Published 18 August 2003. doi:10.1084/jem.20030767
© Rockefeller University Press,
0022-1007/2003/8/635 $5.00
The Journal of Experimental Medicine, Volume 198, Number 4, 635-643
129-derived Strains of Mice Are Deficient in DNA Polymerase
and Have Normal Immunoglobulin Hypermutation
John P. McDonald1,
Ekaterina G. Frank1,
Brian S. Plosky1,
Igor B. Rogozin2,
Chikahide Masutani3,
Fumio Hanaoka3,4,
Roger Woodgate1 and
Patricia J. Gearhart5
1 Section on DNA Replication, Repair, and Mutagenesis, Laboratory of Genomic Integrity, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD 20892
2 National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, MD 20894
3 Graduate School of Frontier Biosciences, Osaka University, and CREST, Japan Science and Technology Corporation, 1-3 Yamada-oka, Suita, Osaka 565-0871, Japan
4 RIKEN (The Institute of Physical and Chemical Research), Wako-shi, Saitama 351-0198, Japan
5 Laboratory of Molecular Gerontology, National Institute on Aging, National Institutes of Health, Baltimore, MD 21224
Address correspondence to Roger Woodgate, Laboratory of Genomic Integrity, Building 6, Room 1A13, NICHD, NIH, 9000 Rockville Pike, Bethesda, MD 20892-2725. Phone: 301-496-6175; Fax: 301-594-1135; email: woodgate{at}helix.nih.gov
 |
Abstract
|
|---|
Recent studies suggest that DNA polymerase
(pol
) and DNA polymerase
(pol
) are involved in somatic hypermutation of immunoglobulin variable genes. To test the role of pol
in generating mutations in an animal model, we first characterized the biochemical properties of murine pol
. Like its human counterpart, murine pol
is extremely error-prone when catalyzing synthesis on a variety of DNA templates in vitro. Interestingly, when filling in a 1 base-pair gap, DNA synthesis and subsequent strand displacement was greatest in the presence of both pols
and
. Genomic sequence analysis of Poli led to the serendipitous discovery that 129-derived strains of mice have a nonsense codon mutation in exon 2 that abrogates production of pol
. Analysis of hypermutation in variable genes from 129/SvJ (Poli-/-) and C57BL/6J (Poli+/+) mice revealed that the overall frequency and spectrum of mutation were normal in pol
-deficient mice. Thus, either pol
does not participate in hypermutation, or its role is nonessential and can be readily assumed by another low-fidelity polymerase.
Key Words: genomic organization immunoglobulin variable genes DNA polymerase
cytosine deamination base excision repair
 |
Introduction
|
|---|
The recent discovery of the Y-family of DNA polymerases (1) has provoked much investigation of their biochemical properties when they replicate damaged and undamaged DNA templates (25). One of the better characterized members of this large family is pol
. Both Saccharomyces cerevisiae and human orthologs of pol
can efficiently synthesize past various types of DNA damage (69), because their active sites are more accessible to solvents than that of a high fidelity polymerase (10). Humans with defects in their POLH gene are afflicted with the xeroderma pigmentosum variant (XP-V) phenotype, which is characterized by an increased sensitivity to ultraviolet light and sunlight-induced skin cancers (11). Thus, pol
has an important biological role in protecting us from the deleterious effects of sunlight. Furthermore, as a result of its nonrestrictive catalytic site, pol
misincorporates nucleotides on undamaged templates (1214). Pol
has been implicated in somatic hypermutation of antibodies, as immunoglobulin variable (V) genes from XP-V patients have an altered spectrum of mutations (15, 16), which is consistent with the types of mutations generated by pol
in vitro (17, 18).
In addition to pol
, humans possess three other Y-family polymerases, pols
,
, and Rev1, with pol
being the most closely related to pol
(19). Human pol
has a limited ability to replicate past DNA lesions in vitro, suggesting that it is not as efficient as pol
in translesion synthesis (20, 21). However, unlike pol
, pol
possesses a 5' dRP lyase activity and may participate in a specialized form of base excision repair (22). Perhaps the most striking property of pol
in vitro is its infidelity when replicating undamaged DNA. It is most error-prone when copying template T, where the enzyme misincorporates dGMP by 3- to 10-fold over the correct Watson and Crick base, dAMP (2226). The biological function of pol
remains unknown, and no human disease or repair-related deficiency has been directly linked to mutations in the POLI gene. Because of its extreme low-fidelity in copying undamaged DNA, pol
is a good candidate for introducing mutations into V genes (23, 27). Indeed, during the course of our studies, Faili et al. (28) reported that a human Burkitt lymphoma cell line (BL2), with a homozygous deletion of both POLI alleles, is deficient in somatic hypermutation. As the first step toward understanding the biological function of pol
in a whole-animal system, we assayed the frequency and pattern of mutations in V regions from the heavy chain locus in pol
-deficient mice and compared them to similar data from pol
-proficient mice.
 |
Materials and Methods
|
|---|
Overexpression and Purification of Mouse Pol
and Pol
.
Cloning of the full-length mouse Poli cDNA in plasmid pJM297, has been described previously (19). An
2.8-kb NcoI to PsiI fragment from pJM297 was subcloned into the baculovirus expression vector pJM296 (23) that had been digested with NcoI and SmaI, to create the GST-Poli fusion construct, pJM306. GST-tagged mouse pol
was overexpressed in SF9 insect cells infected with pJM306-derived baculovirus, and subsequently purified by Glutathione-agarose affinity chromatography and hydroxylapatite chromatography as previously described for the GST-tagged human pol
(23). Histidine-tagged murine pol
was overproduced and purified as described previously (29).
DNA Templates.
The synthetic oligonucleotides used as primers or templates in the in vitro replication assays were synthesized by Loftstrand Laboratories using standard techniques and were gel-purified before use. The sequence of each oligonucleotide is given in the legend of each figure. Primers were 5'-labeled with [
-32P]ATP (5000 Ci/mmol; 1 Ci = 37 GBq; Amersham Biosciences) using T4 polynucleotide kinase (Invitrogen).
Replication Reactions.
Radiolabeled primer-template DNAs were prepared by annealing the 5'-32P labeled primer to the unlabeled template DNA at a molar ratio of 1:1.5. For gapped templates, a second unlabeled oligonucleotide was also annealed to the template in a ratio of 1:2. Standard replication reactions (10 µl) contained 40 mM Tris
HCl pH 8.0, 5 mM MgCl2, 100 µM of each ultrapure dNTP (Amersham Biosciences), 10 mM ß-mercaptoethanol, 250 µg/ml BSA, 2.5% glycerol, 10 nM 5'-[32P] primer-template DNA, and 3 nM GST-Pol
. Reactions were incubated at 37°C for 30 min (unless noted otherwise), and reactions were terminated by the addition of 10 µl of 95% formamide/10 mM EDTA containing 0.1% xylene cyanol and 0.1% Bromophenol blue. Samples were heated to 100°C for 5 min and 5 µl of the reaction mixture was added to 20% polyacrylamide/7 M urea gels and separated by electrophoresis. Replication products were subsequently visualized by PhosphorImager analysis (FujiFilm Software Inc.).
Identification and Genomic Sequence of a Mouse Pol
BAC Clone.
A BAC clone, 12337 (Incyte Genomics), containing
100 to 120 kb of DNA encompassing the mouse Poli genomic region was isolated by screening a BAC clone library using a mouse Poli EST (GenBank/EMBL/DDBJ accession no. AA162008) as a probe. The 12337 BAC clone was then subjected to random "shotgun" sequencing (NHGRI, NIH, Bethesda, MD). An approximate 36 kb DNA sequence of the mouse genome encompassing Poli has been deposited in GenBank and assigned the accession nos. AF489425 and AF489426.
PCR Genotyping of Murine Poli Codon 27.
To identify mutant or wild-type alleles of codon 27, an 88-bp fragment of mouse Poli exon 2 was amplified from mouse genomic DNA using the following forward (5'CAGTTTGCAGTCAAGGGCC) and reverse (5'TCGACCTGGGCATAAAAGC) primers. PCR amplifications were performed in a 20 µl reaction using AmpliTaq DNA polymerase (PE Biosystems) and 100200 ng of genomic DNA with standard reaction conditions as suggested by the manufacturer. The reaction was performed for 45 cycles at 95°C for 30 s, 57°C for 30 s, and 72°C for 1 min. A 10 µl aliquot from the completed PCR reaction was then treated with TaqI and incubated at 65°C for 1 h. The TaqI-treated and untreated portions of the PCR reaction were separated on a 6% polycrylamide gel (Invitrogen), and stained with ethidium bromide. Genomic DNAs from various strains of mice were obtained from The Jackson Laboratory (C57BL/6J, 129/J, 129/SvJ, 129/ReJ); Novagen (BALB/c, ICR Swiss); or as a generous gift from Gilbertus van der Horst (Erasmus University, Rotterdam, The Netherlands; 129/Ola).
Testis Extracts and Western Blot Analysis.
Testis tissues from various 129 or C57BL/6 mice were provided as a generous gift by Eric Wawrousek (National Eye Institute, NIH, Bethesda, MD) or purchased from The Jackson Laboratory. Protein extracts from mouse testis were prepared from frozen whole testes. The testes were thawed on ice in lysis buffer consisting of 9 M urea, 4% Nonidet P-40, 2% biolyte ampholyte 5/8 (Bio-Rad Laboratories), 2% 2-mercaptoethanol, and 1x Complete EDTA-free protease inhibitor cocktail (Roche). Thawed testes were first minced and additional lysis buffer added to a final ratio of 8 ml to 1 g of tissue. The testis tissue was homogenized three times for 1015 s on ice using a polytron PT3000 (Brinkmann Instruments) and the homogenate was then centrifuged for 1 h at 100,000 g at 22°C. The supernatant was removed and frozen on dry ice. Total protein concentration was determined by using the Bradford Protein assay dye reagent concentrate (Bio-Rad Laboratories). For Western blot analysis,
40 to 50 µg of total protein was subjected to electrophoresis in SDS-10% PAGE gels. Proteins were electro-transferred to an Immobilon P membrane (Millipore) and subsequently probed with a 1:5,000 dilution of pol
polyclonal rabbit antibody raised against a 16-mer peptide (AEWERAGAARPSAHRC) corresponding to the very COOH terminus of murine pol
that had been conjugated to Keyhole limpet hemocyanin antigen (Covance). Levels of mouse actin were used as protein loading controls and were detected using an anti-actin antibody (Sigma-Aldrich). Mouse pol
and actin proteins were subsequently visualized using the CSPD-chemiluminescent "Western Light" chemiluminescent assay (Applied Biosystems).
Mice Used for Hypermutation Studies.
129/SvJ and C57BL/6J mice were purchased from The Jackson Laboratory and used at 39 mo of age. Three 129/SvJ mice were immunized intraperitoneally with 100 µg of phenyloxazolone coupled to chicken serum albumin in Ribi adjuvant (Corixa), boosted after 2 mo, and killed 3 days later. 13 C57BL/6J mice were killed without immunization. Peyer's patches from both groups were removed from the small intestine, and cells were stained with phycoerythrin-labeled antibody to B220 (BD Biosciences) and fluorescein-labeled peanut agglutinin (PNA; E-Y Laboratories). B220+PNA+ cells, which are undergoing mutation, were isolated by flow cytometry, and DNA from
30,000 cells was prepared.
DNA Sequencing of Immunoglobulin V Genes.
The intron region downstream of rearranged V, diversity, and joining (J) gene segments on the heavy chain locus was sequenced. DNA was amplified using nested 5' primers for the third framework region of VHJ558 gene segments and 3' primers for 400 nucleotides downstream of the JH4 gene segment. Primers for the first PCR amplification were: forward 5'AGCCTGACATCTGAGGAC, and reverse 5'TAGTGTGGAACATTCCTCAC. Nested primers for the second amplification were: forward 5'CCGGAATTCCTGACATCTGAGGACTCTGC, and reverse 5'CGCGGATCCGCTGTCACAGAGGTGGTCCTG, with added EcoRI and BamHI restriction sites, respectively. Reaction conditions for the first primer set were 95°C for 1 min, 55°C for 1.5 min, 72°C for 2 min for 30 cycles, and for the second primer set were 95°C for 30 s, 60°C for 1.5 min, and 72°C for 1 min for 30 cycles. PCR products were cloned into pBluescript (Stratagene) and sequenced by Lark Technologies (Houston, TX).
 |
Results
|
|---|
Fidelity of Murine Pol
Replication on Various DNA Templates.
To determine the biochemical properties of murine pol
, the enzyme was overproduced and purified as a recombinant GST-tagged protein from baculovirus-infected insect cells. Similar to our studies with human pol
(23, 27), murine pol
appears to be extremely error-prone. When replicating a recessed template, pol
readily misincorporates dNMPs opposite most template bases, but does not put in dCMP opposite T (Fig. 1
A). When replicating the end of a template, murine pol
is unable to misincorporate dGMP or dAMP opposite G, yet clearly favors the misincorporation of dCMP opposite template C (Fig. 1 B). Thus, like its well-characterized human ortholog, murine pol
exhibits a template-dependent misincorporation pattern in vitro.

View larger version (47K):
[in this window]
[in a new window]
|
Figure 1. Low-fidelity synthesis by murine pol . (A) Synthesis on a recessed template. The template was a 40 mer with a sequence 5'AGCGTCTTAATCTAAGCYXTCGCTATGTTTTCAAGGATTC where X was either G, A, T or C, and Y was T except when X was T, in which case Y = A. (B) Synthesis at the end of a template. The template was a 22 mer with a sequence 5'XTCGCTATGTTTTCAAGGATTC, where X was either G, A, T, or C. In both sets of experiments the primer for each reaction was a radiolabeled 16-mer with the sequence 5'CTTGAAAACATAGCGA, and the location of the hybridized primer on the respective template is underlined. The immediate local sequence context of each primer/template is given above each group of assays. The extent of murine pol -dependent (mis)incorporation was measured at each template site in the absence of dNTPs (0), all four dNTPs (4), or each individual dNTP.
| |
Strand Displacement by Pol
- and Pol
during Gap Filling.
Recent studies suggest that an early event in somatic hypermutation is the deamination of cytosines in DNA (30). It is hypothesized that the resulting uracil moiety gives rise to C
T transitions if copied by a high-fidelity polymerase, or both transitions and transversions if uracil is removed by uracil DNA glycosylase to produce an abasic site which could be copied by an error-prone polymerase (30, 31). Alternatively, the abasic site could be further processed by base excision repair proteins into a single nucleotide gap (5, 32). As pol
possesses intrinsic 5' dRP lyase activity (22) and shows enhanced catalytic activity on gapped substrates (22, 27), it seems reasonable to think that pol
might participate in such a pathway. Because pol
has previously been implicated as being the A-T mutator in hypermutation (15, 18), we were interested in assaying the efficiency and accuracy of both polymerases in replicating a 1 base-pair gap. The template base chosen for the gap-filling reaction was dG, as such a substrate would be expected to occur through the deamination of the complementary dC. As seen in Fig. 2
, pol
is active and error-prone on this substrate. In the presence of all four dNTPs, there is very limited strand displacement with 12 bases inserted at the original 1 bp gap. The correct base dCMP is preferentially inserted opposite template G, but dAMP and dTMP are also efficiently misinserted. Under the same conditions, pol
is more accurate than pol
, with the predominant insertion of the correct base, dCMP, and very little misinsertion of dAMP, dGMP, or dTMP. Both polymerases appear to replicate the 1 bp gap with roughly the same efficiency, but pol
is clearly better at strand displacement than pol
, and some primers are even fully-extended to the end of the template. When the two polymerases are added together, the major product of the 1 bp gap-filling assay is actually 3 bp long, and there appears to be significantly more strand displacement in the presence of both polymerases than in the presence of either pol
or pol
alone. Thus, both pol
and pol
can participate in a 1 bp gap-filling reaction, and their combined actions would lead to significant strand displacement.
Genomic Structure of Murine Poli.
To achieve our initial goal of generating a pol
-deficient mouse, we determined the entire genomic structure of the Poli gene located on a 120-kb mouse genomic BAC clone, 12337. The murine Poli gene was compared to the human gene, based on the human genomic sequence (GenBank/EMBL/DDBJ accession no.: NT_010893). Similar to human POLI, the mouse Poli gene has 10 exons (Fig. 3) . The gene spans a region of
23 kb on mouse chromosome 18, band E2, that shares synteny with human chromosome 18. Furthermore, the positions of introns and the sizes of exons are highly conserved between mouse and human genes. Intron 9 of the mouse gene has not been completely sequenced due to the presence of a mouse L1 retrotransposon sequence, which was detected by BLAST homology searches using the sequence of the 5' and 3' ends of the intron.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 3. Comparison of the genomic structure of the human POLI- and mouse Poli genes. Both genes consist of 10 exons (indicated as black boxes). The size of each exon and its intervening intron is given above and below the sequence respectively. The precise distance between exon 9 and 10 of Poli is unknown. However, the 5' and 3' ends of intron 9 match perfectly with an L1 retrotransposon which is 6.2 kb long.
| |
129-derived Strains of Mice Have a Nonsense Mutation in Their Poli Gene.
Sequence analysis of the 12337 BAC clone revealed a single nucleotide polymorphism in exon 2 which changed the wild-type Serine 27 codon, TCG, to an amber stop codon, TAG. As the clone came from a 129/SvJ mouse library, we determined if the mutation was present in other 129-derived strains. Fortuitously, the mutation can be easily detected, as it destroys a TaqI restriction site in the wild-type exon 2 (TCGA; wild-type serine codon 27 underlined). Using a PCR-based assay, we were able to genotype mouse strains for the presence or absence of the polymorphism. PCR products encompassing codon 27 from all of the mouse 129 strains analyzed (129/J, 129/SvJ, 129/ReJ, and 129/Ola) were undigested by the TaqI enzyme, indicating that they were homozygous for the nonsense mutation (Fig. 4
A). In contrast, TaqI digestion of the PCR product from C57BL/6J genomic DNA resulted in complete cleavage, showing that this strain is homozygous for the wild-type codon. Genotypic analysis of several other laboratory strains of mice such as BALB/c and ICR Swiss showed that they also had the wild-type codon for Poli (unpublished data).
In theory, the nonsense mutation should result in a pol
protein consisting of just 26 amino acids. This truncation occurs well before any of the conserved polymerase domains of pol
and should result in a complete loss of pol
activity within the cell. To confirm that the mutation abrogated pol
synthesis, the level of pol
was analyzed by Western blotting of testis extracts, where pol
is normally highly expressed (19, 27). Testis extracts from 129/SvJ and C57BL/6J mice were separated by gel electrophoresis, and pol
was detected using an antibody raised against a peptide corresponding to the very COOH terminus of murine pol
. This antibody recognizes full-length or mis-spliced variants containing the catalytic domain of pol
. As shown in Fig. 4 B, extracts from C57BL/6J mice had significant levels of pol
protein, whereas extracts from 129/SvJ mice had no detectable levels of full-length protein. Thus, the S27 nonsense mutation leads to a severe, if not total, deficiency in pol
protein in 129 mice.
Hypermutation of Immunoglobulin Genes in the Absence of Pol
.
The availability of mice naturally deficient in pol
gave us an opportunity to determine if pol
is required for somatic hypermutation of immunoglobulin genes. Mutations were identified in the intron region downstream of rearranged V genes on the heavy chain locus from both 129/SvJ and C57BL/6J mice. All the mutations in clones with different V rearrangements were counted, and only unique mutations in clones with the same rearrangements were scored. For 129/SvJ mice, 96% of the clones had mutations (81 out of 84); and for C57BL/6J mice, 53% of the clones were mutated (137 out of 258; Fig. 5
A). The overall frequency of mutation was 2.5% mutations/bp for 129/SvJ clones, and 0.5% mutations/bp for C57BL/6J clones. The frequency was probably higher in the 129/SvJ clones because the mice were inadvertently immunized before sacrifice, whereas the C57BL/6 mice were not immunized. For the 129/SvJ clones, 98% of the mutations were base substitutions (703 out of 715), and the rest were 9 deletions of 12 nucleotides, 1 deletion of 30 nucleotides, and 2 insertions of a single base. For the C57BL/6 clones, 99% of the mutations were substitutions (452 out of 454); the rest were a deletion of 1 nucleotide and an insertion of 44 nucleotides. Thus, there were very few insertions or deletions in either strain, with the vast majority of mutations being base substitutions.

View larger version (28K):
[in this window]
[in a new window]
|
Figure 5. Frequency and location of mutations in the JH4 intron of rearranged V genes. (A) 129/SvJ clones from immunized mice had an overall frequency of 2.5% mutations/bp, and C57BL/6J clones from unimmunized mice had 0.5% mutations/bp. The total number of clones analyzed is shown in the center of each circle. The pie segments represent the proportion of clones that contained the specified number of mutations indicated. (B) The sequence of the 5' nontranscribed strand from the 129/SvJ germ line is shown; 129/SvJ mutations are above the sequence and C57BL/6J mutations are below. Every tenth base is underlined. , deletion; ^, insertion. Italicized nucleotides 246, 248, 330, and 333 are allelic variations in C57BL/6, which are A, A, T, and T, respectively. Mutations from the wild-type sequence to G are colored orange; A, blue; T, red; and C, green.
| |
The types of base substitutions in the two groups of clones are shown in Table I. For both 129/SvJ and C57BL/6J clones, 56% of the changes were at A and T bases, and 44% were at G and C bases. The percent of individual types of substitutions was very similar between the two groups, with the exception of a decrease of C to T substitutions in the 129/SvJ clones (10%) compared with the C57BL/6 clones (17%), as recorded from the nontranscribed strand (P[
2] = 0.01). The location of mutations in the intron sequence from both strains is diagrammed in Fig. 5 B. Both strains have mutations at DNA motifs that are associated with increased hypermutability, RGYW and WA (mutable positions are underlined; R = A or G, Y = C or T, W = A or T) (17, 33). For example, mutations at G in RGYW or RGYW-like sequences are seen in nucleotide positions 40, 48, and 57; and mutations at A in WA hotspots are found in positions 8, 267, and 325. The figure shows that the overall distribution of mutations is similar between the two strains.
 |
Discussion
|
|---|
129-derived Strains of Mice Lack Pol
.
Like human pol
, murine pol
exhibits extremely low-fidelity synthesis when copying a variety of undamaged DNA templates. During the course of our attempts to generate a murine knock-out of Poli, we serendipitously discovered that inbred mice derived from the commonly-used 129 strains have a nonsense mutation at the beginning of the Poli gene. The amber codon replaces the Ser27 codon and results in a truncated protein lacking any catalytic function. Similar mutations producing short products have been identified in the human POLH gene encoding pol
from XP-V patients. For example, the XP4BE mutation results in a 27 amino acid product, and the XP30RO mutation yields a 42-amino acid fragment (34). Both of these mutations lead to a severe XP-V phenotype which includes increased UV sensitivity, enhanced UV-induced mutations, and an elevated incidence of UV-induced skin cancers indicating that these mutations result in a loss of pol
activity. As the mouse Poli mutation produces a similar truncation, it is likely that there is a severe defect in pol
function(s) in 129 mice. Indeed, our inability to detect pol
in Western blots of testis extracts from 129 mice supports such a conclusion.
As 129 mice have no detectable levels of pol
, are there any phenotypes that can be attributed to this deficiency? The fact that 129 mice are viable suggests that pol
is not essential for growth. However, although we did not detect pol
protein in tissue extracts, it is possible that there is very limited suppression of the amber nonsense codon during development so as to produce enough protein for viability. Another possibility is that the 129 strain has mutations in other genes that could compensate for the lack of pol
. Thus, the nonessential role of pol
in development needs to be established genetically in mice with the mutation in a defined wild-type background. Concerning cancers, it has been observed that 129 strains are resistant to gamma radiation-induced thymic lymphomas (35), indicating that certain DNA lesions may be processed more accurately in the absence of pol
.
One note of caution should be mentioned: many investigators use 129-derived embryonic stem cells for gene targeting. Although the recombinant mice are back-crossed to wild-type strains, experiments are often performed with F2 crosses that may carry the 129-derived Poli mutation. Indeed, we have analyzed a number of repair-deficient mice generated with 129 embryonic stem cells, and found that they have mixed +/+, +/-, and -/- genotypes for Poli (unpublished data). It is therefore possible that any repair phenotype previously associated with a particular gene knockout may also have been influenced by a deficiency in pol
.
Normal V-Gene Hypermutation in Pol
-deficient Mice.
Mutations are likely introduced into V genes by error-prone DNA polymerases during repair and/or replication of deaminated cytosines. To test if pol
is involved, the frequency and pattern of mutations was studied in 129/SvJ mice. Mutations were examined in the JH4 intron region 3' of rearranged V genes on the heavy chain locus. This 344-base region contains a high frequency of unselected mutations in clones from both immunized (36, 37) and unimmunized (38, 39) mice, ranging from 0.3% to 1.9% mutations per bp. In this study, clones from 129/SvJ mice had 2.5% mutations per bp, indicating that robust hypermutation can occur in the absence of pol
. A normal level of hypermutation in V
genes from 129 mice has also been previously reported (38). Furthermore, the types and location of bases changes were similar between pol
-deficient and proficient mice.
Based on these observations with the pol
-deficient 129 mice, we conclude that either pol
does not participate in hypermutation, or that its role is nonessential and can be readily assumed by another low-fidelity polymerase. These results contrast with those of Faili et al., who found that hypermutation does not occur in a human BL2 cell line with a homozygous deletion of POLI (28). Such differences might be due to short-term stimulation of B cells in culture where only pol
may be available (40) versus long-term stimulation in mice where other DNA polymerases can substitute for pol
in the hypermutation process.
Although pol
-deficient mice undergo normal somatic hypermutation, there are experimental results that suggest pol
helps to facilitate hypermutation. In pol
-deficient BL2-cells, there was a reduction in G
C mutations (28), which suggests that in wild-type cells, pol
has access to the site of deaminated cytosines to produce G
C mutations. In pol
-deficient mice, there was a normal frequency of hypermutation at G, A, T, and C nucleotides, which is most likely due to synthesis by pol
. While pol
appears to be more accurate than pol
in the gap-filling assay shown in Fig. 2, it is nevertheless a low-fidelity DNA polymerase (13, 41) and could easily generate mutations opposite all 4 base pairs through limited strand displacement. Interestingly, in pol
-deficient humans, hypermutation occurs mostly at G
C pairs (15), which is consistent with synthesis by pol
at a 1-bp gap and little to no strand displacement (Fig. 2), or replication by pol
past an abasic site (24, 42). Finally, a recent study indicates that pol
and pol
physically interact and colocalize in replication foci in the nucleus (43). As shown here, gap-filling and subsequent strand displacement is most robust when both enzymes are added together, and such activities may result in the introduction of multiple mutations located several base pairs from the initial single nucleotide gap.
Further studies on the precise biological roles of the enigmatic pol
are clearly necessary, and it is hoped that the wide availability of 129 strains of mice naturally deficient in pol
will facilitate such research.
 |
Acknowledgments
|
|---|
We would like to thank Jan Hoeijmakers and Henk Roest for helpful discussions of the phenotypes of the inbred 129 strains of mice; Gilbertus van der Horst for 129/Ola genomic DNA; Eric Wawrousek for kindly providing C57BL/6 and 129/SvJ testis tissues; David Winter and Xianmin Zeng for help with the hypermutation studies; and Alexandra Vaisman for assistance in making Figure 5.
This work was supported by the NIH Intramural research program (J.P. McDonald, E.C. Frank, B.S. Plosky, I.B. Rogozin, R. Woodgate, and P. Gearhart) and from the Core Research for Evolutional Science and Technology (CREST) from the Japan Science and Technology Corporation (C. Masutani and F. Hanaoka).
Submitted: May 8, 2003
Revised: July 10, 2003
Accepted: July 10, 2003
 |
Footnotes
|
|---|
Abbreviations used in this paper: pol, DNA polymerase; XP-V, xeroderma pigmentosum variant.
 |
References
|
|---|
1 Ohmori, H., E.C. Friedberg, R.P.P. Fuchs, M.F. Goodman, F. Hanaoka, D. Hinkle, T.A. Kunkel, C.W. Lawrence, Z. Livneh, T. Nohmi, et al. 2001. The Y-family of DNA polymerases. Mol. Cell. 8:78.[CrossRef][Medline]
2 Woodgate, R. 1999. A plethora of lesion-replicating DNA polymerases. Genes Dev. 13:21912195.[Free Full Text]
3 Goodman, M.F., and B. Tippen. 2000. The expanding polymerase universe. Nat. Rev. Mol. Cell Biol. 1:101109.[CrossRef][Medline]
4 Friedberg, E.C., R. Wagner, and M. Radman. 2002. Specialized DNA polymerases, cellular survival, and the genesis of mutations. Science. 296:16271630.[Abstract/Free Full Text]
5 Kunkel, T.A., Y.I. Pavlov, and K. Bebenek. 2003. Functions of human DNA polymerases
,
and
suggested by their properties, including fidelity with undamaged DNA templates. DNA Repair. 2:135149.[Medline]
6 Johnson, R.E., S. Prakash, and L. Prakash. 1999. Efficient bypass of a thymine-thymine dimer by yeast DNA polymerase, pol
. Science. 283:10011004.[Abstract/Free Full Text]
7 Washington, M.T., R.E. Johnson, S. Prakash, and L. Prakash. 2000. Accuracy of thymine-thymine dimer bypass by Saccharomyces cerevisiae DNA polymerase
. Proc. Natl. Acad. Sci. USA. 97:30943099.[Abstract/Free Full Text]
8 Masutani, C., R. Kusumoto, S. Iwai, and F. Hanaoka. 2000. Mechanisms of accurate translesion synthesis by human DNA polymerase
. EMBO J. 19:31003109.[CrossRef][Medline]
9 Yuan, F., Y. Zhang, D.K. Rajpal, X. Wu, D. Guo, M. Wang, J.S. Taylor, and Z. Wang. 2000. Specificity of DNA lesion bypass by the yeast DNA polymerase
. J. Biol. Chem. 275:82338239.[Abstract/Free Full Text]
10 Trincao, J., R.E. Johnson, C.R. Escalante, S. Prakash, L. Prakash, and A.K. Aggarwal. 2001. Structure of the catalytic core of S. cerevisiae DNA polymerase
. Implications for translesion DNA synthesis. Mol. Cell. 8:417426.[CrossRef][Medline]
11 Cleaver, J.E., and D.M. Carter. 1973. Xeroderma pigmentosum variants: influence of temperature on DNA repair. J. Invest. Dermatol. 60:2932.[CrossRef][Medline]
12 Washington, M.T., R.E. Johnson, S. Prakash, and L. Prakash. 1999. Fidelity and processivity of Saccharomyces cerevisiae DNA polymerase
. J. Biol. Chem. 274:3683536838.[Abstract/Free Full Text]
13 Matsuda, T., K. Bebenek, C. Masutani, F. Hanaoka, and T.A. Kunkel. 2000. Low fidelity DNA synthesis by human DNA polymerase-
. Nature. 404:10111013.[CrossRef][Medline]
14 Johnson, R.E., M.T. Washington, S. Prakash, and L. Prakash. 2000. Fidelity of human DNA polymerase
. J. Biol. Chem. 275:74477450.[Abstract/Free Full Text]
15 Zeng, X., D.B. Winter, C. Kasmer, K.H. Kraemer, A.R. Lehmann, and P.J. Gearhart. 2001. DNA polymerase
is an A-T mutator in somatic hypermutation of immunoglobulin variable genes. Nat. Immunol. 2:537541.[CrossRef][Medline]
16 Yavuz, S., A.S. Yavuz, K.H. Kraemer, and P.E. Lipsky. 2002. The role of polymerase
in somatic hypermutation determined by analysis of mutations in a patient with xeroderma pigmentosum variant. J. Immunol. 169:38253830.[Abstract/Free Full Text]
17 Rogozin, I.B., Y.I. Pavlov, K. Bebenek, T. Matsuda, and T.A. Kunkel. 2001. Somatic mutation hotspots correlate with DNA polymerase
error spectrum. Nat. Immunol. 2:530536.[CrossRef][Medline]
18 Pavlov, Y.I., I.B. Rogozin, A.P. Galkin, A.Y. Aksenova, F. Hanaoka, C. Rada, and T.A. Kunkel. 2002. Correlation of somatic hypermutation specificity and A-T base pair substitution errors by DNA polymerase
during copying of a mouse immunoglobulin
light chain transgene. Proc. Natl. Acad. Sci. USA. 99:99549959.[Abstract/Free Full Text]
19 McDonald, J.P., V. Rapic-Otrin, J.A. Epstein, B.C. Broughton, X. Wang, A.R. Lehmann, D.J. Wolgemuth, and R. Woodgate. 1999. Novel human and mouse homologs of Saccharomyces cerevisiae DNA polymerase
. Genomics. 60:2030.[CrossRef][Medline]
20 Tissier, A., E.G. Frank, J.P. McDonald, S. Iwai, F. Hanaoka, and R. Woodgate. 2000. Misinsertion and bypass of thymine-thymine dimers by human DNA polymerase
. EMBO J. 19:52595266.[CrossRef][Medline]
21 Vaisman, A., E.G. Frank, J.P. McDonald, A. Tissier, and R. Woodgate. 2002. Pol
-dependent lesion bypass in vitro. Mutat. Res. 510:922.[Medline]
22 Bebenek, K., A. Tissier, E.G. Frank, J.P. McDonald, R. Prasad, S.H. Wilson, R. Woodgate, and T.A. Kunkel. 2001. 5'-Deoxyribose phosphate lyase activity of human DNA polymerase
in vitro. Science. 291:21562159.[Abstract/Free Full Text]
23 Tissier, A., J.P. McDonald, E.G. Frank, and R. Woodgate. 2000. pol
, a remarkably error-prone human DNA polymerase. Genes Dev. 14:16421650.[Abstract/Free Full Text]
24 Johnson, R.E., M.T. Washington, L. Haracska, S. Prakash, and L. Prakash. 2000. Eukaryotic polymerases
and
act sequentially to bypass DNA lesions. Nature. 406:10151019.[CrossRef][Medline]
25 Zhang, Y., F. Yuan, X. Wu, and Z. Wang. 2000. Preferential incorporation of G opposite template T by the low-fidelity human DNA polymerase
. Mol. Cell. Biol. 20:70997108.[Abstract/Free Full Text]
26 Vaisman, A., A. Tissier, E.G. Frank, M.F. Goodman, and R. Woodgate. 2001. Human DNA polymerase
promiscuous mismatch extension. J. Biol. Chem. 276:3061530622.[Abstract/Free Full Text]
27 Frank, E.G., A. Tissier, J.P. McDonald, V. Rapic-Otrin, X. Zeng, P.J. Gearhart, and R. Woodgate. 2001. Altered nucleotide misinsertion fidelity associated with pol
-dependent replication at the end of a DNA template. EMBO J. 20:29142922.[CrossRef][Medline]
28 Faili, A., S. Aoufouchi, E. Flatter, Q. Gueranger, C.A. Reynaud, and J.C. Weill. 2002. Induction of somatic hypermutation in immunoglobulin genes is dependent on DNA polymerase
. Nature. 419:944947.[CrossRef][Medline]
29 Yamada, A., C. Masutani, S. Iwai, and F. Hanaoka. 2000. Complementation of defective translesion synthesis and UV light sensitivity in xeroderma pigmentosum variant cells by human and mouse DNA polymerase
. Nucleic Acids Res. 28:24732480.[Abstract/Free Full Text]
30 Petersen-Mahrt, S.K., R.S. Harris, and M.S. Neuberger. 2002. AID mutates E. coli suggesting a DNA deamination mechanism for antibody diversification. Nature. 418:99103.[Medline]
31 Rada, C., G.T. Williams, H. Nilsen, D.E. Barnes, T. Lindahl, and M.S. Neuberger. 2002. Immunoglobulin isotype switching is inhibited and somatic hypermutation perturbed in UNG-deficient mice. Curr. Biol. 12:17481755.[CrossRef][Medline]
32 Gearhart, P.J. 2002. Immunology: the roots of antibody diversity. Nature. 419:2931.[CrossRef][Medline]
33 Rogozin, I.B., and N.A. Kolchanov. 1992. Somatic hypermutagenesis in immunoglobulin genes. II. Influence of neighbouring base sequences on mutagenesis. Biochim. Biophys. Acta. 1171:1118.[Medline]
34 Masutani, C., R. Kusumoto, A. Yamada, N. Dohmae, M. Yokoi, M. Yuasa, M. Araki, S. Iwai, K. Takio, and F. Hanaoka. 1999. The XPV (xeroderma pigmentosum variant) gene encodes human DNA polymerase
. Nature. 399:700704.[CrossRef][Medline]
35 Newcomb, E.W., L.E. Diamond, S.R. Sloan, M. Corominas, I. Guerrerro, and A. Pellicer. 1989. Radiation and chemical activation of ras oncogenes in different mouse strains. Environ. Health Perspect. 81:3337.[Medline]
36 Lebecque, S.G., and P.J. Gearhart. 1990. Boundaries of somatic mutation in rearranged immunoglobulin genes: 5' boundary is near the promoter, and 3' boundary is approximately 1 kb from V(D)J gene. J. Exp. Med. 172:17171727.[Abstract/Free Full Text]
37 Schenten, D., V.L. Gerlach, C. Guo, S. Velasco-Miguel, C.L. Hladik, C.L. White, E.C. Friedberg, K. Rajewsky, and G. Esposito. 2002. DNA polymerase
deficiency does not affect somatic hypermutation in mice. Eur. J. Immunol. 32:31523160.[CrossRef][Medline]
38 Frey, S., B. Bertocci, F. Delbos, L. Quint, J.C. Weill, and C.A. Reynaud. 1998. Mismatch repair deficiency interferes with the accumulation of mutations in chronically stimulated B cells and not with the hypermutation process. Immunity. 9:127134.[CrossRef][Medline]
39 Rada, C., M.R. Ehrenstein, M.S. Neuberger, and C. Milstein. 1998. Hot spot focusing of somatic hypermutation in MSH2-deficient mice suggests two stages of mutational targeting. Immunity. 9:135141.[CrossRef][Medline]
40 Poltoratsky, V., C.J. Woo, B. Tippin, A. Martin, M.F. Goodman, and M.D. Scharff. 2001. Expression of error-prone polymerases in BL2 cells activated for Ig somatic hypermutation. Proc. Natl. Acad. Sci. USA. 98:79767981.[Abstract/Free Full Text]
41 Matsuda, T., K. Bebenek, C. Masutani, I.B. Rogozin, F. Hanaoka, and T.A. Kunkel. 2001. Error rate and specificity of human and murine DNA polymerase
. J. Mol. Biol. 312:335346.[CrossRef][Medline]
42 McDonald, J.P., A. Tissier, E.G. Frank, S. Iwai, F. Hanaoka, and R. Woodgate. 2001. DNA polymerase iota and related Rad30-like enzymes. Phil. Trans. R. Soc. Lond. B Biol. Sci. 356:5360.[Abstract/Free Full Text]
43 Kannouche, P., A.R. Fernandez de Henestrosa, B. Coull, A. Vidal, C. Gray, D. Zicha, R. Woodgate, and A.R. Lehmann. 2002. Localisation of DNA polymerases
and
to the replication machinery is tightly co-ordinated in human cells. EMBO J. 21:62466256.[Medline]

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
-
Saribasak, H., Rajagopal, D., Maul, R. W, Gearhart, P. J
(2009). Hijacked DNA repair proteins and unchained DNA polymerases. Phil Trans R Soc B
364: 605-611
[Abstract]
[Full Text]
-
Langerak, P., Krijger, P. H.L, Heideman, M. R, van den Berk, P. C.M, Jacobs, H.
(2009). Somatic hypermutation of immunoglobulin genes: lessons from proliferating cell nuclear antigenK164R mutant mice. Phil Trans R Soc B
364: 621-629
[Abstract]
[Full Text]
-
Waters, L. S., Minesinger, B. K., Wiltrout, M. E., D'Souza, S., Woodruff, R. V., Walker, G. C.
(2009). Eukaryotic Translesion Polymerases and Their Roles and Regulation in DNA Damage Tolerance. Microbiol. Mol. Biol. Rev.
73: 134-154
[Abstract]
[Full Text]
-
Yang, I.-Y., Hashimoto, K., de Wind, N., Blair, I. A., Moriya, M.
(2009). Two Distinct Translesion Synthesis Pathways across a Lipid Peroxidation-derived DNA Adduct in Mammalian Cells. J. Biol. Chem.
284: 191-198
[Abstract]
[Full Text]
-
Plosky, B. S., Frank, E. G., Berry, D. A., Vennall, G. P., McDonald, J. P., Woodgate, R.
(2008). Eukaryotic Y-family polymerases bypass a 3-methyl-2'-deoxyadenosine analog in vitro and methyl methanesulfonate-induced DNA damage in vivo. Nucleic Acids Res
36: 2152-2162
[Abstract]
[Full Text]
-
Yang, W., Woodgate, R.
(2007). What a difference a decade makes: Insights into translesion DNA synthesis. Proc. Natl. Acad. Sci. USA
104: 15591-15598
[Abstract]
[Full Text]
-
Wu, X., Stavnezer, J.
(2007). DNA polymerase {beta} is able to repair breaks in switch regions and plays an inhibitory role during immunoglobulin class switch recombination. JEM
204: 1677-1689
[Abstract]
[Full Text]
-
Dumstorf, C. A., Clark, A. B., Lin, Q., Kissling, G. E., Yuan, T., Kucherlapati, R., McGregor, W. G., Kunkel, T. A.
(2006). Participation of mouse DNA polymerase {iota} in strand-biased mutagenic bypass of UV photoproducts and suppression of skin cancer. Proc. Natl. Acad. Sci. USA
103: 18083-18088
[Abstract]
[Full Text]
-
Ohkumo, T., Kondo, Y., Yokoi, M., Tsukamoto, T., Yamada, A., Sugimoto, T., Kanao, R., Higashi, Y., Kondoh, H., Tatematsu, M., Masutani, C., Hanaoka, F.
(2006). UV-B Radiation Induces Epithelial Tumors in Mice Lacking DNA Polymerase {eta} and Mesenchymal Tumors in Mice Deficient for DNA Polymerase {iota}. Mol. Cell. Biol.
26: 7696-7706
[Abstract]
[Full Text]
-
Takata, K.-i., Shimizu, T., Iwai, S., Wood, R. D.
(2006). Human DNA Polymerase N (POLN) Is a Low Fidelity Enzyme Capable of Error-free Bypass of 5S-Thymine Glycol. J. Biol. Chem.
281: 23445-23455
[Abstract]
[Full Text]
-
Wu, X., Tsai, C. Y., Patam, M. B., Zan, H., Chen, J. P., Lipkin, S. M., Casali, P.
(2006). A Role for the MutL Mismatch Repair Mlh3 Protein in Immunoglobulin Class Switch DNA Recombination and Somatic Hypermutation. J. Immunol.
176: 5426-5437
[Abstract]
[Full Text]
-
Jansen, J. G., Langerak, P., Tsaalbi-Shtylik, A., van den Berk, P., Jacobs, H., de Wind, N.
(2006). Strand-biased defect in C/G transversions in hypermutating immunoglobulin genes in Rev1-deficient mice. JEM
203: 319-323
[Abstract]
[Full Text]
-
Lin, Q., Clark, A. B., McCulloch, S. D., Yuan, T., Bronson, R. T., Kunkel, T. A., Kucherlapati, R.
(2006). Increased Susceptibility to UV-Induced Skin Carcinogenesis in Polymerase {eta}-deficient Mice. Cancer Res.
66: 87-94
[Abstract]
[Full Text]
-
Masuda, K., Ouchida, R., Takeuchi, A., Saito, T., Koseki, H., Kawamura, K., Tagawa, M., Tokuhisa, T., Azuma, T., O-Wang, J.
(2005). DNA polymerase {theta} contributes to the generation of C/G mutations during somatic hypermutation of Ig genes. Proc. Natl. Acad. Sci. USA
102: 13986-13991
[Abstract]
[Full Text]
-
Trivedi, R. N., Almeida, K. H., Fornsaglio, J. L., Schamus, S., Sobol, R. W.
(2005). The Role of Base Excision Repair in the Sensitivity and Resistance to Temozolomide-Mediated Cell Death. Cancer Res.
65: 6394-6400
[Abstract]
[Full Text]
-
Mayorov, V. I., Rogozin, I. B., Adkison, L. R., Gearhart, P. J.
(2005). DNA Polymerase {eta} Contributes to Strand Bias of Mutations of A versus T in Immunoglobulin Genes. J. Immunol.
174: 7781-7786
[Abstract]
[Full Text]
-
Martomo, S. A., Yang, W. W., Wersto, R. P., Ohkumo, T., Kondo, Y., Yokoi, M., Masutani, C., Hanaoka, F., Gearhart, P. J.
(2005). Different mutation signatures in DNA polymerase {eta}- and MSH6-deficient mice suggest separate roles in antibody diversification. Proc. Natl. Acad. Sci. USA
102: 8656-8661
[Abstract]
[Full Text]
-
Zheng, N.-Y., Wilson, K., Jared, M., Wilson, P. C.
(2005). Intricate targeting of immunoglobulin somatic hypermutation maximizes the efficiency of affinity maturation. JEM
201: 1467-1478
[Abstract]
[Full Text]
-
Delbos, F., De Smet, A., Faili, A., Aoufouchi, S., Weill, J.-C., Reynaud, C.-A.
(2005). Contribution of DNA polymerase {eta} to immunoglobulin gene hypermutation in the mouse. JEM
201: 1191-1196
[Abstract]
[Full Text]
-
Wilson, T. M., Vaisman, A., Martomo, S. A., Sullivan, P., Lan, L., Hanaoka, F., Yasui, A., Woodgate, R., Gearhart, P. J.
(2005). MSH2-MSH6 stimulates DNA polymerase {eta}, suggesting a role for A:T mutations in antibody genes. JEM
201: 637-645
[Abstract]
[Full Text]
-
Jansen, J. G., Tsaalbi-Shtylik, A., Langerak, P., Calléja, F., Meijers, C. M., Jacobs, H., de Wind, N.
(2005). The BRCT domain of mammalian Rev1 is involved in regulating DNA translesion synthesis. Nucleic Acids Res
33: 356-365
[Abstract]
[Full Text]
-
Ruiz, J. F., Lucas, D., Garcia-Palomero, E., Saez, A. I., Gonzalez, M. A., Piris, M. A., Bernad, A., Blanco, L.
(2004). Overexpression of human DNA polymerase {micro} (Pol {micro}) in a Burkitt's lymphoma cell line affects the somatic hypermutation rate. Nucleic Acids Res
32: 5861-5873
[Abstract]
[Full Text]
-
Schrader, C. E., Vardo, J., Linehan, E., Twarog, M. Z., Niedernhofer, L. J., Hoeijmakers, J. H.J., Stavnezer, J.
(2004). Deletion of the Nucleotide Excision Repair Gene Ercc1 Reduces Immunoglobulin Class Switching and Alters Mutations Near Switch Recombination Junctions. JEM
200: 321-330
[Abstract]
[Full Text]
-
Li, Z., Scherer, S. J., Ronai, D., Iglesias-Ussel, M. D., Peled, J. U., Bardwell, P. D., Zhuang, M., Lee, K., Martin, A., Edelmann, W., Scharff, M. D.
(2004). Examination of Msh6- and Msh3-deficient Mice in Class Switching Reveals Overlapping and Distinct Roles of MutS Homologues in Antibody Diversification. JEM
200: 47-59
[Abstract]
[Full Text]
-
Martomo, S. A., Yang, W. W., Gearhart, P. J.
(2004). A Role for Msh6 But Not Msh3 in Somatic Hypermutation and Class Switch Recombination. JEM
200: 61-68
[Abstract]
[Full Text]
-
Zeng, X., Negrete, G. A., Kasmer, C., Yang, W. W., Gearhart, P. J.
(2004). Absence of DNA Polymerase {eta} Reveals Targeting of C Mutations on the Nontranscribed Strand in Immunoglobulin Switch Regions. JEM
199: 917-924
[Abstract]
[Full Text]
-
Wang, M., Devereux, T. R., Vikis, H. G., McCulloch, S. D., Holliday, W., Anna, C., Wang, Y., Bebenek, K., Kunkel, T. A., Guan, K., You, M.
(2004). Pol {iota} Is a Candidate for the Mouse Pulmonary Adenoma Resistance 2 Locus, a Major Modifier of Chemically Induced Lung Neoplasia. Cancer Res.
64: 1924-1931
[Abstract]
[Full Text]
-
Faili, A., Aoufouchi, S., Weller, S., Vuillier, F., Stary, A., Sarasin, A., Reynaud, C.-A., Weill, J.-C.
(2004). DNA Polymerase {eta} Is Involved in Hypermutation Occurring during Immunoglobulin Class Switch Recombination. JEM
199: 265-270
[Abstract]
[Full Text]
-
Li, Z., Woo, C. J., Iglesias-Ussel, M. D., Ronai, D., Scharff, M. D.
(2004). The generation of antibody diversity through somatic hypermutation and class switch recombination. Genes Dev.
18: 1-11
[Full Text]