Published 16 September 2002. doi:10.1084/jem.20020179
© Rockefeller University Press, 0022-1007/2002/9/765/ $5.00
The Journal of Experimental Medicine, Volume 196, Number 6, September 16, 2002 765-780
Np73, A Dominant-Negative Inhibitor of Wild-type p53 and TAp73, Is Up-regulated in Human Tumors
Alex I. Zaika1,
Neda Slade1,
Susan H. Erster1,
Christine Sansome1,
Troy W. Joseph1,
Michael Pearl2,
Eva Chalas2 and
Ute M. Moll1
1 Department of Pathology, Stony Brook University, Stony Brook, NY 11794
2 Department of Obstetrics and Gynecology, Stony Brook University, Stony Brook, NY 11794
Address correspondence to Ute M. Moll, Department of Pathology, BST L9 R134, Stony Brook University, Stony Brook, NY 11794. Phone: 631-444-2459; Fax: 631-444-3424; E-mail: umoll{at}notes.cc.sunysb.edu
 |
Abstract
|
|---|
p73 has significant homology to p53. However, tumor-associated up-regulation of p73 and genetic data from human tumors and p73-deficient mice exclude a classical Knudson-type tumor suppressor role. We report that the human TP73 gene generates an NH2 terminally truncated isoform.
Np73 derives from an alternative promoter in intron 3 and lacks the transactivation domain of full-length TAp73.
Np73 is frequently overexpressed in a variety of human cancers, but not in normal tissues.
Np73 acts as a potent transdominant inhibitor of wild-type p53 and transactivation-competent TAp73.
Np73 efficiently counteracts transactivation function, apoptosis, and growth suppression mediated by wild-type p53 and TAp73, and confers drug resistance to wild-type p53 harboring tumor cells. Conversely, down-regulation of endogenous
Np73 levels by antisense methods alleviates its suppressive action and enhances p53- and TAp73-mediated apoptosis.
Np73 is complexed with wild-type p53, as demonstrated by coimmunoprecipitation from cultured cells and primary tumors. Thus,
Np73 mediates a novel inactivation mechanism of p53 and TAp73 via a dominant-negative family network. Deregulated expression of
Np73 can bestow oncogenic activity upon the TP73 gene by functionally inactivating the suppressor action of p53 and TAp73. This trait might be selected for in human cancers.
Key Words: p73
Np73 Ex2Del p73 apoptosis deregulation in tumor
 |
Introduction
|
|---|
The p53 family member p73 has significant homology to the p53 tumor suppressor. Human full-length p73 (TAp73) shares 63% amino acid identity with the DNA-binding region of TP53 including conservation of all DNA contact residues, as well as 38 and 29% identity with the tetramerization domain and transactivation domain, respectively (1). TAp73 also shows functional homology to p53. Ectopically overexpressed TAp73
and TAp73ß (two COOH-terminal splice variants) largely mimic p53 activities, including the induction of apoptosis, cell cycle arrest, and the transactivation of an overlapping set of target genes (2, 3). Moreover, endogenous TAp73 is able to integrate death stimuli from three different pathways: cellular and viral oncogenes, some forms of DNA damage, and T cell receptor hyperactivation. We and others have shown that deregulation of the oncogenes E2F1, cMyc, and E1A induces apoptosis and growth suppression in tumor cells in a p53-independent manner by transcriptionally inducing and activating endogenous TAp73 proteins (47). Moreover, during E2F1-mediated apoptosis in primary mouse embryo fibroblasts (MEFs),* a supra-additive cooperation exists between wild-type p53 and TAp73 (5). Although wild-type MEFs show 77% apoptosis after forced E2F1 expression, p53-/- MEFs (containing TAp73) and p73-/- MEFs (containing p53) alone show reduced killing ability of only 12 and 15%, respectively. The excessively weakened killing ability of p73-/- MEFs, despite the presence of wild-type p53, is consistent with an important synergistic signal emanating from TAp73 that cooperates with p53 to induce oncogene-triggered death. Because oncogene deregulation of E2F1 is one of the most common genetic alterations in human tumors, this finding provides a possible physiologic cause for TAp73 overexpression in tumors. Furthermore, TAp73 is activated to mediate apoptosis by a restricted spectrum of DNA damage. Endogenous TAp73 is activated in response to cisplatin, and
-IR in a pathway that depends on the nonreceptor tyrosine kinase c-abl (810). Moreover, doxorubicin stabilizes TAp73 protein by acetylation (11). Conversely, cells deficient in c-abl do not up-regulate their p73 and are resistant to killing by cisplatin. On the other hand, TAp73 is not activated by UV, actinomycin D, and mitomycin C, all of which activate p53 (1, 8). Lastly, peripheral T cells undergo apoptosis after hyperstimulation of their T cell receptors. This cell fate is mediated via the E2F1TAp73 pathway (6). Consistent with this notion, E2F1 null mice exhibit a marked disruption of lymphatic homeostasis with increased T cells and splenomegaly (12, 13). Thus, TAp73 might function independently but synergistically with p53 in a tumor surveillance pathway in vivo.
However, despite this strong functional homology, data from human tumors and p73-deficient mice argue against a classical Knudson-type tumor suppressor role for the TP73 gene. TP73-deficient mice lack a spontaneous tumor phenotype (14) and inactivating mutations in human tumors are extremely rare (>900 tumors analyzed to date; for review see reference 15). Moreover, although all normal human tissues studied express very low levels of p73, multiple primary tumor types and tumor cell lines overexpress wild-type p73, including cancers of the breast, lung, esophagus, stomach, colon, bladder, ovary, liver, bile ducts, ependymal lining, myelogenous leukemia, and neuroblastoma (15). It is important to point out that to date, most studies identifying p73 overexpression in primary human tumors have examined total levels of p73, with only a few exceptions that specifically measured TAp73 (16, 17). Importantly, in the mouse, an N terminally truncated
Np73 protein has recently been found, generated from an alternative promoter in intron 3 and lacking a transactivation domain (18).
Np73 is the predominant form in the developing mouse brain and is the only form of p73 in the neonatal brain and sympathetic ganglia (14, 18). Mouse
Np73 plays an essential antiapoptotic role during developmental p53-driven neuronal death in vivo by acting as a dominant-negative inhibitor of p53 (18). Functional studies have shown that
Np73 is required to counteract p53-mediated neuronal death during normal "sculpting" of the developing mouse neuronal system (18). In primary neuronal cultures, withdrawal of the obligate survival factor nerve growth factor leads to p53 induction with p53-dependent cell death but a concomitant decrease of
Np73. Importantly, sympathetic neurons are rescued from cell death after nerve growth factor withdrawal or recombinant adenoviral p53 infection when
Np73 levels are maintained by viral delivery (18). Given the existence of this powerful transdominant p53 inhibitor in the mouse, the possibility arose that this isoform might in part be responsible for the overexpression seen in human tumors and, in fact, be the crucial component. Therefore, we sought the human counterpart of
Np73, determined whether human tumors express it and determined its potential role in cancer.
 |
Materials and Methods
|
|---|
Tumor Samples and Cell Lines.
Primary tumors and normal tissues were collected at University Hospital State University of New York, Stony Brook in compliance with and approved by the Institutional Review Board. Freshly harvested tumors (minimum 60% tumor cells) and normal tissues were immediately snap frozen in liquid nitrogen and stored at -80°C until RNA extraction. The human breast cancer cell line MDA 231, the p53 null lines H1299 and SaOs2, and the wild-type p53 lines U2OS, RKO, and HeLa cells were maintained in DMEM/10% fetal calf serum.
Semiquantitative RT-PCR Assay.
Total RNA was extracted from tissues as previously described (17). 1 µg total RNA, 10 pmoles each of a radiolabeled isoform-specific upstream primer, and a common TP73 exon 4 reverse primer were used in a 10-µl reaction (Titan Kit; Roche) for 25 cycles to ensure linearity of the assay (unpublished data) and subjected to phosphoimage analysis. Primer sequences were 5'-TGC TGT ACG TCG GTG ACC-3' (sense
Np73), 5'-CGA CGG CTG CAG AGC GAG-3' (sense TAp73), and 5'-TCG AAG GTG GAG CTG GGT TG-3' (antisense for both).
Np73 and TAp73 amplicon sizes were 175 and 365 bp, respectively. For Ex2Del p73, primers were 5'-GCG CCA GGC CAG CCG GGA CGG AC-3' (sense) and 5'-CGC GGC TGC TCA TCT GGT CCA TGG TGC-3' (antisense), which yielded a 320-bp band. Band intensities were normalized to their respective glyceraldehyde3-phosphate dehydrogenase (GAPDH) values. In matched samples, the up-regulation in tumors was calculated by dividing normalized
Np73Tumor by
Np73Normal, TAp73Tumor by TAp73Normal, or Ex2Del p73Tumor by Ex2Del p73Normal. To calculate the preferential up-regulation of
Np73 in tumors, the formula
Np73Tumor/
Np73Normal divided by TAp73Tumor/TAp73Normal was used. The analogous formula was used for Ex2Del p73. Some samples were independently repeated and yielded highly reproducible results. Genomic sequencing of p53 exons 59 was performed with the Amplimer Panel (CLONTECH Laboratories, Inc.). Immunocytochemical staining for p53 was done on fixed tissue sections from the same tumor mass.
Luciferase Assays.
A pcDNA3-based expression plasmid for
Np73
was generated with an NH2-terminal Flag tag. pcDNA3-Fp53 expressing human Flag-tagged wild-type p53, pcDNA3-p73
and pcDNA3-p73ß expressing hemagglutinin-tagged human TAp73
and TAp73ß (provided by G. Melino, University of Rome, Rome, Italy), murine stem cell virus expressing a tetramerization domain mutant of
Np73
called
Np73L322P (corresponding to L371P in TAp73
), and the p53/p73-specific reporter PG13-Luc were previously described (4). PG13 is a reporter plasmid containing 13 tandem repeats of the p53 consensus DNA binding site. H1299 and SaOs2 cells were transfected by Fugene (Roche). Luciferase activity was normalized for renilla luciferase activity (Promega).
Western Blot and Coimmunoprecipitation Analysis.
Hela and H1299 cells were transfected with expression plasmids for wild-type p53 (0.5 µg) or TAp73ß (0.5 µg) with either 1.5 µg
Np73
or empty vector (see Fig. 3
C). The indicated molar ratios were used and green fluorescent protein (GFP) was cotransfected in all cases (see Fig. 3 B). Total cell lysates were prepared 24 h later and subjected to immunoblot analysis. Gel loading was normalized for equal vimentin or GFP levels (20 µg per lane). Antibodies to p73 were monoclonal ER15 (recognizes amino acids 380495 of human p73
isoforms and detects TA and
N forms; Oncogene Research Products), polyclonal anti-p73 (raised against the COOH-terminal; Chemicon), and the polyclonal anti-
Np73 (raised in rabbit against the exon 3' peptide LYVGDPARHLATA and immunopurified, and does not cross react with p53 or any TAp73 isoform). Antibodies against p53 (DO-1 and PAb 421), HDM2 (IF2), p21Waf1, and 14-3-3
were from Oncogene Research Products and Flag antibody (M2) was from Sigma-Aldrich. For the normalization of protein loading, blots were reprobed with
-vimentin (BioGenex) or GFP (CLONTECH Laboratories, Inc., see Fig. 3 B). For coimmunoprecipitations (see Fig. 5, AC)
, SaOs2 and U2OS cells were transfected with 2.4 µg of the indicated plasmids in single transfections, or 0.6 µg p53 plasmid plus 1.8 µg
Np73
in cotransfections. 24 h later, 600 µg lysates were subjected to immunoprecipitation with 1 µg of the indicated antibodies and analyzed by Western blot as previously described (19).
For the immunoprecipitation of
Np73 from tumors and normal tissues (see Fig. 2
D), frozen tissue was mechanically pulverized under liquid N2, resuspended in 1.5 ml TENN buffer (50 mM Tris, 5 mM EDTA, 150 mM NaCl, 0.5% NP-40, pH 8.0) containing a protease inhibitor cocktail (Roche), and homogenized using an electric homogenizer followed by sonication for 2 min. The lysates were centrifuged twice at 14,000 rpm for 15 min. 2 mg total protein in 500 µl TENN was precleared four times using 70 µl each time of a 1:1 mixture of protein A and G slurry (GIBCO BRL). The last supernatant was incubated with 1 µg ER15 antibody for 30 min at 4°C, followed by the addition of 40 µl slurry of Prot G beads. The mixture was then rotated overnight at 4°C. For controls, lysates were immunoprecipitated with monoclonal GC15 specific for p73ß (Oncogene Research Products) or Flag antibody (M2). Pelleted beads were washed four times in RIPA buffer (50 mM Tris, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, 1% NaDeoxycholate, pH 7.4), boiled in sample buffer for 3 min, and loaded onto an SDS-PAGE gel. Membranes were immunoblotted with polyclonal anti-
Np73 (1:20) and bands were verified by reblotting with ER15 (1:200). For coimmunoprecipitation of a
Np73p53 complex from tissues (see Fig. 5 D), 2 mg total protein in 500 µl TENN was precleared as described above and incubated with a 1:1 mixture (40 µl slurry) of agarose beads covalently coupled to the monoclonal p53 antibodies 1801 or DO-1 (Santa Cruz Biotechnology, Inc.). For controls, 40 µl Prot G agarose slurry was used. Membranes were immunoblotted with polyclonal anti-
Np73 and bands were verified by reblotting with ER15.




View larger version (112K):
[in this window]
[in a new window]
|
Figure 2. Np73 is frequently overexpressed in a variety of primary human cancers. (A) Tumor-specific up-regulation of Np73 (solid bars) transcripts in 35 tumor pairs, compared with their respective normal tissues of origin. In addition, Ex2Del p73 transcripts (gray bars) were measured in a subset of pairs. Ex2Del p73 is another previously described isoform of p73 that lacks most of the transactivation domain. In contrast to Np73, it is generated from the same promoter as TAp73 by splicing out exon 2. It is also a transdominant inhibitor of p53 (references 2224). Isoform-specific semiquantitative RT-PCR assay from total RNA extracted from human tissues (see Table I). Two tumor pairs (nos. 21 and 22) had readily detectable Np73 levels in tumor tissues but failed to give detectable Np73 levels in their corresponding normal tissues. Therefore, fold up-regulation could not be quantitated in those 2 cases reducing the total number plotted from 37 to 35 cases. Expression levels, standardized for their corresponding GAPDH values, were used to calculate fold induction as described in Materials and Methods. (B) Up-regulation of Np73 transcripts in a series of unmatched 52 human breast cancers compared with 8 unrelated normal breast tissues. Np73-specific semiquantitative RT-PCR assay from total RNA extracted from tissues. Expression levels were standardized using the corresponding GAPDH value of each sample. The relative expression of Np73 in breast cancers and normal breast tissues is shown. The average normal tissue expression (gray line) is indicated. The arrow marks an arbitrary cut-off, delineating tumors with fivefold or higher Np73 overexpression. 16 of 52 breast cancers (31%) overexpress Np73 levels that were between 6- and 44-fold higher than that of average normal breast tissue. (C) Characterization of the polyclonal anti- Np73. Anti- Np73 does not recognize TAp73 , TAp73ß, or p53. H1299 cells were transfected with empty vector or the indicated expression plasmids and lysates (50 µg protein for lanes 15 and 10 µg for lanes 69) were immunoblotted with either a cocktail of ER15, GC15, and DO-1 (lanes 69) or anti- Np73 (lanes 15). (D) Tumor-specific up-regulation of Np73 protein. Cases 9, 14, and 26 (top from left to right) and cases 10, 31, and 1 (bottom) from Table I are shown. Immunoprecipitations of equal amounts of total protein (2 mg each) from matched pairs of homogenized tumor/normal tissues with 1 µg anti-p73 antibody ER15 followed by immunoblotting with polyclonal anti- Np73. Hc, heavy chain. The last lane (top) is a positive control of H1299 lysate transfected with a Np73 expression vector.
| |
Apoptosis Assay.
Hela and SaOs2 cells were seeded into 8-well chamber slides and cotransfected with 300 ng of the indicated pcDNA3-based expression plasmids per well using Fugene (see Fig. 4
A). Control wells (vector alone) received 600 ng. After 16 or 24 h, cells were stained with Annexin V or Tdt-mediated dUTP-X nick-end labeling (TUNEL), respectively, according to the manufacturer's instructions (Roche). Expression was determined by immunofluorescence in duplicate wells. Transfection efficiency was reproducibly
30% of cells, similar among all constructs and evenly distributed throughout the wells. Annexin V or TUNEL positive cells (494 fields at 40x) and plasmid-expressing cells (15 random fields, >500 cells) were counted and the percentage of apoptosis in transfected cells was determined after correction for background with vector alone.





View larger version (179K):
[in this window]
[in a new window]
|
Figure 4. Np73 counteracts apoptosis and suppression of tumor cell growth induced by wild-type p53 and TAp73. (A) Annexin V analysis of apoptosis. HeLa cells were transfected with expression plasmids encoding wild-type p53 or TAp73ß with either empty vector or Np73 at a 1:1 molar ratio and analyzed after 16 h. As control, Np73 plus empty vector was used. For each construct, the number of expressing cells was determined by immunofluorescence and the apoptotic index of expressing cells is indicated. Results are the average ± SD of four independent experiments. Similar results were obtained with SaOs2 cells and with TUNEL analysis. (B) SaOs2 colony suppression induced by wild-type p53 and TAp73 is inhibited by Np73 . Number of colonies are shown in Table II. (C) p53 expression analysis of random SaOs2 clones derived from surviving colonies of a parallel experiment to the one shown in B. Immunoblots with anti-p53 antibody DO-1 using 30 µg total cell lysate per lane. Clones from cells originally transfected with expression plasmids for wild-type p53 alone (left) or wild-type p53 plus Np73 (right). Except for clone 6, all other wild-type p53-transfected clones have lost full-length p53 protein expression. Clones 1, 3, and 5 show no detectable p53 protein at all, whereas clones 2, 4, and 6 express truncated p53 polypeptides (left). In contrast, all six colonies derived from cotransfection with wild-type p53 and Np73 show detectable levels of full-length p53 protein with sequence-confirmed wild-type status of the DNA binding domain in three of three tested clones (right, five clones are shown). Immunoblot to show Np73 expression in SaOs2 clones 812 compared with a SaOs2 clone transfected with empty vector (bottom). (D) Np73 confers drug resistance to wild-type p53/TAp73 harboring tumor cells. RKO cells were transfected with empty vector (left), the irrelevant expression plasmid LcRel (center), or with Np73 expression plasmid (right). 5 h after transfection, cells were treated with 5 µM camptothecin overnight or left untreated (not depicted). After fixation with paraformaldehyde, each well underwent both TUNEL staining in green and immunofluorescence with Np73-specific polyclonal antibody (left and right) or Flag antibody (center) in red to assess apoptosis and expression. In contrast to vector-only or LcRel-transfected cells, Np73 -expressing cells (right white arrows) are virtually protected from camptothecin-induced apoptosis. The p73 antibody produces a slight background staining in empty vectortransfected RKO cells, which allows the counting of all cells in the well (left). The percentage of apoptosis of Np73 -expressing and control-transfected cells after 24 h of treatment with 5 µM camptothecin is shown.
| |
RKO cells were seeded into 8-well slides and transfected with either vector, the irrelevant control plasmid cRel, or with
Np73
using Lipofectamine Plus (GIBCO BRL; see Fig. 4 D). LcRel is a transcriptionally and apoptotically inactive Flag-tagged, truncated version of the transcription factor cRel, fused to a mitochondrial targeting sequence (19) and cloned into pcDNA3. 5 h after transfection, cells were either stressed with 5 µM camptothecin or left untreated overnight before fixation with paraformaldehyde. Wells were processed for TUNEL staining followed by immunofluorescence staining with polyclonal anti-
Np73 (1:20) and donkey antirabbit IgG (H+L)-rhodamine conjugate (Jackson ImmunoResearch Laboratories). Apoptosis was quantitated as the percentage of
Np73
-expressing cells and compared with vector-transfected cells.
Colony Suppression Assay.
SaOs2 cells in 60-mm plates were transfected by Fugene with 1.5 µg each of the indicated expression plasmids. Vector-only plates received 3 µg plasmid. 24 h later, cells were transferred to 100-mm dishes and placed under G418 selection (500 µg/ml) for 21 d, fixed, stained with crystal violet (20), and photographed. All foci were counted.
Mobility Shift Assays (EMSAs).
H1299 and U2OS cells were transfected with plasmids encoding wild-type p53,
Np73
, or a combination of the two. 24 h later, nuclear extracts were prepared by Dounce homogenization as previously described (21). As probes, we used double stranded oligonucleotides of the p53 consensus DNA binding sequences: 5'-GGGCATGTCCGGGCATGTCC-3' (called p53CON) or 5'-CCTGCCTGGACTTGCCTGGCCTGCCTGGACTTGCCTGG-3'. EMSA was performed with 1 ng 32 Plabeled probe and 10 µg nuclear extract in binding buffer (40 mM NaCl, 10 mM morpholino propane sulfonic acid, pH 7.0, 0.1% NP-40, 1 mM EDTA, 2.5% glycerol, 0.5 µg poly[dI-dC]) for 30 min at room temperature. Samples were loaded onto a native 6% polyacrylamide gel and electrophoresed at 4°C and 200 V for 4 h. Where indicated, 0.5 µg p53-specific monoclonal antibody PAb 421 was included to produce a supershift. Specific competition experiments included unlabeled p53CON in 50-fold molar excess of radiolabeled probe. Nonspecific competition consisted of 50-fold molar excess of the scrambled p53CON 5'-GGGAATTTCCGGGAATTTCC-3' or the mutant sequence CCTTAATGGACTTTAATGGCCTTAATGGACTTTAATGG (mutated nucleotides are underlined).
Antisense Suppression of
Np73.
Wild-type p53-harboring RKO cells were seeded into 8-well slides and transfected with 360 ng wild-type p53 expression plasmid with 200 nM of either
Np73 antisense oligonucleotide directed against exon 3' with extension into the adjacent 5' untranslated region (UTR) (antisense, 5'-A*C*C*G*ACGTACAGC*A*T*G*G-3'; stars indicate the phosphorothioate-modified bases), or
Np73 sense oligonucleotide (sense, 5'-C*C*A*T*GCTGTACGT*C*G*G*T-3'; both HPLC-purified, Operon Inc.) using Lipofectamine Plus or Oligofectamine (GIBCO BRL) according to the manufacturer's instructions. Vector alone was also used. 20 h after transfection, cells were subjected to immunoblotting or TUNEL staining. Apoptosis was quantitated using a Nikon E800 microscope equipped with a Bio-Rad confocal laser scanning system. For each sample, the total fluorescence of five random fields per duplicate well was acquired with a 20x lens using identical acquisition and photomultiplier settings. Data were processed to calculate the integral optical density using the Laser Pix software package (Bio-Rad Laboratories). In other experiments, RKO cells were transfected with 200 nM each of the antisense and sense oligonucleotides listed above. After 8 h, cells were DNA damaged by adding 1 µM camptothecin for an additional 16 h before TUNEL staining. Apoptosis was determined as described above.
 |
Results
|
|---|
The Human TP73 Gene Can Produce
Np73.
Mouse
Np73 differs from TAp73 by a novel exon 3', which replaces the first 3 exons and is spliced in frame to exon 4 of the TP73 gene (18). To clone the human homologue of mouse
Np73, we performed a GenBank search using mouse exon 3'. By sequence alignment of a human genomic P1 artificial chromosome clone containing TP73 (sequence data are available from GenBank/EMBL/DDBJ under accession no. AL 136528), we identified a region with 77% identity to the 5' UTR of mouse
Np73 mRNA (sequence data are available from GenBank/EMBL/DDBJ under accession no. Y 19235). This allowed us to predict the human exon 3' and design isoform-specific primers for human
Np73. Full-length
Np73
cDNA, spanning exons 3'14 including 103 bases of 3' UTR, was cloned by RT-PCR from total RNA of human placenta and MDA 231 breast cancer cells, and sequence was confirmed (Fig. 1
A). To confirm that
Np73 derives from a separate promoter upstream of exon 3', we performed 5' rapid amplification of cDNA ends and sequenced the 5' UTR upstream of exon 3' (Fig. 1 C). Human exon 3' encodes 13 unique amino acids with almost complete identity to mouse exon 3' (12 out of 13 residues are identical; Fig. 1 A). The human
N promoter contains the predicted TATA box 25 nucleotides upstream of the transcriptional start site, which is located 7.6 kb downstream of exon 3.



View larger version (100K):
[in this window]
[in a new window]
|
Figure 1. Gene architecture of human TP73. (A) In contrast to TP53, which harbors a single promoter generating a single protein composed of the transactivation domain (TAD), DNA-binding domain (DBD), and tetramerization domain (TD), the TP73 gene is complex and contains two promoters and an additional sterile motif domain (SAM). The P1 promoter in the 5' UTR region produces transactivation-competent full-length proteins containing the TA domain (TAp73). The P2 promoter in intron 3 produces TA-deficient protein(s) ( Np73) with dominant-negative function toward TAp73 and wild-type p53. Np73 starts with exon 3', which encodes 13 unique amino acids that are highly conserved between human and mouse. Another NH2 terminally truncated p73, Ex2Del, also lacks the TA domain but is created by splicing out exon 2 from the P1 transcript (reference 1). The COOH-terminal of TAp73 undergoes additional exon splicing, which generates ß- isoforms. (B) Positions of the P1 and P2 promoters. Positions of the RT-PCR primers are indicated: TAp73 (bottom), Np73 (center), and Ex2Delp73 (top). (C) Sequence of the 5' UTR region of Np73. The putative TATA box is indicated.
| |
Expression of
Np73 and Ex2Del p73 in Human Tumors.
Unique cDNA primers were designed for amplification of
Np73 from tissues by semiquantitative RT-PCR (Fig. 1 B). Then, we determined if expression levels of
Np73 were tumor specifically up-regulated using a spectrum of human tumor pairs that were matched with the patients' normal tissues of origin (Table I
and Fig. 2 A). They included 35 cancers (cancers of the ovary, endometrium, cervix, vulva, vagina, breast, kidney, and colon) and 2 large benign ovarian tumors (serous cystadenoma and serous cystadenofibroma). Indeed, in 27 of the 37 pairs (73%),
Np73 was specifically up-regulated between 2- and 150-fold in the patients' tumors compared with their matched normal tissues (Table I, second column). In a subset of our matched pairs, we also determined the expression of the previously described Ex2Del p73 (23). Ex2Del p73 is another isoform of p73 that lacks most of the transactivation domain, but in contrast to
Np73 it is generated from the same promoter as TAp73 by splicing out exon 2. Ex2Del p73 was shown to be up-regulated in some ovarian and vulval cancers and breast cancer cell lines and is a transdominant inhibitor of p53 (2224). As already seen with
Np73, Ex2Del p73 was also specifically up-regulated 2.220-fold in 11 of 22 analyzed tumors (50%) compared with their matched normal tissues either alone or concomitant with
Np73 (Table I, third column, and Fig. 2 A). Taken together, 30 of 37 tumor pairs (81%) exhibited tumor-specific up-regulation of
Np73 and/or Ex2Del p73. On the other hand, because we previously showed that breast cancers can overexpress TAp73 (17), we next used isoform-specific RT-PCR to simultaneously measure
Np73 and TAp73. TAp73 was up-regulated in 18 of 37 tumors (49%; Table I, fourth column) compared with its respective normal tissues of origin. However, although tumors with deregulated
Np73 and/or Ex2Del p73 also tended to show up-regulation of TAp73, the magnitude of the
Np73 and/or Ex2Del p73 up-regulation was much higher than that of TAp73 in the majority of cases. Among the 31 tumor pairs with up-regulation of any one or all of these three p73 transcripts, 22 tumors (71%) exhibited preferential up-regulation of
Np73 (19 tumors; Table I, left side of fifth column) or Ex2Del p73 (3 tumors; Table I, right side of fifth column). These included 13 ovarian cancers and 2 large benign ovarian tumors, 5 endometrial cancers, 2 breast cancers, 2 cervical cancers, and 2 vulvar cancers. Moreover, 14 of these 22 tumors (67%) exhibited exclusive up-regulation of
Np73 and/or Ex2Del p73. ("preferential" up-regulation means that the up-regulation of
Np73 and/or Ex2Del p73 was more marked than the up-regulation of TAp73). In one case, the tumor showed preferential
Np73 up-regulation of >2,700-fold compared with TAp73 expression (tumor no. 4). Only nine tumors (29%) exhibited an inverse ratio with a disproportional rise of TAp73 compared with their rise in
Np73. Thus, taken together, in our series of 31 matched tumors with some form of tumor-specific deregulation of the TP73 gene, 22 tumors (71%) exhibit either exclusive or preferential up-regulation of dominant-negative p73 isoforms.
In our paired tumor series, we had an overall p53 mutational rate of 38%, as determined either by direct sequencing of the PCR-amplified DNA binding domain or by immunocytochemically shown nuclear overexpression (Table I). This prevalence is in agreement with the reported rates of p53 mutations in these tumor types (
40%; reference 25). We reasoned that if
Np73 and Ex2Del p73 were indeed p53- and TAp73-directed inhibitors and would act as oncogenes, one would expect to see their expression preferentially in wild-type p53 tumors. Of the 22 tumors with preferential up-regulation of
Np73 and/or Ex2Del p73, 21 tumors were available for p53 mutational analysis. Of these 21 tumors, 15 tumors harbored wild-type p53 (71%). In contrast, among the nine cases with preferential up-regulation of TAp73, six tumors harbored mutant p53 (66%). We then analyzed this set of 30 tumors for a correlation between overexpression of dominant-negative forms of p73 and concomitant wild-type p53 status. When all tumors were included, a statistical trend but no significance was found by Student's t test. When the unusual tumor number 4 is excluded, which is characterized by a singularly high level of
Np73 up-regulation of almost 3,000-fold compared with TAp73 up-regulation plus a mutant p53 status, statistical significance was found (P = 0.014). Taken together, a correlation between tumor-specific up-regulation of
Np73 or Ex2Del p73 and wild-type p53 status of the tumor cannot be made with this limited set of tumors, although a trend is present. More tumor samples will need to be analyzed in the future to support the hypothesis that the expression of dominant-negative p73 isoforms alleviates the selection pressure for p53 mutations in tumors.
To further investigate whether tumors up-regulate
Np73, we determined
Np73 transcript levels in a series of 52 unmatched breast cancers and compared them to 8 available normal breast tissues from unrelated individuals (Fig. 2 B). 16 of 52 breast cancers (31%) overexpressed
Np73 levels that were between 6- and 44-fold higher than the average of the 8 normal breast tissues (Fig. 2 B, gray line). An additional 10 tumors showed
Np73 up-regulation between two- and sixfold above the normal average. In contrast, four normal breast tissues showed nondetectable levels of
Np73, two cases expressed at average level, and only two tissues were elevated two- to fourfold. Next, we used isoform-specific semiquantitative RT-PCR to simultaneously measure
Np73 and TAp73 because we previously showed that breast cancers can also overexpress TAp73 (17). Among the 16 cancers with a 644-fold increase of
Np73, 12 cancers again showed preferential up-regulation of
Np73 over TAp73 (unpublished data). Although the data is not complete enough to make strong conclusions, as we had already seen in the gynecological cancers on Table I, our results on breast cancer again suggests that
Np73 might selectively be up-regulated during tumorigenesis.
To confirm that tumor-specific up-regulation of
Np73 transcripts translate to the up-regulation of proteins, we generated a
Np73-specific polyclonal antibody raised against the unique exon 3'. This antibody recognizes
Np73 but does not cross react with TAp73
, TAp73ß, or p53 (Fig. 2 C). Using this reagent, we determined
Np73 protein expression on 10 matched pairs of homogenized tumor/normal tissues from Table I. Tissues were subjected to immunoprecipitations of equal amounts of total protein (2 mg each) with the anti-p73 specific antibody ER15 followed by immunoblotting with polyclonal anti-
Np73. Some examples are shown in Fig. 2 D, which represent cases 1, 9, 10, 14, 26, and 31. Tumor-specific up-regulation of
Np73 protein was found in all 10 cases as demonstrated by tumors yielding detectable
Np73
protein, whereas their respective matched normal tissue showed a complete absence of
Np73
protein in nine cases and only a minute amount in case number 10. Moreover, when tumor lysates in these cases (2 mg each) were immunoprecipitated with nonspecific Flag antibody,
Np73 protein could not be detected (unpublished data). Also, the immunoprecipitation of cases 9, 14, and 26 with ß-specific anti-p73 antibody GC15 did not yield
Np73 protein, indicating that in contrast to
Np73
,
Np73ß is not up-regulated to detectable levels in these cases. As expected, no strict correlation between the levels of tumor-associated protein and the ranking in Table I is present because the RT-PCR measurements indicate the relative fold increase of mRNA levels of tumor versus normal rather than absolute values. Interestingly, cases 26 and 31 did not exhibit increased
Np73 expression of their tumors at the transcript level, yet clearly do so on the protein level. This notion warrants additional investigation because it might suggest that the prevalence of tumor-associated
Np73 up-regulation is somewhat higher than transcript measurements would predict.
Np73 Is an Efficient Dominant-Negative Inhibitor of the Transcription Function of Wild-type p53 and TAp73.
To test the hypothesis that human
Np73 is a dominant-negative inhibitor of human wild-type p53 and TAp73, we first performed reporter assays with expression plasmids for wild-type p53, TAp73
, TAp73ß, and a p53/TAp73-responsive luciferase reporter in the presence or absence of
Np73
using p53 null H1299 and SaOs2 cells (Fig. 3, AC, and unpublished data). Increasing ratios of
Np73
expression plasmid were added to a constant amount of p53 or TAp73
and TAp73ß plasmids. Fig. 3 B shows that the p53 expression levels in this assay were independent of the amount of
Np73
added, and that p53 and TAp73 expression levels were not interfering with the amount of
Np73
expressed. Surprisingly, the steady state levels of TAp73ß actually increased in proportion to the amount of
Np73
added, despite the fact that the same amount of TAp73ß plasmid was used in all reactions. Of note, the addition of
Np73
exhibited complete suppression of the transcriptional activity of wild-type p53, TAp73
, and TAp73ß in a dose-dependent manner (Fig. 3 A and unpublished data). Furthermore,
Np73
also efficiently suppresses endogenous target gene products of wild-type p53 and TAp73 (Fig. 3 C and unpublished data). In HeLa and H1299 cells, the transfection of wild-type p53 or TAp73ß induces endogenous HDM2, 14-3-3
, and p21Waf1 compared with basal levels seen with empty vector. However, the concomitant expression of
Np73
strongly suppresses each of these response gene products (compare lanes 2 and 3 and lanes 4 and 5). Expression of
Np73
alone did not suppress these target genes (compare lanes 6 and 7).
Np73 Is an Efficient Dominant-Negative Inhibitor of the Apoptosis and Suppressor Function of Wild-type p53 and TAp73.
Moreover,
Np73
is a strong inhibitor of apoptosis induced by wild-type p53 and TAp73 (Fig. 4 A). HeLa and SaOs2 cells undergo wild-type p53- and TAp73-dependent cell death as assessed by Annexin V staining and TUNEL assay. This apoptotic activity is completely abolished by the coexpression of
Np73
(Fig. 4 A and unpublished data). The inhibitory action of
Np73
is dependent on the presence of transcription-competent wild-type p53 and TAp73 because
Np73
alone cannot affect apoptosis (Fig. 4 A, left column). Furthermore, in agreement with the antiapoptotic effect,
Np73
is an inhibitor of colony suppression mediated by wild-type p53 and TAp73 (Fig. 4 B and Table II). The reintroduction of wild-type p53 and TAp73 suppresses the growth of SaOs2 cells (2, 26) and this suppression is thought to be largely due to apoptosis (27). In keeping with these results, the transfection of wild-type p53 strongly suppresses macroscopic colony formation of SaOs2 cells compared with many visible colonies with vector backbone alone (4 foci for wild-type p53 vs. 1,778 for vector control; Fig. 4 B and Table II). As expected, the expression of
Np73
alone has no growth-promoting effect compared with vector controls (1,383 vs. 1,778 foci), but was actually slightly growth suppressive in these p53 null cells for reasons that are unclear. In contrast, the coexpression of
Np73
with wild-type p53 at a 1:1 molar ratio counteracts this effect, leading to a 12.5-fold increase in the number of colonies from 4 to 51 foci. Likewise, TAp73
, although not quite as potent as wild-type p53, suppresses colony formation (82 foci), but the coexpression of
Np73
with TAp73
again antagonizes this effect and increases the number of macroscopic colonies by 8.1-fold to 669 foci. Taken together,
Np73 is an efficient dominant-negative inhibitor of wild-type p53 and TAp73, although the strong repressive effect of
Np73
on p53 and TAp73 seen in transient assays (Fig. 4 A) is more modest in long-term assays (Fig. 4 B). Entirely consistent with this finding were data from a subsequent p53 expression analysis of SaOs2 cell clones that were established from surviving colonies of a duplicate experiment. A complete loss of full-length p53 protein expression was found in five out of six such randomly picked clones that were derived from plates transfected with wild-type p53 alone (Fig. 4 C, left). Although clones 1, 3, and 5 showed no detectable p53 protein at all, clones 2, 4, and 6 expressed only truncated and presumably nonfunctional p53 polypeptides, likely due to chromosomal rearrangement. The functional significance of the very small amounts of full-length p53 protein detectable in clone 6 is unclear, in light of the presence of coexpressed truncated p53. On the whole, this data is in agreement with the fact that wild-type p53 expression is incompatible with the outgrowth of clones in this assay, and rare colonies escape because they have lost wild-type p53 expression (28). In contrast, all six randomly picked colonies derived from plates cotransfected with wild-type p53 and
Np73
exhibited only full-length p53 protein (Fig. 4 C, five clones are shown). Upon sequencing the DNA binding domain of three of these clones, all three revealed wild-type p53 genotypes. All clones expressed elevated levels of
Np73
protein compared with endogenous levels (Fig. 4 C). Taken together, this data indicates that the coexpression of
Np73
neutralizes the growth-suppressive effect of wild-type p53, thereby removing the selection pressure for the deletion or rearrangement of wild-type p53.
Np73
is able to effectively counteract p53- and TAp73-induced colony suppression in transformed human cells.
Np73
Confers Drug Resistance to Wild-type p53-harboring Tumor Cells.
Because we have shown that
Np73 is an efficient inhibitor of exogenous wild-type p53-mediated apoptosis and growth suppression, we next tested whether
Np73
also inhibits endogenous wild-type p53-mediated apoptosis after DNA damage. RKO cells, a human colon cancer line harboring wild-type p53 and TAp73, were transfected with empty vector, an irrelevant control plasmid (LcRel), or with
Np73
expression plasmid and treated with either 5 µM camptothecin or left untreated (Fig. 4 D). Camptothecin is a topoisomerase inhibitor generating single and double strand DNA breaks, which induce an increase of p53 and TAp73 protein levels (29). As expected, control cells treated with camptothecin and transfected with either empty vector or LcRel underwent marked apoptosis with 44 and 39% of cells dying after 24 h. In contrast,
Np73
-expressing camptothecin-treated cells were strongly protected from drug-induced apoptosis, causing only 6% of cells to die. Thus,
Np73
protects human cancer cells from p53- and TAp73-induced cell death mediated by a chemotherapeutic agent.
Np73 Inhibits Wild-type p53 and TAp73 Function by Heterocomplex Formation.
One explanation for the observed dominant-negative effect is a direct physical interaction between
Np73 and either wild-type p53 or TAp73 proteins, analogous to the dominant-negative mode of action of mutant p53 proteins toward wild-type p53. To test this hypothesis directly, lysates prepared from p53 null SaOs2 cells cotransfected with wild-type p53 and
Np73
were immunoprecipitated with monoclonal antibody ER15, which recognizes
Np73
. Immunoblot analysis with an antibody specific for p53 (CM1) revealed a complex of the two proteins (Fig. 5 A, lane 3). Of note, TAp73 isoforms are unable to form a protein complex with wild-type p53 (Fig. 5 A, lane 7, B, lane 3, and C, lane 1; references 18 and 3032), excluding the possibility that the observed p53 band was coimmunoprecipitated via the endogenous TAp73 protein of SaOs2 cells. As control, no such complex was seen in SaOs2 cells transfected with either empty vector, TAp73
, or
Np73
alone (Fig. 5 A, lanes 1, 2, and 4), nor was a complex seen in SaOs2 cells transfected with p53 alone or with p53 plus TAp73
(Fig. 5 A, lanes 6 and 7), indicating the specificity of the p53
Np73
complex. Moreover, a similar complex was seen in wild-type p53-expressing human U2OS cells after transfection with
Np73
alone. Fig. 5 B shows a specific complex between endogenous wild-type p53 and ectopic
Np73
that was immunoprecipitated by ER15 from U2OS cells (lane 1). No such complex was seen when an irrelevant monoclonal antibody against GFP was used (lane 2), or when TAp73
or empty vector were expressed (lanes 3 and 4). The same specific complex can again be immunoprecipitated from U2OS cells using a monoclonal antibody specific for p53 (421) and immunoblotted with the polyclonal antibody specific for
Np73 that does not cross react with any TAp73 proteins (Fig. 5 C, lane 2). Again, no such complex is found with preimmune mouse IgG (Fig. 5 C, lane 3) or when U2Os cells were transfected with TAp73
(lane 1) or vector (unpublished data). The lysate lane in Fig. 5 A represents 5% of the immunoprecipitation input and the lysate lane in Fig. 5 C represents 210% of the immunoprecipitation input, depending on the experiment. Together, this data indicates that a small but highly reproducible portion of
Np73 forms a stable, specific complex with wild-type p53 in cells. To confirm the existence of this complex in vivo in tumor tissues, we coimmunoprecipitated the
Np73p53 complex from an ovarian carcinoma and an endometrial carcinoma with wild-type p53 status (see example in Fig. 5 D, lane 1). Of note, this mixed complex was only seen in the patients' tumors but not in the corresponding normal ovarian tissues (Fig. 5 D, lane 2). Moreover, no specific complex was seen when the immunoprecipitating anti-p53 antibody beads were substituted by protein G beads (lanes 3 and 4).
We also examined the second possibility, namely direct competition for specific DNA binding between
Np73
and wild-type p53 at the promoter level. Gel shift assays were performed with two different p53-specific DNA binding sequences as probes, using nuclear extracts of H1299 or U2OS cells transfected with expression plasmids for p53 alone or in combination with
Np73
. Although nuclear extract transfected with empty vector showed no specific DNA complex (Fig. 6
A, lane 1), p53 formed a specific complex (lane 2) that could be supershifted with the p53-specific antibody PAb 421 (lane 3) and competed off with 50-fold excess of unlabeled specific probe (lane 4). Likewise, p53 only binds to the specific probe (Fig. 6 A, lane 9), but not to a scrambled version of the specific probe (lane 11). The specific p53/DNA band (Fig. 6 A, lane 9) is supershifted by antibody 421 (lane 10), but 421 cannot produce a "false" supershifted band when p53 fails to bind to the scrambled probe (lane 12). Extracts from cells transfected with
Np73
alone failed to bind to both probes despite high levels of
Np73
expression on immunoblots (Fig. 6 A, lane 8, and unpublished data). However, nuclear extracts from cells cotransfected with p53 and
Np73
at a 1:4 ratio showed a slight decrease in p53DNA complex formation (Fig. 6 A, compare lanes 2 and 5), which became more pronounced at a 1:20 ratio of p53 to
Np73
(compare lanes 6 and 7). Moreover, in a p53 reporter assay using PG13, a tetramerization-incompetent but DNA bindingcompetent mutant of
Np73
, called
Np73 L322P (corresponding to L371P in TAp73
; reference 4), showed a significant but incomplete reversal of the dominant-negative inhibition of p53 transactivation by
Np73
(Fig. 6 B). These results support the notion that competition at the promoter site is another mode of inhibition. Taken together, the formation of inactive heterooligomers between p53 and
Np73 appear to play a role in the dominant-negative inhibition of p53 by
Np73. Such complexes occur naturally in primary tumors and in cultured cells. On the other hand, competition between
Np73 and p53 at the level of the promoter, where the presence of
Np73 interferes with the ability of p53 to bind effectively to its cognate binding site, might be a second mechanism that is physiologically relevant. Using nuclear extracts of
Np73-transfected cells, however, we failed to obtain clear evidence that
Np73
alone can directly bind to p53 cognate sites. This issue justifies additional studies.
Suppression of
Np73 Enhances Apoptosis Mediated by p53 and TAp73.
Our studies demonstrate a dominant-negative action of
Np73 toward the apoptosis, focus suppression, and transactivation functions of p53 and TAp73 within the context of forced
Np73 expression. To test whether
Np73 would have the same inhibitory effect in cells when present at endogenous levels, we used antisense oligonucleotides to suppress endogenous
Np73 expression in wild-type p53-harboring RKO cells that undergo apoptosis after DNA damage. RKO cells treated with camptothecin alone underwent a certain level of apoptosis (Fig. 7
A, left bar). In contrast, the preincubation of RKO cells with antisense oligonucleotides directed against the unique exon 3' of
Np73 showed a significant enhancement of p53-mediated apoptosis after camptothecin stress (Fig. 7 A, center bar), whereas camptothecin-stressed RKO cells pretreated with the sense version of the same oligonucleotide did not (Fig. 7 A, right bar). To further confirm that the gain in apoptotic ability seen after down-regulation of endogenous
Np73 was in fact due to specific derepression of p53-mediated apoptosis, we modified the above experiment by directly transfecting p53. RKO cells were transfected with wild-type p53 expression plasmid before incubation with antisense or sense oligonucleotides. As already seen in Fig. 7 A, p53-expressing cells treated with antisense oligonucleotides showed significantly enhanced apoptosis compared with the same cells treated with sense oligonucleotides (Fig. 7 B). To confirm that our antisense strategy works, we determined
Np73 protein levels. As shown in Fig. 7 C, transfection of the antisense oligonucleotide clearly down-regulated endogenous
Np73 protein levels compared with the sense control oligonucleotide. Taken together, these studies clearly indicate that endogenous
Np73 exerts a significant transdominant inhibition of p53 function. Down-regulation of endogenous
Np73 levels alleviates its suppressive action on p53-mediated apoptosis after DNA damage.
 |
Discussion
|
|---|
p53 controls a powerful stress response by integrating signals from many types of DNA damage or inappropriate oncogenic stimulation. Activation of p53 elicits a cellular response of apoptosis, cell cycle arrest, or senescence, thereby preventing tumor formation. Therefore, direct or indirect loss of p53 function is a preeminent defect in most human cancers whether via intragenic mutation of p53 itself (33), lack of p53 nuclear retention (34), loss of its upstream activator p14ARF (35), or inhibition by its antagonist HDM2 (36, 37). Here we show that the human TP73 gene, a homologue of p53, produces an NH2 terminally truncated isoform driven by an alternative internal promoter in intron 3. Human
Np73 starts with a unique exon 3' that is highly conserved from mouse exon 3' and is in frame with exon 4.
Np73 lacks the transactivation domain and is therefore predicted to function as a transdominant inhibitor of p53. In physical and functional assays, we demonstrate dominant-negative interactions between human
Np73 and wild-type p53 or transcription-competent TAp73.
Np73 is a potent inhibitor of wild-type p53 and TAp73 with respect to their transcriptional activation, apoptotic ability, and growth suppressor function. Of note,
Np73-mediated interference with the biological p53 response occurs at endogenous
Np73 levels, because antisense-directed down-regulation of endogenous
Np73 expression leads to a derepression of the p53 response.
Importantly, in this study we provide the first clinical evidence that
Np73 is frequently up-regulated in a variety of primary cancers including cancers of the breast and the female genital tract. We show that tumor-specific up-regulation of
Np73 occurs at the mRNA and protein level in primary tumors. In a rigorous comparison of tumor/normal tissue pairs from 37 patients, 73% show
Np73 up-regulation specifically in their tumor tissues but not in their respective normal tissues of origin. In addition, a subset of those tumors also up-regulate the previously described Ex2Del p73, another transdominant inhibitor of p53, but one that is generated from the P1 promoter of TP73 via alternative splicing. Taken together, 81% of tumor pairs exhibited tumor-specific up-regulation of
Np73 and/or Ex2Del p73. Of note, among the tumors with up-regulation of any one or all three TP73 transcripts (
Np73, Ex2Del p73, and TAp73), 71% exhibited preferential up-regulation of
Np73 or Ex2Del p73. Moreover, two thirds of the latter group of tumors showed exclusive up-regulation of
Np73 and/or Ex2Del p73 without any concomitant rise in TAp73. Furthermore, among tumors with preferential up-regulation of
Np73 and Ex2Del p73, 71% harbored wild-type p53. In contrast, among the (small) group of tumors with preferential TAp73 up-regulation, 66% harbored mutant p53. In summary, given the trend between tumor-specific up-regulation of
Np73 and/or Ex2Del p73 on the one hand and wild-type p53 status on the other, it is tempting to speculate that the expression of dominant-negative p73 isoforms alleviates the selection pressure for p53 mutations in tumors by functionally inactivating the suppressor action of p53. More tumor samples need to be analyzed to clarify this question. If confirmed, however, this mode of p53 inactivation would be functionally equivalent to the amplification of the HDM2 gene in some human sarcomas and leukemias (36, 37). While this work was in progress, Grob et al. (38) reported that p53 and TAp73 can directly induce
Np73 via a p53-responsive element in the
Np73 promoter in cultured cells. Moreover, Nakagawa et al. (39) confirmed that TAp73 directly transactivates
Np73, but such an activity for p53 could not be found by this group. Nevertheless, these results further fortify the analogy to the p53-HDM2 autoregulatory feedback loop. It will be interesting to determine whether p53 and/or TAp73 itself drive the overexpression of
Np73 in primary tumors as well.
We provide evidence that physical interaction between
Np73
and wild-type p53 is one of the possible functional mechanisms of this inhibition. We showed that this mixed complex occurs naturally in cultured human tumor cells and tumor tissues. While this work was under review, Nakagawara et al. (39) also reported that
Np73
and
Np73ß form stable mixed complexes with endogenous and ectopic wild-type p53, as well as with TAp73
. Similarly, Pozniak et al. (18) reported a direct physical interaction of mouse
Np73
and
Np73ß proteins with mouse wild-type p53, both of which inhibited the apoptosis-promoting activity of p53. Thus, heterocomplexes appear to interfere with the specific DNA binding activity of wild-type p53. In contrast to
Np73, TAp73 isoforms are unable to form a protein complex with wild-type p53 (Fig. 5, B and C; references 18 and 3032). Therefore, the existence of mixed complexes suggests that the unique exon 3' at the NH2 terminus of
Np73, in conjunction with the missing transactivation domain, induces a conformational change in
Np73 that allows the complex to form. In contrast, another recently described isoform named
TA-p73
, which is encoded by p73 (exons 414) but missing the unique exon 3', does not appear to form a complex with wild-type p53 (40). Heterooligomeric complexes mirror the ability of many missense p53 mutants in heterozygous tumors to abrogate the function of the remaining wild-type p53 allele (41, 42). Of note, a stoichiometry as low as 1:3 of mutant to wild-type p53 molecules already abrogates wild-type p53 function, suggesting that a similar stoichiometry might be effective for
Np73 as well. An additional mechanism of p53 inhibition might be direct promoter competition, with
Np73 displacing p53 from the DNA binding site (43). Such a phenomena has been seen in gel shift assays with high concentrations of in vitro translated p73 (exons 414) protein (
TA-p73
; reference 40). In nuclear extracts of H1299 and U2OS cells cotransfected with p53 plus
Np73, which more closely mimics the physiological situation than in vitro translated proteins, we also observed a decrease in p53DNA complex formation in the presence of
Np73
, supporting the notion of promoter competition. Under these experimental conditions, however, we failed to obtain clear evidence that
Np73
alone can directly bind to p53 cognate sites. Although both inhibitory mechanisms are likely, this point needs additional study.
Responsiveness to oncogenes and selected forms of DNA damage might suggest a putative tumor suppressor role of the TP73 gene analogous to TP53. However, tumor-associated overexpression of (total) p73 and in some cases TAp73 rather than loss of expression, is the most commonly observed tumor-specific abnormality of the TP73 gene. This fact, in conjunction with a conspicuous lack of p73 mutation in human tumors and a lack of a cancer phenotype in p73-deficient mice, provides clear evidence that the TP73 gene is not a classic Knudson-type tumor suppressor in vivo. Instead, our finding that a significant percentage of human tumors specifically select for dominant-negative p73 isoforms strongly argues for their oncogenic role during tumorigenesis in vivo. Preferential up-regulation of
Np73 and Ex2Del p73 in tumors might bestow oncogenic activity upon the TP73 gene that specifically interferes with the tumor suppressor functions of wild-type p53 and TAp73. In fact, this scenario suggests that the TP73 gene embodies the "two genes in one" idea with products that play opposing roles within the family circuitry. Their impact on tumor formation in vivo might therefore depend on the balance between tumor-promoting and -suppressing family members. The existence of this inhibitory family network might explain the paucity of p73 mutations in human tumors. In the developing mouse brain,
Np73 is the predominant form of TP73 and a powerful inhibitor of p53 (18). In vivo and in vitro studies showed that
Np73 plays an essential antiapoptotic role required to counteract p53-mediated neuronal death during the "sculpting" of the developing brain. This explains why p73-/- mice, missing all forms of p73 including protective
Np73, underwent accelerated neuronal death in sympathetic ganglia (18). Thus, in keeping with a common theme in cancer, a developmental inhibitory network that is essential for normal physiology resurfaces in cancer, but in a corrupted and derailed fashion. In support of the idea that
Np73 can act as an oncogene in vivo, overexpression of
N isoforms of p63, a p73 homologue, is found in human cancers including lung cancer, squamous cell carcinoma of the head and neck (44), bladder cancer (45), and nasopharyngeal carcinoma (46). Importantly, a specific
Np63 isoform is oncogenic in nude mice and in the Rat 1a focus formation assay (44).
Evidence from some human cancers and mouse models indicates that the mutational status of p53 is an important clinical variable for prognosis as well as for guiding the aggressiveness of anticancer therapy. However, currently, p53 mutational status is not widely accepted as a clinical indicator because many studies show that its prognostic power for survival and its predictive value for therapeutic response is poor (for review see reference 47). From a practical standpoint, the discovery of a
Np73-based p53p73 interference network suggests that the p53 status of a tumor should no longer be considered in isolation. The existence of this inhibitory network might account for the inconsistencies of clinical studies that sought to use p53 status as a predictor of outcome. It mandates that we do a careful analysis of the functional consequences of this network in vivo. The establishment and clarification of an inhibitory p53p73 network would have a major clinical impact ranging from fine tuning the prognostic power of p53 mutation status to rational p53p73-targeted drug design.
In conclusion, we report here the cloning of human
Np73 and show that
Np73 mediates a novel inactivation mechanism of wild-type p53 and TAp73 via dominant-negative interference. Deregulated expression of
Np73 can bestow oncogenic activity upon the TP73 gene by functionally inactivating the suppressor action of p53 and TAp73. This trait might be frequently selected for in a variety of human cancers.
 |
Acknowledgments
|
|---|
We thank T. Shirangi for technical assistance.
This study is supported by grants from the National Cancer Institute and the United States Army Medical Research Command.
Submitted: February 1, 2002
Revised: June 24, 2002
Accepted: July 18, 2002
 |
Footnotes
|
|---|
* Abbreviations used in this paper: EMSA, mobility shift assay; GAPDH, glyceraldehyde3-phosphate dehydrogenase; GFP, green fluorescent protein; MEF, mouse embryo fibroblast; TUNEL, Tdt-mediated dUTP-X nick-end labeling; UTR, untranslated region.
 |
References
|
|---|
1 Kaghad, M., H. Bonnet, A. Yang, L. Creancier, J.C. Biscan, A. Valent, A. Minty, P. Chalon, J.M. Lelias, X. Dumont, et al. 1997. Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell. 90:809819.[CrossRef][Medline]
2 Jost, C.A., M.C. Marin, and W.G. Kaelin, Jr. 1997. p73 is a simian p53-related protein that can induce apoptosis. Nature. 389:191194.[CrossRef][Medline]
3 Zhu, J., J. Jiang, W. Zhou, and X. Chen. 1998. The potential tumor suppressor p73 differentially regulates cellular p53 target genes. Cancer Res. 58:50615065.[Abstract/Free Full Text]
4 Zaika, A., M. Irwin, C. Sansome, and U.M. Moll. 2001. Oncogenes induce and activate endogenous p73 protein. J. Biol. Chem. 276:1131011316.[Abstract/Free Full Text]
5 Irwin, M., M.C. Marin, A.C. Phillips, R.S. Seelan, D.I. Smith, W. Liu, E.R. Flores, K.Y. Tsai, T. Jacks, K.H. Vousden, et al. 2000. Role for the p53 homologue p73 in E2F-1-induced apoptosis. Nature. 407:645648.[CrossRef][Medline]
6 Lissy, N.A., P.K. Davis, M. Irwin, W.G. Kaelin, and S.F. Dowdy. 2000. A common E2F-1 and p73 pathway mediates cell death induced by TCR activation. Nature. 407:642645.[CrossRef][Medline]
7 Stiewe, T., and B.M. Putzer. 2000. Role of the p53-homologue p73 in E2F1-induced apoptosis. Nat. Genet. 26:464469.[CrossRef][Medline]
8 Gong, J.G., A. Costanzo, H.Q. Yang, G. Melino, W.G. Kaelin, Jr., M. Levrero, and J.Y. Wang. 1999. The tyrosine kinase c-Abl regulates p73 in apoptotic response to cisplatin-induced DNA damage. Nature. 399:806809.[CrossRef][Medline]
9 Yuan, Z.M., H. Shioya, T. Ishiko, X. Sun, J.Gu, Y.Y. Huang, H. Lu, S. Kharbanda, R. Weichselbaum, and D. Kufe. 1999. p73 is regulated by tyrosine kinase c-Abl in the apoptotic response to DNA damage. Nature. 399:814817.[CrossRef][Medline]
10 Agami, R., G. Blandino, M. Oren, and Y. Shaul. 1999. Interaction of c-Abl and p73alpha and their collaboration to induce apoptosis. Nature. 399:809813.[CrossRef][Medline]
11 Costanzo, A., P. Merlo, N. Pediconi, M. Fulco, V. Sartorelli, P.A. Cole, G. Fontemaggi, M. Fanciulli, L. Schiltz, G. Blandino, et al. 2002. DNA damage-dependent acetylation of p73 dictates the selective activation of apoptotic target genes. Mol. Cell. 9:175186.[CrossRef][Medline]
12 Yamasaki, L., T. Jacks, R. Bronson, E. Goillot, E. Harlow, and N.J. Dyson. 1996. Tumor induction and tissue atrophy in mice lacking E2F-1. Cell. 85:537548.[CrossRef][Medline]
13 Field, S.J., F.Y. Tsai, F. Kuo, A.M. Zubiaga, W.G. Kaelin, Jr., D.M. Livingston, S.H. Orkin, and M.E. Greenberg. 1996. E2F-1 functions in mice to promote apoptosis and suppress proliferation. Cell. 85:549561.[CrossRef][Medline]
14 Yang, A., N. Walker, R. Bronson, M. Kaghad, M. Oosterwegel, J. Bonnin, C. Vagner, H. Bonnet, P. Dikkes, A. Sharpe, et al. 2000. p73-deficient mice have neurological, pheromonal and inflammatory defects but lack spontaneous tumours. Nature. 404:99103.[CrossRef][Medline]
15 Moll, U.M., S. Erster, and A. Zaika. 2001. p53, p63 and p73 - solos, alliances and feuds among family members. Biochim. Biophys. Acta. 1552:4759.[Medline]
16 Kovalev, S., N.D. Marchenko, S. Swendeman, M. LaQuaglia, and U.M. Moll. 1998. Expression level, allelic origin, and mutation analysis of the p73 gene in neuroblastoma tumors and cell lines. Cell Growth Differ. 9:897903.[Abstract]
17 Zaika, A.I., S. Kovalev, N.D. Marchenko, and U.M. Moll. 1999. Overexpression of the wild type p73 gene in breast cancer tissues and cell lines. Cancer Res. 59:32573263.[Abstract/Free Full Text]
18 Pozniak, C.D., S. Radinovic, A. Yang, F. McKeon, D.R. Kaplan, and F.D. Miller. 2000. An anti-apoptotic role for the p53 family member, p73, during developmental neuron death. Science. 289:304306.[Abstract/Free Full Text]
19 Marchenko, N.D., A.I. Zaika, and U.M. Moll. 2000. Death signal induced localization of p53 protein to mitochondria: a potential role in apoptotic signaling. J. Biol. Chem. 275:1620216212.[Abstract/Free Full Text]
20 Baker, S.J., S. Markowitz, E.R. Fearon, J.K. Willson, and B. Vogelstein. 1990. Suppression of human colorectal carcinoma cell growth by wild type p53. Science. 249:912915.[Abstract/Free Full Text]
21 Ostermeyer, A.G., E. Runko, B. Winkfield, B. Ahn, and U.M. Moll. 1996. Cytoplasmically sequestered wild-type p53 protein in neuroblastoma is relocated to the nucleus by a C-terminal peptide. Proc. Natl. Acad. Sci. USA. 93:1519015194.[Abstract/Free Full Text]
22 Ng, S.W., G.K. Yiu, Y. Liu, L.W. Huang, M. Palnati, S.H. Jun, R.S. Berkowitz, and S.C. Mok. 2000. Analysis of p73 in human borderline and invasive ovarian tumor. Oncogene. 19:18851890.[CrossRef][Medline]
23 Fillippovich, I., N. Sorokina, M. Gatei, Y. Haupt, K. Hobson, E. Moallem, K. Spring, M. Mould, M.A. McGuckin, M.F. Lavin, et al. 2002. Transactivation-deficient p73alpha (p73Deltaexon2) inhibits apoptosis and competes with p53. Oncogene. 20:514522.
24 O'Nions, J., L.A. Brooks, A. Sullivan, A. Bell, B. Dunne, M. Rozycka, A. Reddy, J.A. Tidy, D. Evans, P.J. Farrell, et al. 2001. p73 is over-expressed in vulval cancer principally as the Delta2 isoform. Br. J. Cancer. 85:15511556.[CrossRef][Medline]
25 IARC p53 Database. http://www.iarc.fr/p53/Index.html.
26 Diller, L., J. Kassel, C.E. Nelson, M.A. Gryka, G. Litwak, M. Gebhardt, B. Bressac, M. Ozturk, S.J. Baker, B. Vogelstein, et al. 1990. p53 functions as a cell cycle control protein in osteosarcomas. Mol. Cell. Biol. 10:57725781.[Abstract/Free Full Text]
27 Pietenpol, J.A., T. Tokino, S. Thiagalingam, W.S. el-Deiry, K.W. Kinzler, and B. Vogelstein. 1994. Sequence-specific transcriptional activation is essential for growth suppression by p53. Proc. Natl. Acad. Sci. USA. 91:19982002.[Abstract/Free Full Text]
28 Finlay, C.A., P.W. Hinds, and A.J. Levine. 1989. The p53 proto-oncogene can act as a suppressor of transformation. Cell. 57:10831093.[CrossRef][Medline]
29 Zhu, J., S. Nozell, J. Wang, J. Jiang, W. Zhou, and X. Chen. 2001. p73 cooperates with DNA damage agents to induce apoptosis in MCF7 cells in a p53-dependent manner. Oncogene. 20:40504057.[CrossRef][Medline]
30 Marin, M.C., C.A. Jost, L.A. Brooks, M.S. Irwin, J. O'Nions, J.A Tidy, N. James, J.M. McGregor, C.A. Harwood, I.G. Yulug, et al. 2000. A common polymorphism acts as an intragenic modifier of mutant p53 behaviour. Nature Genet. 25:4754.[CrossRef][Medline]
31 Di Como, C.J., C. Gaiddon, and C. Prives. 1999. p73 function is inhibited by tumor-derived p53 mutants in mammalian cells. Mol. Cell. Biol. 19:14381449.[Abstract/Free Full Text]
32 Gu, J., D. Chen, J. Rosenblum, R.M. Rubin, and Z.M. Yuan. 2000. Identification of a sequence element from p53 that signals for Mdm2-targeted degradation. Mol. Cell. Biol. 20:12431253.[Abstract/Free Full Text]
33 Vogelstein, B., D. Lane, and A.J. Levine. 2000. Surfing the p53 network. Nature. 408:307310.[CrossRef][Medline]
34 Moll, U.M., M. LaQuaglia, J. Benard, and G. Riou. 1995. Wild-type p53 protein undergoes cytoplasmic sequestration in undifferentiated neuroblastomas but not in differentiated tumors. Proc. Natl. Acad. Sci. USA. 92:44074411.[Abstract/Free Full Text]
35 Sherr, C.J. 1998. Tumor surveillance via the ARF-p53 pathway. Genes Dev. 12:29842991.[Free Full Text]
36 Oliner, J.D., J.A. Pietenpol, S. Thiagalingam, J. Gyuris, K.W. Kinzler, and B. Vogelstein. 1993. Oncoprotein MDM2 conceals the activation domain of tumor suppressor p53. Nature. 362:857860.[CrossRef][Medline]
37 Watanabe, T., A. Ichikawa, H. Saito, and T. Hotta. 1996. Overexpression of the MDM2 oncogene in leukemia and lymphoma. Leuk. Lymphoma. 21:391397.[Medline]
38 Grob, T.J., U. Novak, C. Maisse, D. Barcaroli, A.U. Luthi, F. Pirnia, B. Hugli, H.U. Graber, V. De Laurenzi, M.F. Fey, et al. 2001. Human DeltaNp73 regulates a dominant negative feedback loop for TAp73 and p53. Cell Death Differ. 8:12131223.[CrossRef][Medline]
39 Nakagawa, T., M. Takahashi, T. Ozaki, K. Watanabe, S. Todo, H. Mizuguchi, T. Hayakawa, and A. Nakagawara. 2002. Autoinhibitory regulation of p73 by
Np73 to modulate cell survival and death through a p73-specific target element within the
Np73 promoter. Mol. Cell. Biol. 22:25752585.[Abstract/Free Full Text]
40 Stiewe, T., C.C. Theseling, and B.M. Putzer. 2002. Transactivation-deficient
TA-p73 inhibits p53 by direct competition for DNA binding. J. Biol. Chem. 277:1417714185.[Abstract/Free Full Text]
41 Kern, S.E., J.A. Pietenpol, S. Thiagalingam, A. Seymour, K.W. Kinzler, and B. Vogelstein. 1992. Oncogenic forms of p53 inhibit p53-regulated gene expression. Science. 256:827830.[Abstract/Free Full Text]
42 Unger, T., M.M. Nau, S. Segal, and J.D. Minna. 1992. p53: a transdominant regulator of transcription whose function is ablated by mutations occurring in human cancer. EMBO J. 11:13831390.[Medline]
43 Ishimoto, O., C. Kawahara, K. Enjo, M. Obinata, T. Nukiwa, and S. Ikawa. 2002. Possible oncogenic potential of DeltaNp73: a newly identified isoform of human p73. Cancer Res. 62:636641.[Abstract/Free Full Text]
44 Hibi, K., B. Trink, M. Patturajan, W.H. Westra, O.L. Caballero, D.E. Hill, E.A. Ratovitski, J. Jen, and D. Sidransky. 2000. AIS is an oncogene amplified in squamous cell carcinoma. Proc. Natl. Acad. Sci. USA. 97:54625467.[Abstract/Free Full Text]
45 Park, B.J., S.J. Lee, J.I. Kim, S.J. Lee, C.H. Lee, S.G. Chang, J.H. Park, and S.G. Chi. 2000. Frequent alteration of p63 expression in human primary bladder carcinomas. Cancer Res. 60:33703374.[Abstract/Free Full Text]
46 Crook, T., J.M. Nicholl, J. Brooks, J. O'Nions, and M.J. Allday. 2000. High level expression of deltaN-p63: a mechanism for the inactivation of p53 in undifferentiated nasopharyngeal carcinoma (NPC)? Oncogene. 10:34393444.
47 Moll, U.M. 2000. New p53-based strategies for cancer therapy. In DNA Alterations in Cancer: Genetic and Epigenetic Changes. M. Ehrlich, editor. Eaton Publishing, Natick, MA. 439455.

CiteULike
Complore
Connotea
Del.icio.us
Digg
Facebook
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
-
Lunghi, P., Costanzo, A., Mazzera, L., Rizzoli, V., Levrero, M., Bonati, A.
(2009). The p53 Family Protein p73 Provides New Insights into Cancer Chemosensitivity and Targeting. Clin. Cancer Res.
15: 6495-6502
[Abstract]
[Full Text]
-
Prokunina-Olsson, L., Welch, C., Hansson, O., Adhikari, N., Scott, L. J., Usher, N., Tong, M., Sprau, A., Swift, A., Bonnycastle, L. L., Erdos, M. R., He, Z., Saxena, R., Harmon, B., Kotova, O., Hoffman, E. P., Altshuler, D., Groop, L., Boehnke, M., Collins, F. S., Hall, J. L.
(2009). Tissue-specific alternative splicing of TCF7L2. Hum Mol Genet
18: 3795-3804
[Abstract]
[Full Text]
-
Marques-Garcia, F., Ferrandiz, N., Fernandez-Alonso, R., Gonzalez-Cano, L., Herreros-Villanueva, M., Rosa-Garrido, M., Fernandez-Garcia, B., Vaque, J. P., Marques, M. M., Alonso, M. E., Segovia, J. C., Leon, J., Marin, M. C.
(2009). p73 Plays a Role in Erythroid Differentiation through GATA1 Induction. J. Biol. Chem.
284: 21139-21156
[Abstract]
[Full Text]
-
Ahmad, Z. K., Altuna, X., Lopez, J. P., An, Y., Wang-Rodriguez, J., Juneja, V. R., Chen, J. S., Arandazi, M. J., Aguilera, J., Harris, J. P., Ongkeko, W. M.
(2009). p73 Expression and Function in Vestibular Schwannoma. Arch Otolaryngol Head Neck Surg
135: 662-669
[Abstract]
[Full Text]
-
Burge, S., Teufel, D. P., Townsley, F. M., Freund, S. M. V., Bycroft, M., Fersht, A. R.
(2009). Molecular basis of the interactions between the p73 N terminus and p300: Effects on transactivation and modulation by phosphorylation. Proc. Natl. Acad. Sci. USA
106: 3142-3147
[Abstract]
[Full Text]
-
Sun, Y, Peng, Z-L
(2009). Programmed cell death and cancer. Postgrad. Med. J.
85: 134-140
[Abstract]
[Full Text]
-
Rosenbluth, J. M., Mays, D. J., Pino, M. F., Tang, L. J., Pietenpol, J. A.
(2008). A Gene Signature-Based Approach Identifies mTOR as a Regulator of p73. Mol. Cell. Biol.
28: 5951-5964
[Abstract]
[Full Text]
-
Rosenbluth, J. M., Pietenpol, J. A.
(2008). The jury is in: p73 is a tumor suppressor after all. Genes Dev.
22: 2591-2595
[Abstract]
[Full Text]
-
Tomasini, R., Tsuchihara, K., Wilhelm, M., Fujitani, M., Rufini, A., Cheung, C. C., Khan, F., Itie-Youten, A., Wakeham, A., Tsao, M.-s., Iovanna, J. L., Squire, J., Jurisica, I., Kaplan, D., Melino, G., Jurisicova, A., Mak, T. W.
(2008). TAp73 knockout shows genomic instability with infertility and tumor suppressor functions. Genes Dev.
22: 2677-2691
[Abstract]
[Full Text]
-
Tozluoglu, M., Karaca, E., Haliloglu, T., Nussinov, R.
(2008). Cataloging and organizing p73 interactions in cell cycle arrest and apoptosis. Nucleic Acids Res
36: 5033-5049
[Abstract]
[Full Text]
-
Tannapfel, A., John, K., Mise, N., Schmidt, A., Buhlmann, S., Ibrahim, S. M., Putzer, B. M.
(2008). Autonomous growth and hepatocarcinogenesis in transgenic mice expressing the p53 family inhibitor DNp73. Carcinogenesis
29: 211-218
[Abstract]
[Full Text]
-
Furuya, K., Ozaki, T., Hanamoto, T., Hosoda, M., Hayashi, S., Barker, P. A., Takano, K., Matsumoto, M., Nakagawara, A.
(2007). Stabilization of p73 by Nuclear I{kappa}B Kinase-{alpha} Mediates Cisplatin-induced Apoptosis. J. Biol. Chem.
282: 18365-18378
[Abstract]
[Full Text]
-
Zhang, J., Chen, X.
(2007). {Delta}Np73 Modulates Nerve Growth Factor-Mediated Neuronal Differentiation through Repression of TrkA. Mol. Cell. Biol.
27: 3868-3880
[Abstract]
[Full Text]
-
Bozzetti, C., Nizzoli, R., Musolino, A., Martella, E. M., Crafa, P., Lagrasta, C. A., Camisa, R., Bonati, A., Lunghi, P., Ardizzoni, A.
(2007). p73 and p53 Pathway in Human Breast Cancers. JCO
25: 1451-1453
[Full Text]
-
Dominguez, G., Bonilla, F.
(2007). In Reply. JCO
25: 1453-1454
[Full Text]
-
Malaguarnera, R, Vella, V, Vigneri, R, Frasca, F
(2007). p53 family proteins in thyroid cancer. Endocr Relat Cancer
14: 43-60
[Abstract]
[Full Text]
-
Li, H., Yao, L., Ouyang, T., Li, J., Wang, T., Fan, Z., Fan, T., Dong, B., Lin, B., Li, J., Xie, Y.
(2007). Association of p73 G4C14-to-A4T14 (GC/AT) polymorphism with breast cancer survival. Carcinogenesis
28: 372-377
[Abstract]
[Full Text]
-
Benito, A., Gutierrez, O., Pipaon, C., Real, P. J., Gachon, F., Ritchie, A. E., Fernandez-Luna, J. L.
(2006). A Novel Role for Proline- and Acid-rich Basic Region Leucine Zipper (PAR bZIP) Proteins in the Transcriptional Regulation of a BH3-only Proapoptotic Gene. J. Biol. Chem.
281: 38351-38357
[Abstract]
[Full Text]
-
Dicker, F., Kater, A. P., Prada, C. E., Fukuda, T., Castro, J. E., Sun, G., Wang, J. Y., Kipps, T. J.
(2006). CD154 induces p73 to overcome the resistance to apoptosis of chronic lymphocytic leukemia cells lacking functional p53. Blood
108: 3450-3457
[Abstract]
[Full Text]
-
Watson, I. R., Blanch, A., Lin, D. C. C., Ohh, M., Irwin, M. S.
(2006). Mdm2-mediated NEDD8 Modification of TAp73 Regulates Its Transactivation Function. J. Biol. Chem.
281: 34096-34103
[Abstract]
[Full Text]
-
Casavant, N. C., Luo, M. H., Rosenke, K., Winegardner, T., Zurawska, A., Fortunato, E. A.
(2006). Potential Role for p53 in the Permissive Life Cycle of Human Cytomegalovirus.. J. Virol.
80: 8390-8401
[Abstract]
[Full Text]
-
Li, T. W.-H., Ting, J.-H. T., Yokoyama, N. N., Bernstein, A., van de Wetering, M., Waterman, M. L.
(2006). Wnt Activation and Alternative Promoter Repression of LEF1 in Colon Cancer.. Mol. Cell. Biol.
26: 5284-5299
[Abstract]
[Full Text]
-
Liu, S. S., Chan, K. Y.-K., Cheung, A. N.-Y., Liao, X.-Y., Leung, T.-W., Ngan, H. Y.-S.
(2006). Expression of {Delta}Np73 and TAp73{alpha} Independently Associated with Radiosensitivities and Prognoses in Cervical Squamous Cell Carcinoma.. Clin. Cancer Res.
12: 3922-3927
[Abstract]
[Full Text]
-
Law, D. J., Labut, E. M., Adams, R. D., Merchant, J. L.
(2006). An isoform of ZBP-89 predisposes the colon to colitis. Nucleic Acids Res
34: 1342-1350
[Abstract]
[Full Text]
-
Dominguez, G., Garcia, J. M., Pena, C., Silva, J., Garcia, V., Martinez, L., Maximiano, C., Gomez, M. E., Rivera, J. A., Garcia-Andrade, C., Bonilla, F.
(2006). {Delta}TAp73 Upregulation Correlates With Poor Prognosis in Human Tumors: Putative In Vivo Network Involving p73 Isoforms, p53, and E2F-1. JCO
24: 805-815
[Abstract]
[Full Text]
-
Malaguarnera, R., Mandarino, A., Mazzon, E., Vella, V., Gangemi, P., Vancheri, C., Vigneri, P., Aloisi, A., Vigneri, R., Frasca, F.
(2005). The p53-homologue p63 may promote thyroid cancer progression. Endocr Relat Cancer
12: 953-971
[Abstract]
[Full Text]
-
Concin, N., Hofstetter, G., Berger, A., Gehmacher, A., Reimer, D., Watrowski, R., Tong, D., Schuster, E., Hefler, L., Heim, K., Mueller-Holzner, E., Marth, C., Moll, U. M., Zeimet, A. G., Zeillinger, R.
(2005). Clinical Relevance of Dominant-Negative p73 Isoforms for Responsiveness to Chemotherapy and Survival in Ovarian Cancer: Evidence for a Crucial p53-p73 Cross-talk In vivo. Clin. Cancer Res.
11: 8372-8383
[Abstract]
[Full Text]
-
Guan, M, Chen, Y
(2005). Aberrant expression of {Delta}Np73 in benign and malignant tumours of the prostate: correlation with Gleason score. J. Clin. Pathol.
58: 1175-1179
[Abstract]
[Full Text]
-
Nyman, U., Sobczak-Pluta, A., Vlachos, P., Perlmann, T., Zhivotovsky, B., Joseph, B.
(2005). Full-length p73{alpha} Represses Drug-induced Apoptosis in Small Cell Lung Carcinoma Cells. J. Biol. Chem.
280: 34159-34169
[Abstract]
[Full Text]
-
Mills, A. A.
(2005). p53: link to the past, bridge to the future. Genes Dev.
19: 2091-2099
[Full Text]
-
Dulloo, I., Sabapathy, K.
(2005). Transactivation-dependent and -independent Regulation of p73 Stability. J. Biol. Chem.
280: 28203-28214
[Abstract]
[Full Text]
-
Belkhiri, A., Zaika, A., Pidkovka, N., Knuutila, S., Moskaluk, C., El-Rifai, W.
(2005). Darpp-32: a Novel Antiapoptotic Gene in Upper Gastrointestinal Carcinomas. Cancer Res.
65: 6583-6592
[Abstract]
[Full Text]
-
Saifudeen, Z., Diavolitsis, V., Stefkova, J., Dipp, S., Fan, H., El-Dahr, S. S.
(2005). Spatiotemporal Switch from {Delta}Np73 to TAp73 Isoforms during Nephrogenesis: IMPACT ON DIFFERENTIATION GENE EXPRESSION. J. Biol. Chem.
280: 23094-23102
[Abstract]
[Full Text]
-
Liu, G., Chen, X.
(2005). The C-terminal Sterile {alpha} Motif and the Extreme C Terminus Regulate the Transcriptional Activity of the {alpha} Isoform of p73. J. Biol. Chem.
280: 20111-20119
[Abstract]
[Full Text]
-
Martinez, N., Sanchez-Beato, M., Carnero, A., Moneo, V., Tercero, J. C., Fernandez, I., Navarrete, M., Jimeno, J., Piris, M. A.
(2005). Transcriptional signature of Ecteinascidin 743 (Yondelis, Trabectedin) in human sarcoma cells explanted from chemo-naive patients. Molecular Cancer Therapeutics
4: 814-823
[Abstract]
[Full Text]
-
Hanamoto, T., Ozaki, T., Furuya, K., Hosoda, M., Hayashi, S., Nakanishi, M., Yamamoto, H., Kikuchi, H., Todo, S., Nakagawara, A.
(2005). Identification of Protein Kinase A Catalytic Subunit {beta} as a Novel Binding Partner of p73 and Regulation of p73 Function. J. Biol. Chem.
280: 16665-16675
[Abstract]
[Full Text]
-
Johnson, R. A., Shepard, E. M., Scotto, K. W.
(2005). Differential Regulation of MDR1 Transcription by the p53 Family Members: ROLE OF THE DNA BINDING DOMAIN. J. Biol. Chem.
280: 13213-13219
[Abstract]
[Full Text]
-
Terrasson, J., Allart, S., Martin, H., Lule, J., Haddada, H., Caput, D., Davrinche, C.
(2005). p73-Dependent Apoptosis through Death Receptor: Impairment by Human Cytomegalovirus Infection. Cancer Res.
65: 2787-2794
[Abstract]
[Full Text]
-
Goldschneider, D., Million, K., Meiller, A., Haddada, H., Puisieux, A., Benard, J., May, E., Douc-Rasy, S.
(2005). The neurogene BTG2TIS21/PC3 is transactivated by {Delta}Np73{alpha} via p53 specifically in neuroblastoma cells. J. Cell Sci.
118: 1245-1253
[Abstract]
[Full Text]
-
Flinterman, M., Guelen, L., Ezzati-Nik, S., Killick, R., Melino, G., Tominaga, K., Mymryk, J. S., Gaken, J., Tavassoli, M.
(2005). E1A Activates Transcription of p73 and Noxa to Induce Apoptosis. J. Biol. Chem.
280: 5945-5959
[Abstract]
[Full Text]
-
Urist, M., Tanaka, T., Poyurovsky, M. V., Prives, C.
(2004). p73 induction after DNA damage is regulated by checkpoint kinases Chk1 and Chk2. Genes Dev.
18: 3041-3054
[Abstract]
[Full Text]
-
Uramoto, H., Wetterskog, D., Hackzell, A., Matsumoto, Y., Funa, K.
(2004). p73 competes with co-activators and recruits histone deacetylase to NF-Y in the repression of PDGF {beta}-receptor. J. Cell Sci.
117: 5323-5331
[Abstract]
[Full Text]
-
Uramoto, H., Sugio, K., Oyama, T., Nakata, S., Ono, K., Morita, M., Funa, K., Yasumoto, K.
(2004). Expression of {Delta}Np73 Predicts Poor Prognosis in Lung Cancer. Clin. Cancer Res.
10: 6905-6911
[Abstract]
[Full Text]
-
Jacobs, W. B., Walsh, G. S., Miller, F. D.
(2004). Neuronal Survival and p73/p63/p53: A Family Affair. Neuroscientist
10: 443-455
[Abstract]
-
Ghosh, A., Stewart, D., Matlashewski, G.
(2004). Regulation of Human p53 Activity and Cell Localization by Alternative Splicing. Mol. Cell. Biol.
24: 7987-7997
[Abstract]
[Full Text]
-
Tomkova, K., Belkhiri, A., El-Rifai, W., Zaika, A. I.
(2004). p73 Isoforms Can Induce T-Cell Factor-Dependent Transcription in Gastrointestinal Cells. Cancer Res.
64: 6390-6393
[Abstract]
[Full Text]
-
Lunghi, P., Costanzo, A., Levrero, M., Bonati, A.
(2004). Treatment with arsenic trioxide (ATO) and MEK1 inhibitor activates the p73-p53AIP1 apoptotic pathway in leukemia cells. Blood
104: 519-525
[Abstract]
[Full Text]
-
Moll, U. M., Slade, N.
(2004). p63 and p73: Roles in Development and Tumor Formation. Mol Cancer Res
2: 371-386
[Abstract]
[Full Text]
-
Ando, K., Ozaki, T., Yamamoto, H., Furuya, K., Hosoda, M., Hayashi, S., Fukuzawa, M., Nakagawara, A.
(2004). Polo-like Kinase 1 (Plk1) Inhibits p53 Function by Physical Interaction and Phosphorylation. J. Biol. Chem.
279: 25549-25561
[Abstract]
[Full Text]
-
Concin, N., Becker, K., Slade, N., Erster, S., Mueller-Holzner, E., Ulmer, H., Daxenbichler, G., Zeimet, A., Zeillinger, R., Marth, C., Moll, U. M.
(2004). Transdominant {Delta}TAp73 Isoforms Are Frequently Up-regulated in Ovarian Cancer. Evidence for Their Role as Epigenetic p53 Inhibitors in Vivo. Cancer Res.
64: 2449-2460
[Abstract]
[Full Text]
-
Liu, G., Nozell, S., Xiao, H., Chen, X.
(2004). {Delta}Np73{beta} Is Active in Transactivation and Growth Suppression. Mol. Cell. Biol.
24: 487-501
[Abstract]
[Full Text]
-
Stiewe, T., Tuve, S., Peter, M., Tannapfel, A., Elmaagacli, A. H., Putzer, B. M.
(2004). Quantitative TP73 Transcript Analysis in Hepatocellular Carcinomas. Clin. Cancer Res.
10: 626-633
[Abstract]
[Full Text]
-
Moll, U. M.
(2003). The Role of p63 and p73 in Tumor Formation and Progression: Coming of Age Toward Clinical Usefulness: Commentary re: F. Koga et al., Impaired p63 Expression Associates with Poor Prognosis and Uroplakin III Expression in Invasive Urothelial Carcinoma of the Bladder. Clin. Cancer Res., 9: 5501-5507, 2003, and P. Puig et al., p73 Expression in Human Normal and Tumor Tissues: Loss of p73{alpha} Expression Is Associated with Tumor Progression in Bladder Cancer. Clin. Cancer Res., 9: 5642-5651, 2003.. Clin. Cancer Res.
9: 5437-5441
[Full Text]
-
Ben-Yehoyada, M., Ben-Dor, I., Shaul, Y.
(2003). c-Abl Tyrosine Kinase Selectively Regulates p73 Nuclear Matrix Association. J. Biol. Chem.
278: 34475-34482
[Abstract]
[Full Text]
-
Wu, G., Nomoto, S., Hoque, M. O., Dracheva, T., Osada, M., Lee, C.-C. R., Dong, S. M., Guo, Z., Benoit, N., Cohen, Y., Rechthand, P., Califano, J., Moon, C.-s., Ratovitski, E., Jen, J., Sidransky, D., Trink, B.
(2003). {Delta}Np63{alpha} and TAp63{alpha} Regulate Transcription of Genes with Distinct Biological Functions in Cancer and Development. Cancer Res.
63: 2351-2357
[Abstract]
[Full Text]
-
Stiewe, T., Stanelle, J., Theseling, C. C., Pollmeier, B., Beitzinger, M., Putzer, B. M.
(2003). Inactivation of Retinoblastoma (RB) Tumor Suppressor by Oncogenic Isoforms of the p53 Family Member p73. J. Biol. Chem.
278: 14230-14236
[Abstract]
[Full Text]