The Journal of Experimental Medicine
ELISpot, FluoroSpot and ELISA kits from Mabtech
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

Published 17 March 2003. doi:10.1084/jem.20021911
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 377K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Masignani, V.
Right arrow Articles by Pizza, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masignani, V.
Right arrow Articles by Pizza, M.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Immunization
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
© Rockefeller University Press, 0022-1007/2003/3/789 $5.00
The Journal of Experimental Medicine, Volume 197, Number 6, 789-799

Vaccination against Neisseria meningitidis Using Three Variants of the Lipoprotein GNA1870

Vega Masignani1, Maurizio Comanducci1, Marzia Monica Giuliani1, Stefania Bambini1, Jeannette Adu-Bobie1, Beatrice Aricò1, Brunella Brunelli1, Alessandro Pieri1, Laura Santini1, Silvana Savino1, Davide Serruto1, David Litt2, Simon Kroll2, Jo Anne Welsch3, Dan M. Granoff3, Rino Rappuoli1 and Mariagrazia Pizza1

1 IRIS, Chiron S.r.l., Via Fiorentina 1, 53100 Siena, Italy
2 Department of Paediatrics, Imperial College London, St. Mary's Hospital Campus, London W2 1PG, United Kingdom
3 Children's Hospital Oakland Research Institute, Oakland, CA 94609

Address correspondence to Rino Rappuoli, IRIS, Chiron S.r.l., via Fiorentina 1, 53100 Siena, Italy. Phone: 39-0577-243414; Fax: 39-0577-278508; E-mail: rino_rappuoli{at}chiron.it


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Sepsis and meningitis caused by serogroup B meningococcus are devastating diseases of infants and young adults, which cannot yet be prevented by vaccination. By genome mining, we discovered GNA1870, a new surface-exposed lipoprotein of Neisseria meningitidis that induces high levels of bactericidal antibodies. The antigen is expressed by all strains of N. meningitidis tested. Sequencing of the gene in 71 strains representative of the genetic and geographic diversity of the N. meningitidis population, showed that the protein can be divided into three variants. Conservation within each variant ranges between 91.6 to 100%, while between the variants the conservation can be as low as 62.8%. The level of expression varies between strains, which can be classified as high, intermediate, and low expressors. Antibodies against a recombinant form of the protein elicit complement-mediated killing of the strains that carry the same variant and induce passive protection in the infant rat model. Bactericidal titers are highest against those strains expressing high yields of the protein; however, even the very low expressors are efficiently killed. The novel antigen is a top candidate for the development of a new vaccine against meningococcus.

Key Words: Neisseria • antigen • vaccine • gene variability


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Neisseria meningitidis is a gram negative, encapsulated bacterium which at any time colonizes the upper respiratory tract of ~10% of human population. Colonizing strains belong to hypervirulent lineages and carriage strains, which are frequently or rarely associated with disease, respectively. During nonepidemic periods approximately once in every 10,000 colonized people or once in 100,000 population, the bacterium enters the blood stream where it multiplies and gives sepsis. During epidemic periods, the attack rates can be much higher. From the blood stream the bacterium may cross the blood-brain barrier and cause meningitis. Both diseases are devastating and can kill 5–15% of the affected children and young adults within hours, despite the availability of effective antibiotics (1). Up to 25% of those who survive are left with permanent sequelae, which may include amputation of limbs, mental retardation, and hearing loss (2, 3). The bacteria have been classified in serogroups based on the chemical composition of the polysaccharide capsule (4). Although 13 chemically different serogroups have been described, only serogroups A, B, C, Y, and W-135, and to a very minor extent X and Z, have been associated with disease (5, 6). In addition to the capsular serogroup, most of the meningococcal strains isolated from invasive disease, have been classified by multilocus enzyme electrophoresis (MLEE) into a small number of hypervirulent lineages: Electrophoretic Types ET-37, ET-5, cluster A4, lineage 3, subgroups I, III, and IV-1 (7, 8). Recently, a new sequence-based classification, multilocus sequence typing (MLST) has been introduced, which classifies the above strains mainly into Sequence Types ST11, ST32, ST8, ST41, ST1, ST5, ST4, respectively (9). Carrier strains have a more diverse clustering, and a wider range of genotypes.

Prevention of disease can effectively be accomplished by vaccination. Immunization was made possible in 1969 when it was discovered that protection from disease correlates with the presence in the serum of antibodies able to induce complement-mediated killing of bacteria, and that purified capsular polysaccharide was able to induce them. Tetravalent vaccines against serogroups A, C, W-135, and Y have been available since 1984 (1012). Although effective in adults, polysaccharide vaccines are less efficacious in infants and young children and do not induce immunological memory, so that they have not been used for universal vaccination. Recently, conjugate vaccines against serogroup C have been introduced in the UK, Ireland, and Canada (13, 14). These are immunogenic in infants and children, induce immunological memory and show overall efficacy of more than 90%. Tetravalent conjugate vaccines against serogroups A, C, W-135, and Y are presently in clinical development (15). As a consequence, during the next 4–6 yr we expect to be able to prevent diseases caused by serogroups A, C, W-135, and Y in all age groups. Unfortunately, the conjugate approach cannot be easily applied to serogroup B because the capsular polysaccharide is a polymer of {alpha}(2->8)N-acetyl neuraminic acid or polysialic acid, a molecule which is identical to a widely distributed human carbohydrate. Being the serogroup B polysaccharide identical to a self-antigen, man is immunologically tolerant to it and therefore fails to induce an effective immune response. On the other hand, an immune response against it would risk to induce autoimmunity (16, 17). For this reason, there are no licensed vaccines available in the USA and Europe for the prevention of serogroup B N. meningitidis disease, which is responsible for 32% of all meningococcal disease in the United States, for 45 to 80% of the cases in Europe and for more than 50% of the cases in the rest of the world, with the exception of Sub-Saharan Africa where serogroup A is responsible for 90% of the cases (18, 19). To develop a vaccine against serogroup B, surface-exposed proteins contained in outer membrane vesicles (OMVs)* have been used (20, 21). These vaccines elicit serum bactericidal antibody responses and protect against meningococcal disease (22, 23). However, while they induce complement-mediated bactericidal antibodies against the homologous strain, they fail to induce bactericidal antibodies against heterologous strains (24). For this reason their use has been limited only to Central and South America.

In the year 2000 our laboratory published the use of the genomic sequence of MC58 to discover novel antigens capable of inducing protection against serogroup B N. meningitidis (25). Here we describe a novel antigen which was discovered by mining the bacterial genome and that is very effective in inducing bactericidal antibodies. This antigen is a very good candidate for inclusion in universal vaccines against N. meningitidis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Strains.
Escherichia coli DH5{alpha} and BL21(DE3) were used as cloning strain and expression host, respectively, and used as recommended by the manufacturer (Invitrogen).

N. meningitidis strains used were described by Comanducci et al. (26). Selection was made to represent the meningococcal diversity both in terms of genotype and geographic distribution (they derive from 19 different countries and 73% belong to serogroup B). 32/71 (45%) were isolated during the last five years. Most data in this paper refer to strains: MC58, 961–5945, M1239, 67/00, NZ394/98, H44/76, Cu385, (26), and 4243 (27). The NZ394/98 strain was originally described by Diana Martin as NZ98/254 (Institute of Environmental Science & Research Limited, Kenepuru Science Centre, Porirua, New Zealand).

GNA1870 Cloning, Expression, and Purification in E. coli.
gna1870 genes were amplified by PCR from the genome of N. meningitidis MC58, 961–5945 and M1239 strains, respectively. Forward and reverse primers were designed in order to amplify the gna1870 coding sequence devoid of the sequence coding for the putative leader peptide. M1239 and 961–5945 variants were found not to be expressible in E. coli. Therefore, they were expressed by adding to the NH2-terminal the sequence GPDSDRLQQRRG that is present in the gonococcus protein, but absent in the meningococcus counterpart. Oligonucleotides used for the amplification are reported as follows: strain MC58 (For1: CGCGGATCCCATATGGTCGCCGCCGACATCG; Rev1: CCCGCTCGAGTTGCTTGGCGGCAAGGC). strain 961–5945(For2: CGCGGATCCCATATGGGCCCTGATTCTGACCGCCTGCAGCAGCGGAGGGTCGCCGCCGACATC-GG; Rev2:CCCGCTCGAGCTGTTTGCCGGCGATGCC); strain M1239 (For 2; Rev3:GCCCAAGCTTCTGTTTGCCGGCGATGCC).

Restriction sites, corresponding to NdeI for the forward primers and XhoI for the reverse primers, are underlined. In the case of M1239 strain the restriction site used for the reverse primer is Hind III. For the 961–5945 and M1239 forward primers, the gonococcus sequence moiety is reported in italics, whereas the meningococcal GNA1870 matching sequences are reported in bold.

PCR conditions in the case of primer combination For1/Rev1 were: denaturation at 94°C for 30 s, annealing at 57°C for 30 s, elongation at 68°C for 1 min (5 cycles), denaturation at 94°C for 30 s, annealing at 68°C for 30 s, elongation at 68°C for 1 min (30 cycles). In the case of primer combinations: For2/Rev2, For3/Rev2, and For3/Rev3: 94°C for 30 s, 56°C for 30 s, 68°C for 1 min (5 cycles), 94°C for 30 s, 71°C for 30 s, 68°C for 1 min (30 cycles).

gna1870 full-length gene was amplified from the MC58 genome using the following primers: f-lFor (CGCGGATCCCATATGAATCGAACTGCCTTCTGCTGCC) and f-lRev (CCCGCTCGAGTTATTGCTTGGCGGCAAGGC) and the following conditions: 94°C for 30 s, 58°C for 30 s, 72°C for 1 min (30 cycles).

PCR were performed on ~10 ng of chromosomal DNA using High Fidelity Taq DNA Polymerase (Invitrogen). The pCR products were digested with NdeI and XhoI and cloned into the NdeI/XhoI sites of the pET-21b+ expression vector (Novagen).

Recombinant proteins were expressed as His-tag fusions and purified by MCAC (Metal Chelating Affinity Chromatography), as described previously (25).

gna1870 Gene Sequencing.
gna1870 gene was amplified using primers external to the coding sequence (A1: GACCTGCCTCATTGATG and B2: CGGTAAATTATCGTGTTCGGACGGC). About 10 ng of chromosomal DNA were used as template for the amplification. PCR conditions were: 30 cycles, 94°C for 40 s, 58°C for 40 s, 68°C for 40 s. PCR fragment were purified by the QIAGEN QIAquick PCR Purification Kit, and submitted to sequence analysis, which was performed using an ABI 377 Automatic Sequencer. The sequence was performed using primers A1, B2, 22 (CAAATCGAAGTGGACGGGCAG), and 32 (TGTTCGATTTTGCCGTTTCCCTG). Sequence analysis was performed using Editview, GeneJockey, MacBoxshade.

Computer Analysis.
The GCG Wisconsin Package suite (version 10.0) was used for computer analysis of gene and protein sequences. The PSORT program (28) was used for localization prediction. For secondary structure analysis, the PredictProtein software available on the web at http://cubic.bioc.columbia.edu/predictprotein/ was applied. The PSI-BLAST algorithm was used for homology searches (http://www.ncbi.nlm.nih.gov/blast) using the nonredundant protein database. The prediction of the Fur box was performed with FindPatterns (GCG) starting from the E. coli consensus (29) and allowing a maximum of nine mismatches. Search for lipoproteins with a glycine-rich region has been performed on 22 complete genomic sequences retrieved at the NCBI site (http://www.ncbi.nlm.nih.gov/PMGifs/Genomes/micr.html) using FindPatterns. The complete genome sequence of Neisseria gonorrhoeae strain FA1090 is available at the site http://dna1.chem.ou.edu/gono.html.

The dendrograms were obtained starting from the multiple sequence alignment of GNA1870 protein sequences (PileUP) using the Protein Sequence Parsimony Method (ProtPars), a program available within the Phylogeny Inference Package (Phylip) (Felsenstein, J. 1993, program distributed by the author), and confirmed by the GCG program Distances, using the Kimura and Jukes-Cantor algorithms.

gna1870 and siaD Isogenic Mutants.
Isogenic knockout mutants in which the gna1870 gene was truncated and replaced with an erythromycin antibiotic cassette, was prepared by transforming strains MC58, 961–5945 and M1239 with the plasmid pBS{Delta}gna1870ERM. This plasmid contains the erythromycin resistance gene within the gna1870 upstream and downstream flanking regions of 500 bp. These regions were amplified from MC58 genome using the following oligonucleotides UFor-GCTCTAGACCAGCCAGGCGCATAC (Xba1 site underlined); URev TCCCCCGGGGACGGCATTTTGTTTACAGG (Sma1 site underlined); DFor TCCCCCGGGCGCCAAGCAATAACCATTG (Sma1 site underlined) and DRev CCCGCTCGAGCAGCGTATCGAACCATGC (Xho1 site underlined). A capsule-deficient mutant was generated using the same approach. The siaD gene was deleted and replaced with ermC using the plasmid pBS{Delta}CapERM. The upstream and downstream flanking regions of 1,000 bp and 1,056 bp, respectively, were amplified from MC58 genome using the following primers: UCapFor GCTCTAGATTCTTTCCCAAGAACTCTC (Xba1 site underlined); UcapRev TCCCCCGGGCCCGTATCATCCACCAC (Sma1 site underlined); DCapFor TCCCCCGGGATCCACGCAAATACCCC (Sma1 site underlined) and DCapRev CCCGCTCGAGATATAAGTGGAAGACGGA (Xho1 site underlined). Amplified fragments were cloned into pBluescript and transformed into naturally competent N. meningitidis strain MC58. The mixture was spotted onto a GC agar plate, incubated for 6 h at 37°C, 5% CO2, then diluted in PBS and spread on GC agar plates containing 5 µg/ml erythromycin. The deletion of the gna1870 gene in the MC58{Delta}gna1870, 961–5945{Delta}gna1870, and M1239{Delta}gna1870 strains was confirmed by PCR; lack of GNA1870 expression was confirmed by Western blot analysis. The deletion of the siaD gene and the lack of capsule expression in the MC58{Delta}siaD strain were confirmed by PCR and FACS®, respectively.

Expression of GNA1870 during Growth.
MC58 strain was grown at 37°C with 5% CO2 in GC medium at stationary phase. Samples were collected during growth (OD620 of 0.05–0.9). MC58{Delta}gna1870 was grown until the OD620 of 0.5. Bacterial cells were collected by centrifugation, washed once with PBS, and resuspended in various volumes of PBS in order to standardize the OD values. Culture supernatant was filtered using a 0.2 µm filter and 1 ml precipitated by the addition of 250 µl of 50% trichloroacetic acid (TCA). The sample was incubated on ice for 2 h, centrifuged for 40 min at 4°C and the pellet washed with 70% ice cold ethanol, and resuspended in PBS. 3 µl of each sample (corresponding to an OD620 of 0.03) was then loaded on a 12% polyacrylamide gels and electrotransferred onto nitrocellulose membranes. Western blot analysis was performed according to standard procedures (30), using anti-GNA1870 polyclonal antibodies at a 1:1,000 dilution, followed by a 1:2,000 dilution of HPR-labeled anti-human IgG (Sigma-Aldrich). Scanning was performed using a LabScan (Amersham Biosciences) and Imagemaster software (Amersham Biosciences).

[3H]-palmitic Acid Labeling of E. coli and N. meningitidis.
Palmitate incorporation of recombinant E. coli BL21(DE3) strain carrying the full-length gna1870 gene was confirmed as described by Jennings et al. (31).

Meningococcal strains MC58 and MC58{Delta}gna1870 were grown in GC medium and labeled with [9,10-3H]-palmitic acid (Amersham Biosciences). Cells from 5 ml culture were lysed by boiling for 10 min and centrifuged at 13,000 rpm. The supernatants were precipitated with TCA and washed twice with cold acetone. Proteins were suspended in 50 µl of 1.0% SDS and 15 µl analyzed by SDS-PAGE, stained with Coomassie brilliant blue, fixed, and soaked for 15 min in Amplify solution (Amersham Biosciences). Gels were exposed to Hyperfilm MP (Amersham Biosciences) at –80°C for 3 d.

Binding Assay to Human Transferrin.
Recombinant GNA1870, human transferrin hTF (Sigma T-4132) and the mix of the two (final concentration of 7 µM) were dialysed O/N in PBS at 4°C. After dialysis 20 µl of each protein and the mixture of them were loaded on a HPLC Superdex 200 PC 3.2/30 gel filtration column (Amersham Biosciences) using PBS as running buffer (32). Blue Dextran 2000 and the molecular weight standards ribonuclease A, chymotrypsinogen A, ovalbumin, bovine serum albumin (Amersham Biosciences) were used to calibrate the column. Gel filtration was performed using a Smart system with a flow rate of 0.04 ml/min and the eluted material monitored at 214 and 280 nm (the GNA1870 retention volume was 1.68 ml and 1.47 ml for htf). Fractions of 40 µl were collected and analyzed by SDS-PAGE. The MC58 recombinant transferrin-binding protein 2 (Tbp2) was used as positive control.

Mice Immunizations.
To prepare antisera, 20 µg of variant 1, variant 2, and variant 3 GNA1870 recombinant proteins were used to immunize 6-wk-old CD1 female mice (Charles River Laboratories). Four to six mice per group were used. The recombinant proteins were given intraperitoneally, together with CFA for the first dose and IFA for the second (day 21) and third (day 35) booster doses. The same immunization schedule were performed using Aluminium hydroxide (3 mg/ml) instead of Freund's adjuvant. Blood samples for analysis were taken on day 49.

FACS® Analysis.
The ability of polyclonal anti-GNA1870 antisera to bind to the surface of live meningococci was determined using FACScanTM flow cytometer on the MC58, MC58{Delta}siaD (nonencapsulated) and MC58{Delta}gna1870, on 961–5945 and 961–5945{Delta}gna1870, on M1239 and M1239{Delta}gna1870, on NZ394/98 and 67/00 strains. Antibody binding was detected using a secondary antibody anti–mouse (whole molecule) FITC-conjugated (Sigma-Aldrich). The positive control included SEAM 3, a mAb specific for the meningococcus B capsular polysaccharide (33). The negative control consisted of a mouse polyclonal antiserum against the cytoplasmic protein NMB1380 (34).

Complement-mediated Bactericidal Activity.
Serum bactericidal activity against N. meningitidis strains was evaluated as described previously (25, 35), with pooled baby rabbit serum (CedarLane) used as complement source. A human serum from an healthy adult (with no intrinsic bactericidal activity when tested at a final concentration of 25 or 50%) was also used as complement source. Serum bactericidal titers were defined as the serum dilution resulting in 50% decrease in CFU per ml after 60 min incubation of bacteria with reaction mixture, compared with control CFU per ml at time 0. Typically, bacteria incubated with the negative control antibody in the presence of complement showed a 150 to 200% increase in CFU/ml during the 60 min incubation.

Western Blot Analysis on Human Sera.
Purified GNA1870 (1 µg/lane) was loaded onto 12.5% SDS-polyacrylamide gels and transferred to a nitrocellulose membrane. The bound protein was detected with 1:200 dilution of convalescent or normal sera, followed by a 1:2,000 dilution of HPR-labeled anti–human IgG (Sigma-Aldrich).

Rat Protection.
5-d-old infant rats were pretreated intraperitoneally with anti-GNA1870 antisera or with anti-PorA monoclonal antibody at time 0 and challenged 2 h later intraperitoneally with 1.9 x 103 CFU/rat of MenC 4243 (OAc-positive). Quantitative blood cultures were obtained 18 h later. Bacterial counts in the blood cultures were obtained by plating 100, 10, and 1 µl (10 µl of a 1:10 dilution) of blood on chocolate agar plates.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GNA1870 Gene and Protein Features.
Genome-derived Neisseria Antigen 1870 (GNA1870) was selected while mining the still incomplete genome of the serogroup B strain MC58, because it had the typical signature of a surface-exposed lipoprotein. This was characterized by a signal peptide with a lipo-box motif of the type –Leu-X-X-Cys, where the Cysteine was followed by a Serine, an amino acid generally associated with outer membrane localization of lipoproteins (36). The gene was annotated as nmb1870 and nma0586 in the genome sequences of MenB MC58 and MenA Z2491 published by The Institute for Genomic Research (TIGR) and Sanger Center, respectively (37, 38). Interestingly, the electronic annotation of TIGR and Sanger assigned the gene start to ATG sequences located 138 and 18 base pairs upstream from the GTG that we propose as the real start codon. This new position is consistent with the presence of a correctly spaced ribosome-binding site, as well as with the prediction of the lipoprotein signature (Fig. 1) .



View larger version (18K):
[in this window]
[in a new window]
 
Figure 1. Nucleotide sequence of the region upstream gene gna1870 in MenB strain MC58. The DNA and deduced amino acid translation of the GNA1870 predicted lipoprotein signal peptide are also shown. The translation initiation codon GTG is positioned at nucleotide +1. The putative ribosome binding site (RBS) is shaded and two possible –10 and –35 promoter elements are indicated by dashed lines and dots, respectively. A putative Fur box is indicated (the sequence CATAACCAAAATGTTTATA matches the E. coli Fur box consensus GATAATGATAATCATTATC in 11 over 19 bases). Horizontal arrows indicate two inverted repeats containing a DNA uptake sequence. The start codons attributed by TIGR and Sanger are indicated by a box and a circle, respectively. The pentanucleotide ATATT used as site of insertion for the IS fragment in MenA strain Z2491 is underlined. In MenA, the presence of the IS fragment creates novel –10 and –35 elements. In Gonococcus, the whole region is conserved with that of MenB, however, the insertion of a single base (G) after position 36 causes a frame-shift, which results in the loss of the lipo-box motif. The correct frame is reestablished with a further eight-base insertion after position 73.

 
According to our analysis, gna1870 is a monocistronic gene and is located 157 bases downstream the stop codon of the fructose-bisphosphate aldolase gene nmb1869 (Fig. 1). In MenA Z2491 the overall organization is similar, however, 31 base pairs upstream from the GTG starting codon there is an insertion of 186 nucleotides that are homologous to an internal repeat region of IS1106, and are flanked by two 16 base pairs inverted repeats. A putative ribosome binding site and a putative Fur box are present 8 and 35 bp, respectively, upstream from the GTG starting codon. Putative promoter sequences were also detected. The mature protein is predicted to be a lipoprotein with a molecular weight of 26,964 Daltons and an isoelectric point of 7.96 in MC58, and is characterized by the presence of four Glycines downstream of the lipo-box motif. Secondary structure prediction analysis indicates that GNA1870 is a globular protein mostly composed of ß sheets. No homologous proteins were found by searching existing nonredundant prokaryotic and eukaryotic protein databases maintained at the NCBI site, including the human genome, suggesting that this protein is specific for Neisseria. However, a domain with some homology (28% identity over 146 amino acids) was found with the COOH-terminal portion of the transferrin-binding protein TfbA of Actinobacillus pleuropneumoniae (39). This amino acid homology does not seem to reflect a functional homology since the recombinant protein failed to bind human transferrin in vitro (data not depicted).

Protein Expression and Lipidation.
To produce a recombinant GNA1870, either the full-length gene or the region coding for amino acids 8–255 were amplified from N. meningitidis strain MC58 by PCR and cloned in the expression vector pET21b+. The recombinant COOH-terminal His-tagged fusion protein was purified and used to immunize mice to obtain antisera. When the full-length clone was grown in the presence of [9,10-3H]-palmitic acid, a radioactive band was detected at the expected molecular weight, confirming that E. coli recognizes the lipoprotein motif and adds a lipid tail to the recombinant protein (data not depicted). A radioactive band of the appropriate molecular weight was also detected in N. meningitidis grown in the presence of [9,10-3H]-palmitic acid (data not depicted). We conclude that GNA1870 is a lipoprotein both in N. meningitidis and in E. coli. The lipoprotein is surface-exposed and expressed at different levels by different strains.

Immune sera raised against the recombinant protein were used to detect the lipoprotein in N. meningitidis MC58 by Western blotting and FACS®. As shown in Fig. 2 , a protein of ~29.5 kD was detected in the total cell extracts of N. meningitidis. Scanning of the Western blot in Fig. 2 A showed that the amount of the protein in the whole cell lysate increased approximately two times during the growth curve, while the optical density of the culture increased from 0.05 to 0.9 OD620nm. Interestingly, a band of the same size was also detected in the culture supernatant. The protein was not detected in the supernatant of the freshly inoculated culture (OD620nm of 0.05), and increased approximately four times during the growth from 0.1 to 0.9 OD620nm (Fig. 2 B, insert 1). The genuine nature of the supernatant was confirmed by testing the same samples for the absence of membrane blebs and of cytoplasmic proteins. As shown in Fig. 2 B, insert 2, the absence in the supernatant preparations of PorA, known to be a major component of membrane blebs, rules out a possible contamination with membrane blebs, while the absence in the supernatant of the cytoplasmic protein NMB1380 confirmed that the supernatant samples do not result from cell lysis (Fig. 2 B, insert 3). The MC58{Delta}gna1870 strain, where the gene coding for the protein GNA1870 had been deleted, shows no protein either in the whole cell lysate or in the culture supernatant (KO lane, in Fig. 2, A and B). The protein was detected by Western blotting in outer membrane vesicles vaccines prepared by the Norwegian Institute of Public Health (NIPH), confirming that the protein segregates with the membrane fractions of N. meningitidis (Fig. 2 C). Interestingly, sera from mice immunized with the NIPH vaccine did not recognize the recombinant GNA1870 in Western blotting (data not shown), suggesting that the protein is not immunogenic in these preparations.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 2. Expression of GNA1870 in strain MC58. (A and insert 1 of B) Western blots of whole cell lysates and culture supernatants, respectively. Cultures were harvested at different times during the growth curve and probed with the anti-GNA1870 serum. (B, inserts 2 and 3) Culture supernatants probed with anti-PorA and anti-NMB1380 antisera, respectively. The OD620 of the culture is indicated above each lane. KO indicates a gna1870 knockout mutant of MC58. Wcl stands for whole cell lysate used as control. (C) Outer membrane vesicle (OMV) vaccine from the Norwegian Institute of Public Health and recombinant GNA1870 used as positive control probed with anti-GNA1870 serum. (D) FACS® analysis of encapsulated MC58 and of its nonencapsulated isogenic mutant using the serum against GNA1870. Shaded profile is the negative control obtained by reaction with the preimmune serum. Non-shaded profile shows reaction with immune sera.

 
FACS® analysis confirmed that the protein is surface-exposed and accessible to antibodies both in encapsulated and nonencapsulated N. meningitidis strains (Fig. 2 D). Western blotting analysis of 43 strains showed that the protein was expressed by all strains tested. However, as shown in Fig. 3 , the levels of expression varied considerably from strain to strain. The strains tested could be broadly classified as high, intermediate, and low expressors. Scanning of the Western blots showed that the difference in expression between high and intermediate, intermediate and low or high and low could be two-, five-, and ninefold, respectively. As shown in Table I, of the 43 strains tested, 25 (58%) expressed high levels of GNA1870, 11 (25.5%) expressed intermediate levels, and 7 (16.5%) expressed low levels. Most of the strains from hypervirulent lineages (ET-5, lineage 3, and ET-37) expressed high levels of the protein, with the exception of A4 isolates where two strains expressed intermediate levels and two expressed low levels. Interestingly, the protein was expressed at high level by strains that have been classically used as OMV vaccine strains (H44/76 and Cu385). No obvious genetic patterns were found to predict the amount of protein expressed by each strain. Even the presence of the IS element in the promoter region, which was found in 8/71 strains (one from serogroup A, three from lineage 3, and four from those classified as others), did not show any correlation with the expression of the protein.



View larger version (83K):
[in this window]
[in a new window]
 
Figure 3. Western blots of a gradient SDS-PAGE gel loaded with total cell lysates of strains expressing high (lanes 1 and 2), intermediate (lanes 3 and 4), and low (lanes 5 and 6) levels of GNA1870. Lane 7 contains a total cell lysate from strain MC58 in which the gene encoding GNA1870 has been inactivated. Lane 1 strain MC58; lane 2 strain H44/76; lane 3 strain NZ394/98; lane 4 strain 961–5945, lane 5 strain 67/00, lane 6 strain M1239, lane 7 MC58{Delta}gna1870.

 

View this table:
[in this window]
[in a new window]
 
Table I. Level of Expression of GNA1870

 
21/40 convalescent sera recognized the recombinant protein in Western blot, while only 2/10 of sera from healthy people recognized it. Thus, GNA1870 may be immunogenic in patients recovering from meningococcal disease.

The Protein Induces Bactericidal Antibodies and Confers Passive Protection in the Infant Rat.
The antisera obtained immunizing with the recombinant protein were tested for their ability to induce complement-mediated killing of encapsulated N. meningitidis strains. Representative strains from the high, intermediate and low expressors were selected for the assay using Western blotting. The differential expression of the protein on the surface of the selected strains was confirmed by FACS® analysis (Fig. 4) . As shown in the figure, MC58, a representative of the high expressor strains was killed with high efficiency by the serum diluted up to 1/64,000, NZ394/98, a representative of the intermediate expressors was also killed with high efficiency, by the serum diluted up to 1/16,000 and even strain 67/00, a representative of the low expressor strains was killed by the antiserum diluted up to 1/2,048. A control strain, where the gna1870 gene had been knocked out, was not killed by the same antiserum. To determine whether the sera were also able to confer protection in vivo, we tested them for their ability to induce passive protection in the infant rat model using two serogroup B and one serogroup C strains. Protection was achieved with all strains and the results obtained with one of the strains are shown in Table II. No bacterial colonies were recovered from the blood of the rats passively immunized with the anti GNA1870, while most of the controls were bacteremic. Similar results were obtained with two other strains (data not shown).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 4. Bactericidal activity and FACS® analysis results of three strains expressing high, intermediate or low levels of GNA1870, based on Western blot of whole-cell lysates with antiserum against GNA1870. Shaded profiles are the negative controls obtained by reaction with the preimmune sera; nonshaded profiles show binding of immune sera. The intermediate expressor NZ394/98 and the low expressor 67/00 have identical amino acid sequences, which are 91.6% homologous to MC58.

 

View this table:
[in this window]
[in a new window]
 
Table II. Passive Protection of Infant Rats Challenged with 5 x 107 CFU of Serogroup C Strain 4243

 
Gene Distribution and Protein Diversity.
gna1870 gene was detected by PCR in 71/71 Neisseria strains. The strain panel mostly includes serogroup B strains, a few strains of serogroups A, C, Y, W-135, and Z, and one strain each of N. gonorrhoeae and N. cinerea. In N. lactamica we could detect a band by Western blotting, but we failed to amplify the gene. Nucleotide sequence of the gene was determined in all 71 strains. Computer analysis of the gna1870 encoded peptides, using Kimura and Jukes-Cantor algorithm divided the family in three variants (Fig. 5) . Strains MC58, 961–5945, and M1239 were arbitrarily selected as type strains for variants 1, 2, and 3, respectively. The sequence diversity between the three type strains is shown in Fig. 6 . Amino acid identity was 74.1% between variant 1 and variant 2, 62.8% between variant 1 and variant 3, and 84.7% between variant 2 and variant 3. Sequences within each variant were well-conserved, the most distant showing 91.6, 93.4, and 93.2% identity to their type strains, respectively. N. cinerea belongs to variant 1, and shares 96.7% homology with MC58. As shown in Fig. 5, variant 1 harbors all strains from hypervirulent lineages ET-5, most lineage 3 strains, the serogroup A strains, two recent isolates of W-135 and one ET-37 strain. Variant 2 harbors all strains from the hypervirulent complex A4, from serogroups Y and Z, one old W-135 isolate and four ET-37 strains. Variant 3 harbors four unique ST strains, one ET-37 strain, one lineage 3 strain, and gonococcus.



View larger version (28K):
[in this window]
[in a new window]
 
Figure 5. Dendrogram showing the strain clustering according to GNA1870 protein distances. 1, 2, and 3 indicate the three variants. Numbers in square brackets indicate the strains with identical sequence present in each branch of the dendrogram. Hypervirulent lineages are indicated, followed by the number of strains when this is different from the total number. Serogroups other than B are also shown. The three type strains (MC58, 961–5965, and M1239) and other strains used in the reported serological analysis and infant rat studies are within circles.

 


View larger version (68K):
[in this window]
[in a new window]
 
Figure 6. Sequence alignment of variant 1 (strain MC58), variant 2 (strain 961–5945), and variant 3 (strain M1239). Amino acid numbers initiate from the Cysteine predicted to be the first amino acid of the mature protein. Gray and black backgrounds indicate conserved and identical residues, respectively.

 
Bactericidal Activity is Variant-specific.
One sequence of each variant was expressed in E. coli as His-tag and used to immunize mice. The resulting antisera were used to test immunological cross-reactivity between strains of the three variants by FACS® and bactericidal assay. As shown in Fig. 7 , by FACS® analysis, all strains were recognized by each antiserum, however, the degree of recognition varied considerably, usually reflecting the amino acid homology between the proteins. In fact, the antiserum against the variant 1 protein (Fig. 7, first row) recognized very well the MC58 strain, to a lower extent the 961–5945 strain, which is 74.1% homologous and, to a lesser extent, the strain M1239 that has an amino acid identity of 62.8%. A similar trend was found for antisera against variants 2 and 3 (rows 2 and 3, respectively, of Fig. 7), although with the anti variant 2 serum the differences were not striking. A monoclonal antibody against the capsule recognized equally well the three strains (Fig. 7, row 4), while a serum against the cytoplasmic protein NMB1380 used as negative control did not recognize them (Fig. 7, row 5). The gna1870 knock-out mutants were not recognized at all by their specific sera (Fig. 7, row 6).



View larger version (47K):
[in this window]
[in a new window]
 
Figure 7. FACS® analysis of sera prepared against recombinant GNA1870 protein representative of variant 1 (first row), variant 2 (second row), and variant 3 (third row), using the type strain of variant 1 (MC58), variant 2 (961–5945), and variant 3 (M1239). Control sera against the capsular polysaccharide is shown in row 4 (monoclonal antibody Seam3). A negative control antiserum against a cytoplasmic protein is shown in row 5 (anti-NMB1380). Row 6 contains the knockout mutants (KO) of each type strain, probed with the homologous antiserum. Shaded profile are the negative controls obtained by reaction with the preimmune sera. Non-shaded profiles show reaction with immune sera.

 
The differences in immuno-recognition between the three variants were more evident by bactericidal assay. As shown in Table III, the serum against each variant was able to induce efficient complement-mediated killing of the homologous strain (titers ranging between 16,000 and 64,000), while the activity was low (titers of 128–2,048) or absent (titers <4) against strains of the other variants. Moreover, in the case of variant 1, we also showed that the most distantly related strains, located at the bottom of the dendogram in Fig. 5, were killed by the anti-MC58 antiserum (titers of above 2.048).


View this table:
[in this window]
[in a new window]
 
Table III. Cross Bactericidal Titers between GNA1879 Variants

 
As predicted from the close amino acid homology, the cross-bactericidal titers between variants 2 and 3 were higher than the others. When human complement was used, bactericidal titers of 4,096, 256 and 512 were obtained with variants 1, 2, and 3, respectively, using the homologous strains of Table III. No titers were detected against the heterologous strains.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Vaccination against N. meningitidis serogroups A, C, W-135, and Y is likely to enter routine use once the conjugate vaccines against these strains will complete the ongoing clinical trials. This will leave disease caused by serogroup B meningococcus, which causes ~50% of invasive disease as the only one not preventable by vaccination. Given the chemical composition of the serogroup B capsule, which is identical to a polysaccharide present in human tissues, development of universal protein-based vaccines against serogroup B N. meningitidis are desirable and urgent.

Conventional approaches to protein-based vaccine development have delivered OMV vaccines which, although efficacious against homologous strains, are unable to induce complement-mediated bactericidal antibodies against heterologous strains, especially in infants and toddlers. The determination of the genome sequence of group B strain MC58 made available the entire repertoire of gene products and allowed the discovery of several novel antigens, which may be used alone or in combination for the development of new vaccines. Some of these were briefly described in initial publications (25), while others have been described in more detail (26, 40). Here we report the discovery and characterization of a novel antigen, that is present on the surface of all strains of N. meningitidis tested and that is a highly promising candidate for the development of protein-based vaccines against meningococcus.

GNA1870 May Be Sufficient to Immunize against Most Strains of N. meningitidis.
The observation that GNA1870 is expressed on the surface by all strains tested to date and is a good target for bactericidal antibodies makes this protein an excellent vaccine candidate. However, there are two potential problems that may limit the possibility of using the antigen. The first is that the expression varies from strain to strain; the second is that there is sequence variability with little or no cross-protection between the different variants. Here we have shown that even strains expressing very low quantities of the protein are efficiently killed by the antisera, a result suggesting that even the low expressors have enough protein on the surface to be a target for complement-mediated attack. The sequence diversity, on the other hand, is limited to three variants, so that we believe it should be possible to induce immunity against all strains of meningococcus by immunizing with a combination of the three proteins. Although our focus is the development of a vaccine against meningococcus B, the data suggest that vaccination with three proteins would induce immunity against all serogroups of meningococcus (see Table II, infant rat protection using a C strain, 4243).

Features of the Gene and Protein.
The presence of a putative Fur box in the promoter suggests that the expression of GNA1870 may be regulated by iron. However, preliminary experiments have shown that the expression of the protein does not increase in low iron conditions (data not shown). We have not been able to find a reason for the different expression of the protein by different strains. Analysis of the DNA sequences upstream from the gene did not show any feature that we could correlate with the differential expression.

An interesting feature of the protein is the presence of a stretch of four Glycines downstream from the lipidated Cysteine. Three or more consecutive glycines downstream from the lipidated Cysteine are present also in other five lipoproteins in N. meningitidis, namely the transferrin-binding protein B (TbpB), the outer membrane component of an ABC transporter NMB0623, the hypothetical protein NMB1047, the TbpB homologue GNA2132 (25), and the AspA lipoprotein (41). In none of these proteins is the poly-glycine stretch encoded by a poly-G tract, suggesting that this feature is not there to generate antigenic modulation. Proteins with this signature are widespread in prokaryotic organisms. A search performed on 22 complete bacterial genomes retrieved 29 lipoproteins with this motif in some but not all bacterial species. The organisms with these type of lipoproteins include both gram negative and gram positive bacteria such as Haemophilus influenzae, Enterococcus fecalis, Mycobacterium tuberculosis, Listeria monocytogenes, Staphylococcus aureus, while others such as E. coli, Bacillus subtilis, Helicobacter pylori, Streptococcus pneumoniae, S. pyogenes, and Vibrio cholerae have none. Most of the lipoproteins with this signature belong to ABC transporters, followed by proteins of unknown function. Although this common feature in the primary structure suggests a common role for the Glycine repeats, so far, the function is not known. However, it has been recently proposed that it may serve to guide the lipoproteins to a specific pathway of secretion and surface localization (42).

Conclusions.
We have described a new protein of N. meningitidis, which is immunogenic during disease, is able to induce bactericidal antibodies in mice, and whose resulting antibodies confer passive protection against meningococcal bacteremia in infant rats. The protein is expressed by all strains tested. Overall these data suggest that protection against most N. meningitidis strains can be achieved by immunizing with three sequence variants of the protein. If human trials with this protein will induce an immune response similar to the one described here for mice, the development of protein-based vaccines against meningococcus may become a reality. In theory the three variants of GNA1870 could be enough to elicit immunity against all strains of meningococcus, however, a vaccine containing also other antigens may be more appropriate, because it would target more than one antigen per bacterium and therefore it would decrease the possibility of selecting escape mutants. A question that needs to be addressed in future studies is whether vaccines based on common proteins will immunize also against commensal Neisseria and whether this is desirable.


    Acknowledgments
 
We thank D. Caugant, T. Popovic, E.R. Moxon, E. Kaczmarski, M.K. Taha, J. Vazquez, E. Rosenqvist, D. Martin, P. Mastrantonio, M. Tanizaki, and G. Hogg for providing meningococcal strains, J. Green for her assistance in experiments with gene variability, I. Delaney for helpful discussion, C. Mallia for editing, and G. Corsi for artwork. This work made use of the Multi Locus Sequence Typing website (http://www.mlst.net) developed by Dr. Man-Suen Chan. The development of this site is funded by the Wellcome Trust.

This work was supported, in part, by grants RO1AI45642 and AI46464 from the National Institute of Allergy and Infectious Diseases of the National Institutes of Health to D.M. Granoff. J. Adu-Bobie was a Marie Curie Fellowship recipient of the European Union.

Submitted: November 1, 2002
Revised: January 28, 2003
Accepted: January 31, 2003


    Footnotes
 
V. Masignani and M. Comanducci contributed equally to this work.

* Abbreviation used in this paper: OMV, outer membrane vesicle. Back


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

1 Andersen, B.M. 1978. Mortality in meningococcal infections. Scand. J. Infect. Dis. 10:277–282.[Medline]

2 Edwards, M.S., and C.J. Baker. 1981. Complications and sequelae of meningococcal infections in children. J. Pediatr. 99:540–545.[CrossRef][Medline]

3 Bedford, H., J. de Louvois, S. Halket, C. Peckham, R. Hurley, and D. Harvey. 2001. Meningitis in infancy in England and Wales: follow up at age 5 years. BMJ. 323:1–5.[Abstract/Free Full Text]

4 Branham, S.E. 1953. Serological relationships among meningococci. Bact. Rev. 17: 175–188.[Free Full Text]

5 Vedros, N.A. 1987. Development of meningococcal serogroups. Evolution of Meningococcal Disease. N.A. Vedros, editor. CRC Press, Inc., Boca Raton, FL. 33–37.

6 Frasch, C.E. 1989. Vaccines for prevention of meningococcal disease. Clin. Microbiol. Rev. 2:S134–S138.

7 Achtman, M. 1995. Global epidemiology of meningococcal disease. Meningococcal Disease. K. Cartwight, editor. John Wiley and Sons, Chichester, England. 159–175.

8 Caugant, D.A. 1998. Population genetics and molecular epidemiology of Neisseria meningitidis. APMIS. 106:505–525.[Medline]

9 Maiden, M.C., J.A. Bygraves, E. Feil, G. Morelli, J.E. Russell, R. Urwin, Q. Zhang, J. Zhou, K. Zurth, D.A. Caugant, et al. 1998. Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proc. Natl. Acad. Sci. USA. 95:3140–3145.[Abstract/Free Full Text]

10 Gotschlich, E.C., T.Y. Liu, and M.S. Artenstein. 1969a. Human immunity to the meningococcus. 3. Preparation and immunochemical properties of the group A, group B, and group C meningococcal polysaccharides. J. Exp. Med. 129:1349–1365.[Abstract]

11 Gotschlich, E.C., I. Goldschneider, and M.S. Artenstein. 1969b. Human immunity to the meningococcus. IV. Immunogenicity of group A and group C meningococcal polysaccharides in human volunteers. J. Exp. Med. 129:1367–1384.[Abstract]

12 Lepow, M.L., J. Beeler, M. Randolph, J.S. Samuelson, and W.A. Hankins. 1986. Reactogenicity and immunogenicity of a quadrivalent combined meningococcal polysaccharide vaccine in children. J. Infect. Dis. 154:1033–1036.[Medline]

13 Costantino, P., S. Viti, A. Podda, M.A. Velmont, L. Nencioni, and R. Rappuoli. 1992. Development and phase 1 clinical testing of a conjugate vaccine against meningococcus A and C. Vaccine. 10:691–698.[CrossRef][Medline]

14 Ramsay, M.E., N. Andrews, E.B. Kaczmarski, and E. Miller. 2001. Efficacy of meningococcal serogroup C conjugate vaccine in teenagers and toddlers in England. Lancet. 357:195–196.[CrossRef][Medline]

15 Peltola, H. 1998. Meningococcal vaccines. Current status and future possibilities. Drugs. 55:347–366.[CrossRef][Medline]

16 Hayrinen, J., H. Jennings, H.V. Raff, G. Rougon, N. Hanai, R. Gerardy-Schahn, and J. Finne. 1995. Antibodies to polysialic acid and its N-propyl derivative: binding properties and interaction with human embryonal brain glycopeptides. J. Infect. Dis. 171:1481–1490.[Medline]

17 Finne, J., D. Bitter-Suermann, C. Goridis, and U. Finne. 1987. An IgG monoclonal antibody to group B meningococci cross-reacts with developmentally regulated polysialic acid units of glycoproteins in neural and extraneural tissues. J. Immunol. 138:4402–4407.[Abstract]

18 Rosenstein, N.E., B.A. Perkins, D.S. Stephens, L. Lefkowitz, M.L. Cartter, R. Danila, P. Cieslak, K.A. Shutt, T. Popovic, A. Schuchat, et al. 1999. The changing epidemiology of meningococcal disease in the United States, 1992-1996. J. Infect. Dis. 180:1894–1901.[CrossRef][Medline]

19 Cartwright, K., N. Noah, and H. Peltola. 2001. Meningococcal disease in Europe: epidemiology, mortality, and prevention with conjugate vaccines. Report of a European advisory board meeting Vienna, Austria, 6-8 October, 2000. Vaccine. 19:4347–4356.[CrossRef][Medline]

20 Sierra, G.V., H.C. Campa, N.M. Varcacel, I.L., Garcia, P.L. Izquierdo, P.F. Sotolongo, G.V. Casanueva, C.O. Rico, C.R. Rodriguez, and M.H. Terry. 1991. Vaccine against group B Neisseria meningitidis: protection trial and mass vaccination results in Cuba. NIPH Ann. 14:195–207.[Medline]

21 Bjune, G. E.A. Hoiby, J.K. Gronnesby, O. Arnesen, J.H. Fredriksen, A. Halstensen, E. Holten, A.K. Lindbak, H. Nokleby, E. Rosenqvist, et al. 1991. Effect of outer membrane vesicle vaccine against group B meningococcal disease in Norway. Lancet. 338:1093–1096.[CrossRef][Medline]

22 Tappero, J.W., R. Lagos, A.M. Ballesteros, B. Plikaytis, D. Williams, J. Dykes, L.L. Gheesling, G.M. Carlone, E.A. Hoiby, J. Holst, et al. 1999. Immunogenicity of 2 serogroup B outer-membrane protein meningococcal vaccines: a randomized controlled trial in Chile. J. Am. Med. Assoc. 281:1520–1527.[Abstract/Free Full Text]

23 Perkins, B.A., K. Jonsdottir, H. Briem, E. Griffiths, B.D. Plikaytis, E.A. Hoiby, E. Rosenqvist, J. Holst, H. Nokleby, F. Sotolongo, et al. 1998. Immunogenicity of two efficacious outer membrane protein-based serogroup B meningococcal vaccines among young adults in Iceland. J. Infect. Dis. 177:683–691.[Medline]

24 Jódar, L., I.M. Feavers, D. Salisbury, and D.M. Granoff. 2002. Development of vaccines against meningococcal disease. Lancet. 359:1499–1508.[CrossRef][Medline]

25 Pizza, M., V. Scarlato, V. Masignani, M.M. Giuliani, B. Arico, M. Comanducci, G.T. Jennings, L. Baldi, E. Bartolini, B. Capecchi, et al. 2000. Identification of vaccine candidates against serogroup B meningococcus by whole-genome sequencing. Science. 287:1816–1820.[Abstract/Free Full Text]

26 Comanducci, M., S. Bambini, B. Brunelli, J. Adu-Bobie, B. Aricò, B. Capecchi, M.M. Giuliani, V. Masignani, L. Santini, S. Savino, et al. 2002. NadA, a novel vaccine candidate of Neisseria meningitides. J. Exp. Med. 195:1445–1454.[Abstract/Free Full Text]

27 Harris, S.L., J.J. King, W. Ferris, and D.M. Granoff. 2003. Age-related disparity in functional activities of human group C serum anticapsular antibodies elicited by meningococcal polysacchardie vaccine. Infect. Immun. 71:275–286.[Abstract/Free Full Text]

28 Nakai, K., and M. Kanehisa. 1991. Expert system for predicting protein localization sites in Gram-negative bacteria. Proteins. 11:95–110.[CrossRef][Medline]

29 de Lorenzo, V., S. Wee, M. Herrero, and J.B. Neilands. 1987. Operator sequences of the aerobactin operon of plasmid ColV-K30 binding the ferric uptake regulation (fur) repressor. J. Bacteriol. 169:2624–2630.[Abstract/Free Full Text]

30 Laemmli, U.K., M. Virji, H. Kayhty, D.J. Ferguson, C. Alexandrescu, and E.R. Moxon. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227:680–685.[CrossRef][Medline]

31 Jennings, G.T., S. Savino, E. Marchetti, B. Aricò, T. Kast, L. Baldi, A. Ursinus, J. Holtje, R.A. Nicholas, R. Rappuoli, and G. Grandi. 2002. GNA33 from Neisseria meningitidis serogroup B encodes a membrane-bound lytic transglycosilase (MltA). Eur. J. Biochem. 269:3722–3731.[Medline]

32 Schlegel, A., O. Danot, E. Richet, T. Ferenci, and W. Boos. 2002. The N terminus of the Escherichia coli transcription activator MalT is the domain of interaction with MalY. J. Bacteriol. 184:3069–3077.[Abstract/Free Full Text]

33 Granoff, D.M., A. Bartoloni, S. Ricci, E. Gallo, D. Rosa, N. Ravenscroft, V. Guarnieri, R.C. Seid, A. Shan, W.R. Usinger, et al. 1998. Bactericidal monoclonal antibodies that define unique meningococcal B polysaccharide epitopes that do not cross-react with human polysialic acid. J. Immunol. 160:5028–5036.[Abstract/Free Full Text]

34 Grifantini, R., E. Bartolini, A. Muzzi, M. Draghi, E. Fringimelica, J. Berger, G. Ratti, R. Petracca, G. Galli, M. Agnusdei, et al. 2002. Previously unrecognized vaccine candidates against serogroup B meningococcus identified by DNA microarrays. Nat. Biotechnol. 20:914–921.[CrossRef][Medline]

35 Peeters, C.C., I.J. Claassen, M. Schuller, G.F. Kersten, E.M. van der Voort, and J.T. Poolman. 1999. Immunogenicity of various presentation forms of PorA outer membrane protein of Neisseria meningitidis in mice. Vaccine. 17:2702–2712.[CrossRef][Medline]

36 Yamaguchi, K., F. Yu, and M. Inouye. 1988. A single amino acid determinant of the membrane localization of lipoproteins in E. coli. Cell. 53:423–432.[CrossRef][Medline]

37 Tettelin, H., N.J. Saunders, J. Heidelberg, A.C. Jeffries, K.E. Nelson, J.A. Eisen, K.A. Ketchum, D.W. Hood, J.F. Peden, R.J. Dodson, et al. 2000. Complete genome sequence of Neisseria meningitidis serogroup B strain MC58. Science. 287:1809–1815.[Abstract/Free Full Text]

38 Parkhill, J., M. Achtman, K.D. James, S.D. Bentley, C. Churcher, S.R. Klee, G. Morelli, D. Basham, D. Brown, T. Chillingworth, et al. 2000. Complete DNA sequence of a serogroup A strain of Neisseria meningitidis Z2491. Nature. 404:502–506.[CrossRef][Medline]

39 Strutzberg, K., L. von Olleschik, B. Franz, C. Pyne, M.A. Schmidt, and G.F. Gerlach. 1995. Mapping of functional regions on the transferrin-binding protein (TfbA) of Actinobacillus pleuropneumoniae. Infect. Immun. 63:3846–3850.[Abstract]

40 Granoff, D.M., G.R. Moe, M.M. Giuliani, J. Adu-Bobie, L. Santini, B. Brunelli, F. Piccinetti, P. Zuno-Mitchell, S.S. Lee, P. Neri, et al. 2001. A novel mimetic antigen eliciting protective antibody to Neisseria meningitidis. J. Immunol. 167:6487–6496.[Abstract/Free Full Text]

41 Turner, D.P., K.G. Wooldridge, and D.A. Ala'Aldeen. 2002. Autotransported serine protease A of Neisseria meningitidis: an immunogenic, surface-exposed outer membrane, and secreted protein. Infect. Immun. 70:4447–4461.[Abstract/Free Full Text]

42 Voulhoux, J.R. and J. Tommassen. Transport of lipoproteins to the cell surface in Neisseria meningitidis. Thirteenth International Pathogenic Neisseria Conference. NIPH, Oslo, Norway. September 1-6 2002. p. 31.


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 377K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Masignani, V.
Right arrow Articles by Pizza, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masignani, V.
Right arrow Articles by Pizza, M.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Medline Plus Health Information
*Immunization
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?


  Home | Help | Feedback | Subscriptions | Archive | Search
TABLE OF CONTENTS