of the virus to generate variants that escape the host CTL response. Our observation that only 1 out of 10 seroconverters who mounted an FL8 response selected a TCR with a homologous ß chain to the Vß13.2 TCR seen in the four long-term survivors suggests that only a minority of donors can mount a CTL response capable of recognizing FL8 epitope variants.
When epitope variation abrogates binding of the peptide to the HLA molecule, all T cell populations will be equally affected, but epitope variants that impact on the interaction between the TCR and the peptide-HLA complex may be tolerated by some TCRs and not by others. We have recently shown that CTL specific for an immunodominant gag epitope restricted by HLAB57, an HLA molecule consistently shown to be associated with delayed HIV-1 disease progression, show a significant degree of tolerance to the common viral variants of this epitope (39), a phenomenon that may contribute to better viral control. The apparent association between expression of the Vß13.2 TCR and delayed disease progression in this study could indicate that the capacity to generate a B8 nef response that includes this TCR facilitates viral control. Although P5 of the FL8 peptide is an anchor residue that mediates binding to the HLAB8 molecule rather than being exposed for direct TCR recognition (40), it is likely that the substitution of lysine for other residues induces a conformational change at the surface of the peptideHLA complex that could affect TCR recognition of the bound peptide. The structure of HLAB8 complexed with another HIV-1 peptide, GGKKKYKL from gag p17, showed that substitutions at the P3 anchor position caused significant structural alterations at the surface of the peptideHLA complex, whereas changes at P5 had more modest conformational impact (40). Similarly, crystal structures of HLA B8 complexed to the index FL8 and Q5 variant peptides (unpublished data) again show that the peptide anchor side chain (lysine) at P5 points downward and is involved in stabilizing the peptide in the groove. The exposed peptide backbone conformation shows no significant differences between the index FL8 and Q5 variant, but glutamine acts less efficiently as an anchor residue, leading to increased mobility of the bound peptide. Our studies to determine the stability of the HLAB8 complexed with either index or Q5 peptide by assessing how long peptide-pulsed cells remain CTL targets confirm reduced stability of the the complex with the variant peptide, but we propose that cells expressing the variant epitope could nevertheless be recognized by T cells expressing a sufficiently high affinity TCR.
The human T cell receptor
-and ß-chains are derived through the selection and rearrangement of a large number of variable (V), diversity (D), and joining (J) gene segments: further complexity is conferred by the addition of N region nucleotide diversity in the junctional region. The hypervariable CDR3 region spans this junctional region and in a number of MHCTCR crystal structures has been shown to interact directly with the peptide epitope held in the cleft of the MHC class I molecule. The length of the CDR3 region is relatively conserved in the human TCR repertoire with a mean of 9.7 residues (standard deviation 1.7) for both
and ß chains (31), in contrast to the Vß13.2 TCR, which has a CDR3 length of 16 amino acids. The CDR3 region of the ß-chain predominantly contacts the COOH-terminal half of the peptide, so the advantage of this TCR may be the flexibility of the long CDR3 region, allowing it to tolerate viral mutations that alter the conformation of the epitope at position 5 of the peptide. The binding data for this TCR show that it has an affinity for HLAB8 complexed with the index peptide in the middle of the range reported for other TCRs: thus it is not an unusually high affinity TCR but has similar properties to others studied to date. The affinity of this TCR for B8 and the Q5 peptide is lower, but still well within the range described for other TCRs. In contrast, the single non-Vß13.2 TCR that we have been able to generate with specificity for the FL8 peptide shows a lower affinity for the B8 index peptide complex (despite the similar peptide titrations in conventional CTL assays) and an affinity for the mutant peptide that is almost certainly outside the range for T cell recognition. These data provide some explanation for the immunodominance of the Vß13.2 TCR and the extent of cross-reactivity that it exhibits.
Why should expression of this TCR be associated with an enhanced ability to proliferate and a striking resistance to apoptosis compared with the majority of HIV-specific T cell populations? We noted that this functional phenotype was associated with the up-regulation of the antiapoptotic molecule Bcl-2. Although detailed crystallographic data of the HLAB8 molecule complexed with the Vß13.2 TCR are still awaited, it is plausible that the stability of the TCRpeptideHLA complex formed by the Vß13.2 TCR confers certain survival properties on the memory T cell population as a function of prolonged stimulation, as recently suggested by Gett and colleagues (41) .
The potential repertoire of different
ß T cells is thought to be between 1015 and 1020, far exceeding the 1012 lymphocytes in the adult human. Random selection of a restricted T cell response in unrelated individuals is therefore highly unlikely and has not been described previously in HIV-1 infection. In primary HIV-1 infection, a narrow oligoclonal CD8+ response in acute infection is associated with more rapid disease progression, thought to be due to limited ability to respond to viral escape variants (18). Recent studies have highlighted the diversity of T cells that respond to the same epitope within and between individuals: analysis of TCR usage in the HLAA2-restricted response to a dominant epitope in p17 gag suggested that the repertoire is selected for its ability to respond to emerging viral variants, with the response to a single epitope in one donor eliciting 15 distinct clonotypes (20). Other studies have shown oligoclonal TCR usage in tetramer-staining HIV-specific populations but no common features of TCR usage for HLAA2 and B27-restricted HIV-specific responses between different individuals (19, 42). In chronic SIV infection, the immunodominant response to SIV gag restricted by Mamu-A*01 is oligoclonal with a preference for Vß13 and conserved CDR3 usage (43): however, TCR usage can vary over time and a single dominant clone has not been identified (44).
Highly restricted TCR usage has been described in the human CTL responses to influenza A matrix in individuals with HLAA2, which is dominated by Vß17 and V
10 usage (14), and in EBV infection, in which donors with HLAB8 exhibit striking TCR conservation of both
and ß chains in their response to an immunodominant epitope in EBNA 3A (16). Our findings in HIV-1 infection differ in several regards. First, selection for the Vß13.2 TCR is confined to the ß-chain with no restriction on
-chain usage: the advantage of the Vß13.2 TCR may lie principally in its potential to recognize variants in the COOH-terminal part of the peptide. Second, highly conserved TCR usage is seen in most indivuals with HLAA2 and CTL responses to influenza matrix, or HLAB8 and CTL responses to EBV EBNA-3, whereas our studies in primary HIV-1 infection suggest that only a minority of infected people with a strong response to the FL8 epitope can select a Vß13.2 TCR homologous to the TCRs from the four long-term survivors. Although the number of patients we have been able to study is relatively small, given the frequency of HLAB8 (which is not enriched in LTNP cohorts), the four donors we identified with large populations of Vß13.2 TCR B8 nef-specific CD8+ T cells have all shown significantly delayed disease progression, suggesting that the ability to select this TCR may be linked with enhanced viral control. Although further studies with larger numbers of patients are needed to provide support for this hypothesis, we propose that individuals who are able to mount an HLAB8-restricted response that includes the Vß13.2 TCR have a greater ability to control viral replication by limiting the advantage of potential CTL escape variants.
| Acknowledgments |
|---|
The Medical Research Council (UK) funded researchers T. Dong, Sarah Rowland-Jones, A.J. McMichael, X. Xu, G. Screaton, N. Chen, G. Stewart-Jones, E.Y. Jones, A. van der Merwe, and P. Easterbrook. D.D. Richman, S. Little, and C. Spina were supported by grants AI 27670, AI 38858, AI 43638, UCSD Center for AIDS Research (AI 36214), AI 29164 from the National Institutes of Health, and the Research Center for AIDS and HIV Infection of the San Diego Veterans Affairs Healthcare System. Additional institutional support provided by the State of California's University-wide AIDS Research Program (IS02-SD-701). Yvonne Jones is a Cancer Research UK Principal Research Fellow.
The authors have no conflicting financial interests.
Submitted: 25 November 2003
Accepted: 4 November 2004
| References |
|---|
|
|
|---|
1 Deacon, N.J., A. Tsykin, S.K. Smith, M. Ludford-Menting, D.J. Hooker, D.A. McPhee, A.L. Greenway, A. Ellett, C. Chatfield, V.A. Lawson, et al. 1995. Genomic structure of an attenuated quasi species of HIV-1 from a blood transfusion donor and recipients. Science. 270:988991.
2 O'Brien, S.J., G.W. Nelson, C.A. Winkler, and M.W. Smith. 2000. Polygenic and multifactorial disease gene association in man: lessons from AIDS. Annu. Rev. Genet. 34:563591.[CrossRef][Medline]
3 Easterbrook, P.J. 1999. Long-term non-progression in HIV infection: definitions and epidemiological issues. J. Infect. 38:7173.[CrossRef][Medline]
4 Rosenberg, E.S., J.M. Billingsley, A. Caliendo, S.L. Boswell, P.E. Sax, S.A. Kalams, and B.D. Walker. 1997. Vigorous HIV-1-specific CD4+ T-cell responses associated with control of viraemia. Science. 278:14471450.
5 Pantaleo, G., S. Menzo, M. Vaccarezza, C. Graziosi, O. Cohen, J. Demarest, D. Montefiori, J. Orenstein, C. Fox, L. Schrager, et al. 1995. Studies in subjects with long-term nonprogressive HIV infection. N. Engl. J. Med. 332:209216.
6 Rinaldo, C., X.-L. Huang, Z. Fan, M. Ding, L. Beltz, A. Logar, D. Panicali, G. Mazzara, J. Liebmann, M. Cottrill, and P. Gupta. 1995. High levels of anti-HIV-1 memory CTL activity and low viral load are associated with lack of disease in HIV-1-infected long-term non-progressors. J. Virol. 69:58385842.[Abstract]
7 Papagno, L., V. Appay, J. Sutton, T. Rostron, G.M. Gillespie, G.S. Ogg, A. King, A.T. Makadzanhge, A. Waters, C. Balotta, et al. 2002. Comparison between HIV- and CMV-specific T cell responses in long-term HIV infected donors. Clin. Exp. Immunol. 130:509517.[CrossRef][Medline]
8 Addo, M.M., X.G. Yu, A. Rathod, D. Cohen, R.L. Eldridge, D. Strick, M.N. Johnston, C. Corcoran, A.G. Wurcel, C.A. Fitzpatrick, et al. 2003. Comprehensive epitope analysis of human immunodeficiency virus type 1 (HIV-1)-specific T-cell responses directed against the entire expressed HIV-1 genome demonstrate broadly directed responses, but no correlation to viral load. J. Virol. 77:20812092.
9 McMichael, A.J., and S.L. Rowland-Jones. 2001. Cellular immune responses to HIV. Nature. 410:980987.[CrossRef][Medline]
10 Appay, V., D.F. Nixon, S.M. Donahoe, G.M. Gillespie, T. Dong, A. King, G.S. Ogg, H.M. Spiegel, C. Conlon, C.A. Spina, et al. 2000. HIV-specific CD8(+) T cells produce antiviral cytokines but are impaired in cytolytic function. J. Exp. Med. 192:6375.
11 Kostense, S., G.S. Ogg, E.H. Manting, G. Gillespie, J. Joling, K. Vandenberghe, E.Z. Veenhof, D. Baarle Dv, S. Jurriaans, M.R. Klein, and F. Miedema. 2001. High viral burden in the presence of major HIV-specific CD8(+) T cell expansions: evidence for impaired CTL effector function. Eur. J. Immunol. 31:677686.[CrossRef][Medline]
12 Appay, V., P.R. Dunbar, M. Callan, P. Klenerman, G.M. Gillespie, L. Papagno, G.S. Ogg, A. King, F. Lechner, C.A. Spina, et al. 2002. Memory CD8+ T cells vary in differentiation phenotype in different persistent virus infections. Nat. Med. 8:379385.[CrossRef][Medline]
13 Lieberman, J., P. Shankar, N. Manjunath, and J. Andersson. 2001. Dressed to kill? A review of why antiviral CD8 T lymphocytes fail to prevent progressive immunodeficiency in HIV-1 infection. Blood. 98:16671677.
14 Moss, P.A.H., R.J. Moots, W.M.C. Rosenberg, S.J. Rowland-Jones, A.J. McMichael, and J.I. Bell. 1991. Extensive conservation of alpha and beta chains of the human T cell antigen receptor recognizing HLA-A2 and influenza matrix peptide. Proc. Natl. Acad. Sci. USA. 88:89878991.
15 Stewart-Jones, G.B., A.J. McMichael, J.I. Bell, D.I. Stuart, and E.Y. Jones. 2003. A structural basis for immunodominant human T cell receptor recognition. Nat. Immunol. 4:657663.[CrossRef][Medline]
16 Argaet, V.P., C.W. Schmidt, S.R. Burrows, S.L. Silins, M.G. Kurilla, D.L. Doolan, A. Suhrbier, D.J. Moss, E. Kieff, T.B. Suclley, et al. 1994. Dominant selection of an invariant T cell antigen receptor in response to persistent infection by Epstein-Barr virus. J. Exp. Med. 180:23352340.
17 Kjer-Nielsen, L., C.S. Clements, A.W. Purcell, A.G. Brooks, J.C. Whisstock, S.R. Burrows, J. McCluskey, and J. Rossjohn. 2003. A structural basis for the selection of dominant alphabeta T cell receptors in antiviral immunity. Immunity. 18:5364.[CrossRef][Medline]
18 Pantaleo, G., J.F. Demarest, H. Soudeyns, C. Graziosi, F. Denis, J.W. Adelsberger, P. Borrow, M.S. Saag, G.M. Shaw, R.P. Sekaly, and A.S. Fauci. 1994. Major expansion of CD8+ T cells with a predominant Vb usage during the primary immune response to HIV. Nature. 370:463467.[CrossRef][Medline]
19 Wilson, J.D.K., G.S. Ogg, R.L. Allen, P.J.R. Goulder, A. Kelleher, A.K. Sewell, C.A. O'Callaghan, S.L. Rowland-Jones, M.F.C. Callan, and A.J. McMichael. 1998. Oligoclonal expansions of CD8(+) T cells in chronic HIV infection are antigen specific. J. Exp. Med. 188:785790.
20 Douek, D.C., M.R. Betts, J.M. Brenchley, B.J. Hill, D.R. Ambrozak, K.L. Ngai, N.J. Karandikar, J.P. Casazza, and R.A. Koup. 2002. A novel approach to the analysis of specificity, clonality, and frequency of HIV-specific T cell responses reveals a potential mechanism for control of viral escape. J. Immunol. 168:30993104.
21 Price, D.A., P.J. Goulder, P. Klenerman, A.K. Sewell, P.J. Easterbrook, M. Troop, C.R. Bangham, and R.E. Phillips. 1997. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proc. Natl. Acad. Sci. USA. 94:18901895.
22 Easterbrook, P.J., and L.K. Schrager. 1998. Long-term nonprogression in HIV infection: methodological issues and scientific priorities. Report of an international European community-National Institutes of Health Workshop, The Royal Society, London, England, November 2729, 1995. Scientific Coordinating Committee. AIDS Res. Hum. Retroviruses. 14:12111228.[Medline]
23 Bunce, M., C.M. O'Neill, M.C. Barnardo, P. Krausa, M.J. Browning, P.J. Morris, and K.I. Welsh. 1995. Phototyping: comprehensive DNA typing for HLA-A, B, C, DRB1, DRB3, DRB4, DRB5 & DQB1 by PCR with 144 primer mixes utilizing sequence-specific primers. Tissue Antigens. 46:355367.[Medline]
24 Altman, J., P.A.H. Moss, P. Goulder, D. Barouch, M. McHeyzer-Williams, J.I. Bell, A.J. McMichael, and M.M. Davis. 1996. Direct visualization and phenotypic analysis of virus-specific T lymphocytes in HIV-infected individuals. Science. 274:9496.
25 Lalvani, A., R. Brookes, S. Hambleton, W.J. Britton, A.V. Hill, and A.J. McMichael. 1997. Rapid effector function in CD8+ memory T cells. J. Exp. Med. 186:859865.
26 Gorczyca, W., J. Gong, and Z. Darzynkiewicz. 1993. Detection of DNA strand breaks in individual apoptotic cells by the in situ terminal deoxynucleotidyl transferase and nick translation assays. Cancer Res. 53:19451951.
27 Dong, T., D. Boyd, W. Rosenberg, N. Alp, M. Takiguchi, A.J. McMichael, and S.L. Rowland-Jones. 1996. Increased affinity for HLA-B35 of an influenza A epitope modified at an "anchor" residue results in an antagonist peptide. Eur. J. Immunol. 26:335339.[Medline]
28 Zhu, Y.Y., E.M. Machleder, A. Chenchik, R. Li, and P.D. Siebert. 2001. Reverse transcriptase template switching: a SMART approach for full-length cDNA library construction. Biotechniques. 30:892897.[Medline]
29 Easterbrook, P.J., T. Rostron, N. Ives, M. Troop, B.G. Gazzard, and S.L. Rowland-Jones. 1999. Chemokine receptor polymorphisms and human immunodeficiency virus disease progression. J. Infect. Dis. 180:10961105.[CrossRef][Medline]
30 Kabat, E.A., and T.T. Wu. 1991. Identical V region amino acid sequences and segments of sequences in antibodies of different specificities. Relative contributions of VH and VL genes, minigenes, and complementarity-determining regions to binding of antibody-combining sites. J. Immunol. 147:17091719.[Abstract]
31 Moss, P.A., and J.I. Bell. 1996. Comparative sequence analysis of the human T cell receptor TCRA and TCRB CDR3 regions. Hum. Immunol. 48:3238.[CrossRef][Medline]
32 Xu, X.-N., G.R. Screaton, F.M. Gotch, T. Dong, R. Tan, N. Almond, B. Walker, R. Stebbings, K. Kent, S. Nagata, et al. 1997. Evasion of CTL responses by nef-dependent induction of Fas ligand expression on SIV-infected cells. J. Exp. Med. 186:716.
33 Wilson, S.E., S.L. Pedersen, J.C. Kunich, V.L. Wilkins, D.L. Mann, G.P. Mazzara, J. Tartaglia, C.L. Celum, and H.W. Sheppard. 1998. Cross-clade envelope glycoprotein 160-specific CD8+ cytotoxic T lymphocyte responses in early HIV type 1 clade B infection. AIDS Res. Hum. Retroviruses. 14:925937.[Medline]
34 van der Merwe, P.A., and S.J. Davis. 2003. Molecular interactions mediating T cell antigen recognition. Annu. Rev. Immunol. 21:659684.[CrossRef][Medline]
35 Phillips, R.E., S.L. Rowland-Jones, D.F. Nixon, F.M. Gotch, J.P. Edwards, A.O. Ogunlesi, J.G. Elvin, J.A. Rothbard, C.R. Bangham, C.R. Rizza, and A.J. McMichael. 1991. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature. 354:453459.[CrossRef][Medline]
36 Allen, T.M., D.H. O'Connor, P. Jing, J.L. Dzuris, B.R. Mothe, T.U. Vogel, E. Dunphy, M.E. Liebl, C. Emerson, N. Wilson, et al. 2000. Tat-specific cytotoxic T lymphocytes select for SIV escape variants during resolution of primary viraemia. Nature. 407:386390.[CrossRef][Medline]
37 Barouch, D.H., J. Kunstman, M.J. Kuroda, J.E. Schmitz, S. Santra, F.W. Peyerl, G.R. Krivulka, K. Beaudry, M.A. Lifton, D.A. Gorgone, et al. 2002. Eventual AIDS vaccine failure in a rhesus monkey by viral escape from cytotoxic T lymphocytes. Nature. 415:335339.[CrossRef][Medline]
38 Moore, C.B., M. John, I.R. James, F.T. Christiansen, C.S. Witt, and S.A. Mallal. 2002. Evidence of HIV-1 adaptation to HLA-restricted immune responses at a population level. Science. 296:14391443.
39 Gillespie, G.M., R. Kaul, T. Dong, H.B. Yang, T. Rostron, J.J. Bwayo, P. Kiama, T. Peto, F.A. Plummer, A.J. McMichael, and S.L. Rowland-Jones. 2002. Cross-reactive cytotoxic T lymphocytes against a HIV-1 p24 epitope in slow progressors with B*57. AIDS. 16:961972.[CrossRef][Medline]
40 Reid, S.W., S. McAdam, K.J. Smith, P. Klenerman, C.A. O'Callaghan, K. Harlos, B.K. Jakobsen, A.J. McMichael, J.I. Bell, D.I. Stuart, and E.Y. Jones. 1996. Antagonist HIV-1 Gag peptides induce structural changes in HLA B8. J. Exp. Med. 184:22792286.
41 Gett, A.V., F. Sallusto, A. Lanzavecchia, and J. Geginat. 2003. T cell fitness determined by signal strength. Nat. Immunol. 4:355360.[CrossRef][Medline]
42 Moss, P.A.H., S.L. Rowland-Jones, P.M. Frodsham, S. McAdam, P. Giangrande, A.J. McMichael, and J.I. Bell. 1995. Persistent high frequency of human immunodeficiency virus-specific cytotoxic T cells in peripheral blood of infected donors. Proc. Natl. Acad. Sci. USA. 92:57735777.
43 Chen, Z.W., L. Shen, J.D. Regan, Z. Kou, S.H. Ghim, and N.L. Letvin. 1996. The T cell receptor gene usage by simian immunodeficiency virus gag-specific cytotoxic T lymphocytes in rhesus monkeys. J. Immunol. 156:14691475.[Abstract]
44 Chen, Z.W., Y. Li, X. Zeng, M.J. Kuroda, J.E. Schmitz, Y. Shen, X. Lai, L. Shen, and N.L. Letvin. 2001. The TCR repertoire of an immunodominant CD8+ T lymphocyte population. J. Immunol. 166:45254533.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|