The Journal of Experimental Medicine
Torrey Pines Biolabs
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

Published online 26 August 2002 doi:10.1084/jem.20012142
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 114K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tatsumi, T.
Right arrow Articles by Storkus, W. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tatsumi, T.
Right arrow Articles by Storkus, W. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
© Rockefeller University Press, 0022-1007/2002/9/619/ $5.00
The Journal of Experimental Medicine, Volume 196, Number 5, September 2, 2002 619-628

Disease-associated Bias in T Helper Type 1 (Th1)/Th2 CD4+ T Cell Responses Against MAGE-6 in HLA-DRB1*0401+ Patients With Renal Cell Carcinoma or Melanoma

Tomohide Tatsumi1, Lisa S. Kierstead1, Elena Ranieri1,4, Loreto Gesualdo4, Francesco P. Schena4, James H. Finke5, Ronald M. Bukowski5, Jan Mueller-Berghaus1, John M. Kirkwood2,6, William W. Kwok7 and Walter J. Storkus1,3,6

1 Department of Surgery, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261
2 Department of Medicine, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261
3 Department of Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261
4 Department of Emergency and Organ Transplantation, Section of Nephrology, University of Bari, Bari 70124, Italy
5 Cleveland Clinic Foundation, Cleveland, OH 44195
6 University of Pittsburgh Cancer Institute, Pittsburgh, PA 15261
7 Department of Immunology, Virginia Mason Research Center, Seattle, WA 98101

Address correspondence to Walter J. Storkus, Professor of Surgery, Molecular Genetics and Biochemistry, and Pathology, W1555 Biomedical Sciences Tower, University of Pittsburgh School of Medicine, 200 Lothrop St., Pittsburgh, PA 15261. Phone: 412-624-6453; Fax: 412-624-1172; E-mail: storkuswj{at}msx.upmc.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
T helper type 1 (Th1)-type CD4+ antitumor T cell help appears critical to the induction and maintenance of antitumor cytotoxic T lymphocyte (CTL) responses in vivo. In contrast, Th2- or Th3/Tr-type CD4+ T cell responses may subvert Th1-type cell-mediated immunity, providing a microenvironment conducive to disease progression. We have recently identified helper T cell epitopes derived from the MAGE-6 gene product; a tumor-associated antigen expressed by most melanomas and renal cell carcinomas. In this study, we have assessed whether peripheral blood CD4+ T cells from human histocompatibility leukocyte antigens (HLA)-DRß1*0401+ patients are Th1- or Th2-biased to MAGE-6 epitopes using interferon (IFN)-{gamma} and interleukin (IL)-5 enzyme-linked immunospot assays, respectively. Strikingly, the vast majority of patients with active disease were highly-skewed toward Th2-type responses against MAGE-6–derived epitopes, regardless of their stage (stage I versus IV) of disease, but retained Th1-type responses against Epstein-Barr virus– or influenza-derived epitopes. In marked contrast, normal donors and cancer patients with no current evidence of disease tended to exhibit either mixed Th1/Th2 or strongly Th1-polarized responses to MAGE-6 peptides, respectively. CD4+ T cell secretion of IL-10 and transforming growth factor (TGF)-ß1 against MAGE-6 peptides was not observed, suggesting that specific Th3/Tr-type CD4+ subsets were not common events in these patients. Our data suggest that immunotherapeutic approaches will likely have to overcome or complement systemic Th2-dominated, tumor-reactive CD4+ T cell responses to provide optimal clinical benefit.

Key Words: melanoma • renal cell carcinoma • helper T lymphocyte • MAGE-6 • epitope


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Although renal cell carcinoma (RCC)* and melanoma are considered among the most responsive cancers to immunotherapy, the vast majority of recent immunotherapeutic approaches have focused solely on the induction of CD8+ antitumor T cells in vivo as a surrogate of clinical benefit (13). It appears clear that the ability to promote effector CD8+ T cells reactive against tumor antigens is a necessary, but not sufficient, event in objective clinical responses (4). CD4+ T cells can also recognize tumor antigen-derived peptides, either directly (as some RCCs and melanomas express MHC class II molecules in situ; references 5 and 6) or via cross-presentation mechanisms by host antigen-presenting cells, such as dendritic cells (DCs; references 7 and 8). Th1-type CD4+ T cells secreting IFN-{gamma} appear crucial to the optimal generation and durability of specific CTL in vivo and may also serve to recruit these effector cells into the tumor microenvironment via delayed-type hypersensitivity responses (8). Hence, the lack of effectively promoting specific Th1-type CD4+ T cell generation, maintenance, and direction for antitumor CD8+ T cells may represent a significant limitation in current vaccine trials.

Tumor-induced deviation of CD4+ T cell responses in progressive disease and the role of Th1- and Th2-type CD4+ effector cells have been evaluated in a limited number of murine models (919). Studies using the B16 melanoma model have documented a gradual shift of initial Th0-, mixed Th1-/Th2-type CD4+ T cell response to Th2/Tr-type dominated responses by 14–20 d of progressive tumor growth (13, 1719). Injection of neutralizing anti–IL-4, -IL-10, or -TGF-ß1 antibodies can prevent this tumor-induced functional transition, resulting in enhanced CD8+ CTL generation and protection against tumor growth (17). Depletion of CD4+ T cells in late-stage progressive B16 models, where Th2/Tr-type response dominate, restores CTL effector function and can result in tumor regression and vitiligo, particularly upon administration of rIL-12 (13). Analyses of the anti-tumor efficacy of Th1- and Th2-type CD4+ T cells has also been evaluated in prophylactic and adoptive transfer tumor models (9, 12, 13, 15). In these latter cases, Th1- and Th2-type can mediate complementary antitumor effector functions, via contrasting mechanisms (9). Although Th2-type CD4+ T cells can promote the recruitment of tumoricidal eosinophils and macrophages into the tumor microenvironment and promote acute tumor rejection (9), on a cell-per-cell basis Th1-type T cells appear to provide a greater therapeutic index (12, 14, 15) and only Th1-type CD4+ T cells appear to promote durable anti-tumor CTL responses (15).

Interestingly, tumor infiltrating lymphocytes in patients with spontaneous and therapeutically induced regressing lesions appear to be characterized by dominant Th1-type responses to mitogens, whereas tumor infiltrating lymphocytes from patients with progressor lesions have been reported to exhibit functionally dominant Th2-type (IL-4, IL-5) and/or Th3-/Tr-type (IL-10, TGF-ß1) CD4+ T cell responses (2022). However, prior analyses of patient bulk CD4+ T cell responses to mitogenic stimuli have yielded equivocal results, with generally no clear-cut Th1- or Th2-type bias observed (2325). As this difference in results may reflect the stringency with which tumor-specific CD4+ T cell responses were evaluated, significant recent emphasis has been placed on the identification of tumor antigen-derived helper T cell epitopes that may be used to quantitate and assess tumor-specific CD4+ T cell numbers and function.

Based on IFN-{gamma} as a read-out cytokine or proliferation as an endpoint, Th1-type epitopes have been identified for the MART-1/Melan-A, gp100/pmel17, tyrosinase, MAGE-3, and MAGE-6 (unpublished data) melanoma-associated antigens, among others (2628). We have recently defined a set of helper epitopes derived from the MAGE-6 protein and have focused on these targets in the current study, since expression of MAGE-6 (unpublished data) has been observed in premalignant lesions in situ and at high frequencies in primary and metastatic tumors (2931). Hence, CD4+ T cell responses to MAGE-6 epitopes may represent early etiologic events. The bias of MAGE-6 (tumor)-specific CD4+ T cell responses (i.e., Th1, Th2, Th3/Tr) may impact cancer incidence in susceptible individuals, the progression status of established MAGE-6+ tumors or time to recurrence of MAGE-6+ disease in the adjuvant setting. Indeed, melanoma expression of HLA-DR has been reported to be a marker of poor prognosis (32, 33), suggesting that the nature of CD4+ T cell recognition of MHC class II–presented tumor epitopes may play a decisive immunoregulatory role in situ.

This study is the first to demonstrate tumor antigen-specific Th2-type polarization of CD4+ T cell responses in the peripheral blood of patients with RCC or melanoma. We have implemented IFN-{gamma} and IL-5 ELISPOT assays to assess the magnitude of Th1- and Th2-type CD4+ T cell responses to MAGE-6 epitopes, respectively. We report that HLA-DRß1*0401+ patients with active melanoma or RCC displayed strongly polarized Th2-type reactivity to these peptides, whereas normal donors and patients that were disease-free following therapeutic intervention exhibited either weak mixed Th1-/Th2-type or strongly-polarized Th1-type responses to these same epitopes.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell Lines and Media.
The T2.DR4 (DRB1*0401+) cell line (provided by Dr. Janice Blum, Indiana University School of Medicine, Indianapolis, IN) was used as the peptide-presenting cell in these studies. This cell line uniformly expresses HLA-DR*0401 molecules that contain moderate-to-low affinity binding peptides derived mainly from intracellular invariant chain (class II–associated invariant chain peptide [CLIP]) due to a genetic deficiency in HLA-DM (34). T2.DR4 cells were maintained in RPMI-1640 supplemented with 10% heat-inactivated FBS, 100 IU/ml penicillin, 100 µg/ml streptomycin, and 10 mM L-glutamine (all reagents GIBCO BRL).

Peptide Selection and Synthesis.
The MAGE-6 (unpublished data), influenza A matrix60–73 (35), malarial circumsporozooite326–345 (26) and EBV EBNA-1519–533 (36) HLA-DR4-presented epitopes were synthesized by FMOC chemistry by the University of Pittsburgh Cancer Institute's (UPCI) Peptide Synthesis Facility (Shared Resource). Peptides were >90% pure based on HPLC profile and MS/MS mass spectrometric analysis performed by the UPCI Protein Sequencing Facility (Shared Resource).

Isolation of Patient and Normal Donor PBMC-Derived T Cells.
40–100 ml of patient or normal donor heparinized blood was obtained with informed consent under IRB-approved protocols and diluted 1:2 with HBSS, applied to ficoll-hypaque gradients (LSM; Organon-Teknika) per the manufacturer's instructions, and centrifuged at 550 g for 25 min at room temperature. Patient and normal donor information is provided in Table I. PBMCs at the buoyant interface were recovered and washed twice with HBSS to remove residual platelets and ficoll-hypaque. HLA-DR4+ status was confirmed by flow cytometry using the anti-HLA-DR4 reactive mAb clone 359–13F10 (IgG; provided by Dr. Janice Blum, Indiana University School of Medicine, Indianapolis, IN) in indirect immunofluorescence assays. PBMCs were diluted to 107/ml in AIM-V medium (GIBCO BRL) and incubated for 60 min at 37°C in T75 vented flasks (COSTAR), with subsequently harvested adherent cells used to generate DCs (see below) and nonadherent cells frozen in 90% FCS containing 10% DMSO (Sigma-Aldrich) at 107 lymphocytes/vial using controlled-rate freezing technique. On the day of establishing DC–T cell cultures, nonadherent cells were thawed and washed twice with HBSS. CD4+ T cells were then isolated using MACSTM (Miltenyi Biotec) anti–human CD4 beads and MiniMACSTM columns per the manufacturer's protocol. CD4+ T cell yields were typically 25–35% of starting PBMC numbers loaded, with purity exceeding 97% as assessed by flow cytometry.


View this table:
[in this window]
[in a new window]
 
Table I. HLA-DRB1*0401-positive Patients Evaluated in this Study

 
Induction of Antitumor T Effector Lymphocytes.
Autologous DCs were prepared as described previously in 7-d cultures of plastic-adherent PBMCs in AIM-V media supplemented with rhGM-CSF and rhIL-4 (26). Harvested, nonadherent DC (2 x 105) were then cocultured with 2 x 106 autologous CD4+ T cells in the presence of 10 µM synthetic peptides for 7 d in RPMI-1640 containing 10% FBS and no exogenously added cytokines. Responder T cells were then harvested and analyzed for MAGE-6 peptide specificity in ELISPOT assays.

IFN-{gamma} and IL-5 ELISPOT Assays for Peptide-Reactive CD4+ T Cell Responses.
To evaluate the frequencies of peripheral blood CD4+ T cells recognizing peptide epitopes, ELISPOT assays for IFN-{gamma} and IL-5 were performed as described previously (26, 27, 37). Briefly, CD4+ T cell responses were evaluated by both IFN-{gamma} (Th1) and IL-5 (Th2) ELISPOT assays. For ELISPOT assays, 96-well multiscreen hemagglutinin antigen plates (Millipore) were coated with 10 µg/ml of anti–human IFN-{gamma} mAb (1-D1K; Mabtech) or 5 µg/ml of anti–human IL-5 (BD Biosciences) in PBS (GIBCO BRL/Life Technologies) overnight at 4°C. Unbound antibody was removed by four successive washing with PBS. After blocking the plates with RPMI1640/10% human serum (1 h at 37°C), 105 CD4+ T cells and T2.DR4 cells (2 x 104 cells) were seeded in multiscreen hemagglutinin antigen plates. Synthetic peptides (stocks at 1 mg/ml PBS) were then added to appropriate wells at a final concentration of 10 µg/ml. Negative peptide control wells contained CD4+ T cells with T2.DR4 cells pulsed with Malaria-CS326–345 peptide, with T2.DR4 cells alone serving as the APC control. Positive controls were T cells plated in the presence of 5 µg/ml PHA (Sigma-Aldrich). Culture medium was AIM-V (GIBCO BRL/Life Technologies) at a final volume of 200 µl/well. Plates were incubated at 37oC in 5% CO2 for 24 h in the case of IFN-{gamma} ELISPOT assays and for 40 h in IL-5 ELISPOT assays. After incubation, supernatants of culture wells were harvested for ELISA analysis, and plates washed with PBS/0.05% Tween 20 (PBS/T) to remove cells. Captured cytokine was detected at sites of its secretion by incubation for 2 h with biotinylated mAb anti–human IFN-{gamma} (7-B6–1; Mabtech) at 2 µg/ml in PBS/0.5% BSA or biotinylated mAb anti–human IL-5 (BD Biosciences) at 2 µg/ml in PBS/0.5% BSA. Plates were then washed six times with PBS/T, and avidin-peroxidase complex (diluted 1:100; Vectastain Elite Kit; Vector Laboratories) was added for 1 h. Unbound complex was removed by three successive washings with PBS/T and three rinses with PBS alone. AEC substrate (Sigma-Aldrich) was added and incubated for 5 min for the IFN-{gamma} ELISPOT assay and the TMB substrate for peroxidase (Vector Laboratories) was added and incubated for 10 min for the IL-5 ELISPOT assay. All determinations were performed in triplicates, with spots imaged using the Zeiss AutoImager (and statistical comparisons determined using a Student two-tailed t test analysis). The data are represented as mean IFN-{gamma} or IL-5 spots per 100,000 CD4+ T cells analyzed.

TGF-ß1 and IL-10 ELISAs.
Supernatants were harvested from ELISPOT plates at the endpoint of the culture period and pooled for a single stimulus (i.e., a given peptide, etc.) and frozen at –20°C until analysis by cytokine-specific ELISA. Cytokine capture and detection antibodies and recombinant cytokine were purchased from BD Biosciences and used in ELISA assays per the manufacturer's instructions. The lower limit of detection for the TGF-ß assay was 60 pg/ml, while that of the IL-10 ELISA was 7 pg/ml. In the case of IL-10, 1–5 responder CD4+ T cells spots imaged in an IL-10 ELISPOT equated with ~12–17 pg/ml IL-10 as determined in the IL-10 ELISA assay (unpublished data).

PCR Analysis.
PCR analyses were performed to determine patient HLA-DR4 genotype using a commercial PCR panel according to the manufacturer's instructions (Dynal) and PBL. RT-PCR analysis was also used to determine tumor expression of MAGE-6 mRNA. The following primer set was used: MAGE-6 (forward: TGGAGGACCAGAGGCCCCC, reverse: CAGGATGATTATCAGGAAGCCTGT, product size 728 bp with cycles: melting 94°C for 1 min, annealing 68°C for 1 min, extension 72°C for 1 min).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Normal HLA-DRß1*0401+ Donors Fail to React or Display a Mixed Th1/Th2 CD4+ Response to MAGE-6 Epitopes after Primary In Vitro Stimulation.
MAGE-6 peptides were not recognized by freshly-isolated CD4+ T cells harvested from normal HLA-DRB1*0401+ donors (unpublished data). To determine if CD4+ precursors were present in normal donors and to identify the balance of Th1-type versus Th2-type responses, we implemented IFN-{gamma} and IL-5 ELISPOT assays, respectively. Although both IL-4 and IL-5 have been previously reported as signature cytokines for Th2-type T cell responses (38, 39), we chose the IL-5 assay over the IL-4 ELISPOT assay to screen for Th2-type CD4+ T cell reactivity for technical reasons, mainly the much lower backgrounds and higher signal-to-noise ratio observed for the IL-5 ELISPOT system (37, 40).

To evaluate whether normal donors could be prompted to recognize any of these sequences, isolated CD4+ T cells derived from the PBMCs of HLA-DR4+ normal donors were stimulated with autologous immature DCs in the presence of the individual MAGE-6 peptides (i.e., MAGE-6121–144, MAGE-6140–170, or MAGE-6246–263). We chose this in vitro stimulation (IVS) protocol since the DCs generated were poor IL-12 producers upon CD40 ligation and these antigen presenting cells do not appear to skew CD4+ T cell responses in either a Th1-type or Th2-type manner (unpublished data). Hence, we consider these as "neutral" DC for CD4+ T cell stimulations. 1 wk after stimulation, CD4+ T cells were used as responders against T2.DR4 target cells pulsed with the candidate DR4-binding peptides. As shown in Fig. 1 , an analysis of 10 normal HLA-DR4+ donors revealed either very low responsiveness or responses that were equivocal with regard to their balance of IFN-{gamma} versus IL-5 spot production. Although we did not perform these analyses in a manner that allowed for an assessment of coordinate cytokine production from a given CD4+ T cell, we considered these results from normal donors to reflect Th0-type or mixed Th1-type/Th2-type responses.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 1. Analysis of the Th1-type vs. Th2-type CD4+ T cell response to MAGE-6 peptides in HLA-DRß1*0401+ normal donors. Peripheral blood CD4+ T cells were isolated from normal donors and stimulated with autologous, "immature" DCs in the presence of the MAGE-6121–144 (M121), MAGE-6140–170 (140L) (M140), or MAGE-6246–263 (M246) peptides for 7 d, in the absence of exogenous cytokines. Responder CD4+ T cells were then analyzed for their reactivity to T2.DR4 cells pulsed with individual MAGE-6 peptides in both IFN-{gamma} and IL-5 ELISPOT assays. Each symbol within a panel represents the combined IFN-{gamma}/IL-5 ELISPOT data for an individual normal donor.

 
Th1-type versus Th2-type Immunoreactivity of CD4+ T Cells Against HLA-DR4-Presented MAGE-6 Epitopes in HLA-DR4+ RCC or Melanoma Patients.
Recent reports have suggested that CD4+ T cells infiltrating progressor RCC and melanoma may display a predominant Th2-bias in response to TCR ligation (41, 42). We used the IFN-{gamma} (Th1-type) and IL-5 (Th2-type) ELISPOT assays to discern whether such a bias existed in the peripheral blood CD4+ T cell repertoire of HLA-DRß1*0401+ patients with RCC or melanoma using the identical IVS system outlined above for normal donors.

Overall, the peripheral blood CD4+ T cell responses were evaluated from 18 RCC and 18 melanoma patients (Table I). Among these patients, 4/18 RCC patients and 7/18 melanoma patients were disease-free (i.e., no-evidence of disease [NED]) at the time of analysis, with all other patients presenting with active disease. As shown in Fig. 2 , patients with active disease (either RCC or melanoma) displayed strongly Th2-polarized CD4+ T cell responses, whereas patients that were disease-free at the time of analysis were strongly Th1-polarized in their reactivity to the three MAGE-6 epitopes evaluated. Not every patient reacted against each of the peptides tested, but if they did respond to a given epitope, this response was strongly polarized in accordance with the disease status of the individual (i.e., Th2 if active disease, etc., Table I). Whereas the melanoma patients were all essentially diagnosed with stage IV disease (with the exception of patients SLM6, SLM9, and SLM23), the RCC patients were approximately equally represented by individuals with stage I or stage IV disease (with patient SLR17 exhibiting stage II disease). A comparison of whether the observed Th2-polarization in CD4+ T cell response to MAGE-6 peptides (Fig. 2, top series) was correlated with disease stage in RCC patients, provided no statistically significant associations (stage I versus stage IV for MAGE-6121–144 [P = 0.89]; for MAGE140–170 [P = 0.27]; for MAGE-6246–263 [P = 0.50]).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 2. Analysis of the Th1-type vs. Th2-type CD4+ T cell response to MAGE-6 peptides in HLA-DRß1*0401+ patients with RCC or melanoma. Peripheral blood CD4+ T cells were isolated from patients with RCC or melanoma and stimulated for 7 d with autologous "immature" plus MAGE-6 peptides as described in the legend to Fig. 1. Responder CD4+ T cells were then analyzed for their reactivity to T2.DR4 cells pulsed with individual MAGE-6 peptides in both IFN-{gamma} and IL-5 ELISPOT assays. Each symbol within a panel represents the combined IFN-{gamma}/IL-5 ELISPOT data for an individual patient, with filled circles indicating patients with active disease and open inverted triangles reflecting patients that were free of disease at the time of evaluation, as described in Table I.

 
Patients with active disease were not predisposed to a general Th2-type polarization in their CD4+ T cell responses. An evaluation of CD4+ T cells from the patients with melanoma or RCC, or normal donors revealed mixed Th1-/Th2-type responses to PHA mitogenic stimulation in IFN-{gamma} and IL-5 ELISPOT assays (Fig. 3) . As groups, patients with active disease, patients with no evidence of disease and normal donors proved indistinguishable in their bulk CD4+ T cell responses to mitogen. Using a series of newly defined HLA-DR4–presented helper epitopes defined from the influenza virus matrix protein (FluM160–73; reference 35) and EBV EBNA-1 (EBNA-1519–533; reference 36), we were able to evaluate CD4+ T cell responses in patients SLR18 and SLR19 who each presented with active disease at the time of analysis (Fig. 4) . In each case, strongly Th2-type biased CD4+ T cell reactivity was noted against the three MAGE-6 epitopes, with concurrent Th1-type polarized CD4+ T cell antiviral responses.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 3. Patient CD4+ T cells from IVS cultures exhibit normal, mixed Th1/Th2 responses to PHA mitogenic stimulation regardless of disease status. CD4+ T cell cultures obtained from IVS outlined in Figs. 1 and 2 were analyzed for their response to PHA mitogen (5 µg/ml). Each symbol represents the combined IFN-{gamma}/IL-5 ELISPOT data for an individual, with melanoma or RCC patients with active disease denoted by filled circles, and patients with no evidence of disease indicated by open circles.

 


View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. Peripheral blood CD4+ T cells from patients SLM18 and SLM19 display Th2-type reactivity to MAGE-6 epitopes, but Th1-type reactivity to viral epitopes. CD4+ T cells were stimulated with immature autologous DCs pulsed with the indicated peptides for 1 wk, as outlined in Figs. 1 and 2. Responder CD4+ T cells were then analyzed for their reactivity to T2.DR4 cells pulsed with individual MAGE-6, influenza matrix, or EBV peptides in both IFN-{gamma} and IL-5 ELISPOT assays.

 
Patients with RCC or Melanoma Do Not Exhibit Th3-/Tr-type CD4+ T Cell Responses to MAGE-6 Epitopes.
Although no ELISPOT is currently available to evaluate TGF-ß production, an index for the bioactivity of the Tr-type CD4+ T cells, we analyzed the supernatant from the peptide-stimulated ELISPOT wells for TGF-ß levels using a cytokine specific ELISA assay. All supernatants were below the level of detection for secreted TGF-ß (i.e., <60 pg/ml, unpublished data). We also evaluated these supernatants for the presence of IL-10 production and were unable to demonstrated peptide-specific secretion of this cytokine (i.e., <7 pg/ml, unpublished data). Based on direct comparison to a newly developed IL-10 ELISPOT assay, as few as 1–5 IL-10 secreting CD4+ T cells (per 50,000) would have registered as 12–17 pg IL-10/ml in our ELISA assay (unpublished data). Hence we believe that these patients have, at best, very few (frequencies <=1/50,000 CD4+ T cells) in their peripheral blood.

Successful therapy associated with NED status is linked to a conversion of peripheral Th2-type to Th1-type CD4+ T cell response to MAGE-6 epitopes. RCC patient SLR12 with stage I disease was surgically managed, resulting in disease-free status. Peripheral blood CD4+ T cell responses were evaluated pre- and postsurgery in IFN-{gamma} and IL-5 ELISPOT assays against the MAGE-6121–144, MAGE-6140–170, and MAGE-6246–263 epitopes, as outlined above. Weak Th2-biased responses were noted against the MAGE-6121–144 and MAGE-6246–263 peptides before surgery, while weak, but Th1-biased responses against these epitopes were noted 1 mo postsurgery (Fig. 5 A).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 5. Analysis of the Th1-type vs. Th2-type CD4+ T cell response to MAGE-6 peptides in HLA-DRß1*0401+ RCC and melanoma patients pre/posttherapy. Peripheral blood T cells were isolated from an RCC patient SLR12 (A) and melanoma patient SLM1 (B) pre- or posttherapy. In both cases, therapy resulted in disease-free status. In the case of patient SLR12, blood was drawn at the time of surgery (filled circle) and 2 mo postsurgery (open inverted triangle). Patient SLM1 was treated with a DC-based vaccine, resulting in a complete response in 3/97. Blood was drawn pretherapy and during therapy, but before regression (filled circles) and after complete regression (open inverted triangles). 7-d IVS were performed as outlined in Fig. 1, with responder CD4+ T cells analyzed for their reactivity to T2.DR4 cells pulsed with individual MAGE-6 peptides in both IFN-{gamma} and IL-5 ELISPOT assays.

 
Patient SLM1 with stage IV melanoma was treated with an autologous DC-based vaccine (UPCI 95–060) and achieved a complete response in March 1997. Peripheral blood CD4+ T cells were isolated both pre- (8/96 and 3/97) and post- (4/97, 11/98) regression of disease. Patient SLM1 was disease-free at the time of both postregression time points. As shown in Fig. 5 B, this patient reacted to all three MAGE-6 epitopes in a strongly Th2-biased manner before regression, but displayed only Th1-type reactivity after the tumor burden was clinically eradicated.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We analyzed peripheral blood T cells harvested from HLA-DRß1*0401+ normal donors and patients with RCC or melanoma for the magnitude and nature of CD4+ T cell responses to 3 MAGE-6 epitopes that we have recently identified as HLA-DRß1*0401-presented epitopes (unpublished data). We observed a dominance of Th2-type (and a frequent lack of any Th1-type) CD4+ T cell responses to these MAGE-6 epitopes in RCC and melanoma patients with active disease (Fig. 2). In marked contrast, normal donors and patients that had been successfully treated and were disease free at the time of analysis, displayed either mixed Th1-/Th2-type or strongly Th1-polarized immunity to these same peptides. It should be stressed that these polarized CD4+ T cell responses are specific for the tumor peptides tested and do not reflect the general tendency of the donor to respond in a generically Th2- (or Th1-) biased fashion, as the mitogen (PHA) control spot frequencies obtained for both the IL-5 and IFN-{gamma} ELISPOT assays were indiscriminant between patients with cancer, patients that were free of disease, and normal donors (Fig. 3). In addition, for two RCC patients (SLR18 and SLR19) evaluated, Th2-type immunity to MAGE-6 peptides coexisted with strong Th1-type immunity to influenza- and EBV-derived helper epitopes (Fig. 4). Overall, although these data derive from relatively few patients, they suggest that Th2-type dominated CD4+ T cell responses against MAGE-6 epitopes may correlate with active disease status in the patient.

However, when the results of RCC patients with stage I disease were compared with those of RCC patients with stage IV disease, we were unable to determine any significant linkage between the degree of Th2-polarization to MAGE-6 epitopes and disease-stage in patients with active disease. As MAGE-6 appears to represent an early tumor-associated antigen, observed in even premalignant lesions (2931), our results may suggest that skewing of a normally mixed Th1-/Th2-type MAGE-6-specific CD4+ T cell responses toward Th2-dominated immunity may also be an early event in disease progression. Such polarization could result from chronic antigenic restimulation in situ throughout disease ontogeny, and could be initiated even in individuals with premalignant MAGE-6+ lesions, potentially serving as a facilitator of disease progression.

Clearly, far more extensive longitudinal studies will be required to determine the prognostic significance of differential Th1- versus Th2-type in the progression, clearance, and/or recurrence of disease. Although we are now in the process of initiating these types of comprehensive studies at the UPMC and UPCI, our preliminary data provided in Fig. 5, suggests that in an RCC patient that was surgically managed and a melanoma patient that was treated with an autologous DC-based vaccine, that Th2-biased responses to MAGE-6 epitopes shifted to Th1-biased response after the patient achieved disease-free status. Furthermore, based on preliminary MHC-peptide tetramer analysis, MAGE-6 reactive CD4+ T cells were observed to increase in the peripheral blood, at least transiently, as soon as 1–2 mo after successful therapy (unpublished data), which may support the register of these helper T cell responses with clinical benefit.

An additional important consideration in our prospective analyses will be a careful comparison of systemic versus tumor-associated CD4+ T cell response polarization to MAGE-6 epitopes. It would be hypothesized that the most dramatic polarizations and highest frequencies of non-Th1 polarized tumor antigen-specific CD4+ T cells would be identified in the tumor microenvironment and tumor-draining lymph nodes. Although we have reported an essentially qualitative Th2-type bias in response to MAGE-6 peptides in the peripheral blood of patients with active disease, we have been thus far, unable to demonstrate systemic antigen-specific Th3/Tr-type CD4+ T cell responses to these epitopes. This may suggest that these latter responses are rare-events in the patient, or alternatively, that they may be concentrated and best observed within the tumor-involved tissues of the patient.

An analysis of the data presented in Table I indicates that 12/15 (i.e., 80%) evaluable melanoma biopsies expressed the MAGE-6 antigen as deduced by RT-PCR analysis. In all 12 of these MAGE-6+ patients, Th1-type or Th2-type CD4+ T cell responses were detected by ELISPOT analysis against at least one of the three MAGE-6 epitopes analyzed in this study. In 2/3 cases where the patient's tumor failed to express the MAGE-6 gene product, the patient's CD4+ T cells did not react to MAGE-6 epitopes. The resected tumor in patient SLM22, however, failed to express the MAGE-6 mRNA, yet Th2-type CD4+ T cell responses were observed against all three MAGE-6–derived helper epitopes. This result may be due to MAGE-6 expression by nonresected metastatic lesions in this stage IV patient with active disease. Alternatively, the anti-MAGE-6 CD4+ T cells may be reacting or cross-reacting against homologous epitopes derived from other MAGE-A family member proteins. An analysis of all MAGE-A family members suggests that this possibility would be most likely for the MAGE-6121–144 peptide, which is identical to the homologous MAGE-3 sequence, but which differs in sequence at 3 or more key positions with all other MAGE-A members (unpublished data). This possibility is less likely for the MAGE-6140–170 and MAGE-6246–263 epitopes that differ from the homologous MAGE-3 sequence by two nonconservative D156S and Y249H substitutions within the putative core binding epitope (unpublished data). Additional nonconservative changes in these two epitope sequences are noted when comparing MAGE-6 to all other MAGE-A members. As corollary analyses, we will prospectively determine whether patient CD4+ T cells isolated using specific HLA-DR4/MAGE-6 peptide tetramers recognize the homologous MAGE-A family sequences.

In these studies, we chose an in vitro induction assay using autologous immature monocyte-derived (i.e., myeloid) DCs that appeared not to skew the nature of the isolated CD4+ T cell response to a given epitope. In preliminary studies, we analyzed freshly-isolated CD4+ T cells from melanoma patients as the responders (arguably recall responses) to peptide-pulsed T2.DR4 targets in our ELISPOT assays and discerned the same cytokine (IFN versus IL-5) secretion bias, as we report after IVS. We systematically implemented the 7-d IVS (using immature myeloid DCs) protocol as this amplified the technically-detectable (ZEISS AutoImager) spot numbers in each of the assays, without changing the bias of cytokines produced. We feel that this is a reasonable amplification tool in the outlined work. As this report was designed to reflect, as closely as possible, the in situ peripheral repertoire, we have not attempted to delineate how other DC subsets or conditioning regimens alters the bias of the responder repertoire in the current manuscript. Our data, however, may suggest that immature DCs, such as have been implemented in a number of vaccine trials (43, 44), may be clinically-inferior to strong DC1-type cells (producing high quantities of IL-12; references 45 and 46) due to their comparative inability to promote strong Th1-biased immunity in the face of existing Th2-type responses.

So, why does the tumor-reactive CD4+ T cell repertoire shift to a Th2-dominated phenotype in situ in cancer bearing patients? A number of nonmutually exclusive hypotheses have been proffered. These include: immune deviation via chronic antigenic stimulation and selective sensitivity of Th1-type CD4+ T cells to activation-induced apoptosis (47), the promotion of DC2-type (i.e., Th2-type promoting) antigen-presenting cell function conditioned by tumor-secreted cytokines and chemokines (i.e., IL-10, TGF-ß, SDF-1; references 48 and 49), and the enforced repolarization of Th1 type-responses into Th2-type responses in situ (50), among others. Using MHC/MAGE-6 peptide tetramers, we anticipate the ability to assess the proapoptotic phenotype of specific CD4+ T cells in patients with active disease versus those that have achieved NED status in future studies. Our current studies investigating CD4+ T cell response to viral epitopes suggest that patient DCs do not exert a dominant DC2 functional phenotype in vitro. Clearly these important issues demand intense prospective evaluation.

Although we are currently analyzing DC-based vaccines that are capable of repolarizing Th2-type tumor-reactive CD4+ T cells toward Th1-type immunity, this may not necessarily represent the clinically preferred modality for the treatment of existing disease. As previously mentioned, Th2-type tumor-specific CD4+ T cells may well prove productive collaborators to Th1-type CD4+ T cells in mediating tumor regression via different, but complementary mechanisms (912, 14, 20). This may be particularly important in the case of MHC class I–loss variant tumors that will be impervious to Th1-type CD4+ T cell-sponsored cytotoxicity mediated by CD8+ antitumor T cells (10, 11). Regardless of which underlying mechanism leads to tumor regression, it appears clear that strong Th1-type tumor-specific T cell responses will be important in the maintenance of durable cellular immunity (12) and extended disease-free intervals in those patients at high-risk for recurrence.


    Acknowledgments
 
The authors wish to thank Dr. Walter Olson and Mr. William Knapp for their excellent technical support and to Drs. Eva Pizzoferrato, Anna Kalinska, and Cynthia Brissette-Storkus for their careful review and comments during the generation of this manuscript.

This work was supported by grants from the National Institutes of Health CA 57840, CA 73743, and CA 82297 (W.J. Storkus) and the Kidney Cancer Association (L.S. Kierstead).

Submitted: December 27, 2001
Revised: June 4, 2002
Accepted: July 15, 2002


    Footnotes
 
* Abbreviations used in this paper: DC, dendritic cell; IVS, in vitro stimulation(s); RCC, renal cell carcinoma. Back


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

1 Jager, E., D. Jager, and A. Knuth. 1999. CTL-defined cancer vaccines: perspectives for active immunotherapeutic interventions in minimal residual disease. Cancer Metastasis Rev. 18:143–150.[CrossRef][Medline]

2 Lindauer, M., T. Stanislawski, A. Haussler, E. Antunes, A. Cellary, C. Huber, and M. Theobald. 1998. The molecular basis of cancer immunotherapy by cytotoxic T lymphocytes. J. Mol. Med. 76:32–47.[CrossRef][Medline]

3 Coulie, P.G. 1997. Human tumour antigens recognized by T cells: new perspectives for anti-cancer vaccines? Mol. Med. Today. 3:261–268.[CrossRef][Medline]

4 Nielsen, M.B., and F.M. Marincola. 2000. Melanoma vaccines: the paradox of T cell activation without clinical response. Cancer Chemother. Pharmacol. 46:S62–S66.

5 Brasanac, D., J. Markovic-Lipokovski, J. Hadzi-Djokic, G.A. Muller, and C.A. Muller. 1999. Immunohistochemical analysis of HLA class II antigens and tumor infiltrating mononuclear cells in renal cell carcinoma: correlation of clinical and histopathological data. Neoplasma. 46:173–178.[Medline]

6 Ruiter, D.J., V. Mattijssen, E.B. Broecker, and S. Ferrone. 1991. MHC antigens in human melanomas. Semin. Cancer Biol. 2:35–45.[Medline]

7 Hoffmann, T.K., N. Meidenbauer, J. Mueller-Berghaus, W.J. Storkus, and T.L. Whiteside. 2001. Proinflammatory cytokines and CD40 ligand enhance cross-presentation and cross-priming capability of human dendritic cells internalizing apoptotic cancer cells. J. Immunother. 24:162–171.[CrossRef][Medline]

8 Nestle, F.O., S. Alijagic, M. Gilliet, Y. Sun, S. Grabbe, R. Dummer, G. Burg, and D. Schadendorf. 1998. Vaccination of melanoma patients with peptide- or tumor lysate-pulsed dendritic cells. Nat. Med. 4:328–332.[CrossRef][Medline]

9 Hung, K., R. Hayashi, A. Lafond-Walker, C. Lowenstein, D. Pardoll, and H. Levitsky. 1998. The central role of CD4+ T cells in the antitumor immune response. J. Exp. Med. 188:2357–2368.[Abstract/Free Full Text]

10 Levitsky, H.I., A. Lazenby, R.J. Hayashi, and D.M. Pardoll. 1994. In vivo priming of two distinct antitumor effector populations: the role of MHC class I expression. J. Exp. Med. 179:1215–1224.[Abstract/Free Full Text]

11 Dranoff, G., E. Jaffee, A. Lazenby, P. Golumbek, H. Levitsky, K. Brose, V. Jackson, H. Hamada, D. Pardoll, and R.C. Mulligan. 1993. Vaccination with irradiated tumor cells engineered to secrete murine granulocyte-macrophage colony-stimulating factor stimulates potent, specific, and long-lasting anti-tumor immunity. Proc. Natl. Acad. Sci. USA. 90:3539–3543.[Abstract/Free Full Text]

12 Fallarino, F., U. Grohmann, R. Bianchi, C. Vacca, M.C. Fioretti, and P. Puccetti. 2000. Th1 and Th2 cell clones to a poorly immunogenic tumor antigen initiate CD8+ T cell-dependent tumor eradication in vivo. J. Immunol. 165:5495–5501.[Abstract/Free Full Text]

13 Nagai, H., I. Hara, T. Horikawa, M. Oka, S. Kamidono, and M. Ichihashi. 2000. Elimination of CD4+ T cells enhances anti-tumor effect of locally secreted interleukin-12 on B16 mouse melanoma and induces vitiligo-like coat color alteration. J. Invest. Dermatol. 115:1059–1064.[CrossRef][Medline]

14 Nishimura, T., K. Iwakabe, M. Sekimoto, Y. Ohmi, T. Yahata, M. Nakui, T. Sato, S. Habu, H. Tashiro, M. Sato, and A. Ohta. 1999. Distinct role of antigen-specific T helper type 1 (Th1) and Th2 cells in tumor eradication in vivo. J. Exp. Med. 190:617–627.[Abstract/Free Full Text]

15 Nishimura, T., M. Nakui, M. Sato, K. Iwakabe, H. Kitamura, M. Sekimoto, A. Ohta, T. Koda, and S. Nishimura. 2000. The critical role of Th1-dominant immunity in tumor immunology. Cancer Chemother. Pharmacol. 46:S52–S61.

16 Gorelik, L., and R.A. Flavell. 2001. Immune-mediated eradication of tumors through the blockade of transforming growth factor-beta signaling in T cells. Nat. Med. 7:1118–1122.[CrossRef][Medline]

17 Seo, N., S. Hayakawa, M. Takigawa, and Y. Tokura. 2001. Interleukin-10 expressed at early tumour sites induces subsequent generation of CD4+ T-regulatory cells and systemic collapse of antitumour immunity. Immunology. 103:449–457.[CrossRef][Medline]

18 Oka, H., Y. Emori, Y. Hayashi, and K. Nomoto. 2000. Breakdown of Th cell immune responses and steroidogenic CYP11A1 expression in CD4+ T cells in a murine model implanted with B16 melanoma. Cell. Immunol. 206:7–15.[CrossRef][Medline]

19 Kobayashi, M., H. Kobayashi, R.B. Pollard, and F. Suzuki. 1998. A pathogenic role of Th2 cells and their cytokine products on the pulmonary metastasis of murine B16 melanoma. J. Immunol. 160:5869–5873.[Abstract/Free Full Text]

20 Lowes, M.A., G.A. Bishop, K. Crotty, R.S. Barnetson, and G.M. Halliday. 1997. T helper 1 cytokine mRNA is increased in spontaneously regressing primary melanoma. J. Invest. Derm. 108:914–919.[CrossRef][Medline]

21 Schwaab, T., J.A. Heaney, A.R. Schned, R.D. Harris, B.F. Cole, R.J. Noelle, D.M. Phillips, L. Stempkowski, and M.S. Ernstoff. 2000. A randomized phase II trial comparing two different sequence combinations of autologous vaccine and human recombinant interferon gamma and human recombinant interferon alpha2B therapy in patients with metastatic renal cell carcinoma: clinical outcome and analysis of immunological parameters. J. Urol. 163:1322–1327.[CrossRef][Medline]

22 Wittke, F., R. Hoffmann, J. Buer, I. Dallmann, K. Oevermann, S. Sel, T. Wandert, A. Ganser, and J. Atzpodien. 1999. Interleukin 10 (IL-10): an immunosuppressive factor and independent predictor in patients with metastatic renal cell carcinoma. Br. J. Cancer. 79:1182–1184.[CrossRef][Medline]

23 Aoki, Y., I. Tsuneki, M. Sasaki, M. Watanabe, T. Sato, H. Aida, and K. Tanaka. 2000. Analysis of Th1 and Th2 cells by intracellular cytokine detection with flow cytometry in patients with ovarian cancer. Gynecol. Obstet. Invest. 50:207–211.[CrossRef][Medline]

24 Goedegebuure, P.S., and T.J. Eberlein. 1995. The role of CD4+ tumor-infiltrating lymphocytes in human solid tumors. Immunol. Res. 14:119–131.[Medline]

25 Pardoll, D.M., and S.L. Topalian. 1998. The role of CD4+ T cell responses in antitumor immunity. Curr. Opin. Immunol. 10:588–594.[CrossRef][Medline]

26 Zarour, H., J.M. Kirkwood, L.S. Kierstead, W. Herr, V. Brusic, C.L. Slingluff, A. Sette, S. Southwood, and W.J. Storkus. 2000. MART-151-73 represents an immunogenic HLA-DR4-restricted epitope recognized by melanoma-reactive CD4+ T cells. Proc. Natl. Acad. Sci. USA. 97:400–405.[Abstract/Free Full Text]

27 Kierstead, L.S., E. Ranieri, V. Brusic, J. Sidney, A. Sette, C.L. Slingluff, J.M. Kirkwood, J.M., and W.J. Storkus. 2001. Multiple gp100- and tyrosinase-derived peptides are recognized by melanoma-reactive CD4+ Th1-type T cells. Br. J. Cancer. 85:1738–1745.[CrossRef][Medline]

28 Chaux, P., V. Vantomme, V. Stroobant, K. Thielemans, J. Corthals, R. Luiten, A.M. Eggermont, T. Boon, and P. van der Bruggen. 1999. Identification of MAGE-3 epitopes presented by HLA-DR molecules to CD4+ T lymphocytes. J. Exp. Med. 189:767–778.[Abstract/Free Full Text]

29 Gibbs, P., A.M. Hutchins, K.T. Dorian, H.A. Vaughan, I.D. Davis, M. Silvapulie, and J.S. Cebon. 2000. MAGE-12 and MAGE-6 are frequently expressed in malignant melanoma. Melanoma Res. 10:259–264.[Medline]

30 Sudo, T., T. Kuramoto, S. Komiya, A. Inoue, and K. Itoh. 1997. Expression of MAGE genes in osteosarcoma. J. Orthop. Res. 15:128–132.[CrossRef][Medline]

31 Ishida, H., T. Matsumura, M.L. Salgaller, Y. Ohmizono, Y. Kadono, and T. Sawada. 1996. MAGE-1 and MAGE-3 or -6 expression in neuroblastoma-related pediatric solid tumors. Int. J. Cancer. 69:375–380.[CrossRef][Medline]

32 Ruiter, D.J., V. Mattijssen, E.B. Broecker, and S. Ferrone. 1991. MHC antigens in human melanomas. Semin. Cancer Biol. 2:35–45.[Medline]

33 Colloby, P.S., K.P. West, and A. Fletcher. 1992. Is poor prognosis really related to HLA-DR expression by malignant melanoma cells? Histopathology. 20:411–416.[Medline]

34 Turvy, D.N., and J.S. Blum. 1998. Detection of biotinylated cell surface receptors and MHC molecules in a capture ELISA: a rapid assay to measure endocytosis. J. Immunol. Methods. 212:9–18.[CrossRef][Medline]

35 Linnemann, T., G. Jung, and P. Walden. 2000. Detection and quantification of CD4+ T cells with specificity for a new major histocompatibility complex class II-restricted influenza A virus matrix protein epitope in peripheral blood of influenza patients. J. Virol. 74:8740–8743.[Abstract/Free Full Text]

36 Leen, A., P. Meij, I. Redchenko, J. Middeldorp, E. Bloemena, A. Rickinson, and N. Blake. 2001. Differential immunogenicity of Epstein-Barr virus latent-cycle proteins for human CD4+ T-helper 1 responses. J. Virol. 75:8649–8659.[Abstract/Free Full Text]

37 Herr, W., E. Ranieri, W. Olson, H. Zarour, L. Gesualdo, and W.J. Storkus. 2000. Mature dendritic cells pulsed with tumor freeze-thaw lysate define an effective in vitro vaccine designed to elicit EBV-specific CD4+ and CD8+ T lymphocyte responses. Blood. 96:1857–1864.[Abstract/Free Full Text]

38 Swain, S.L., D.T. McKenzie, R.W. Dutton, S.L. Tonkonogy, and M. English. 1988. The role of IL4 and IL5: characterization of a distinct helper T cell subset that makes IL4 and IL5 (Th2) and requires priming before induction of lymphokine secretion. Immunol. Rev. 102:77–105.[CrossRef][Medline]

39 Constant, S.L., and K. Bottomly. 1997. Induction of Th1 and Th2 CD4+ T cell responses: the alternative approaches. Annu. Rev. Immunol. 15:297–322.[CrossRef][Medline]

40 Bennouna, J., A. Hildesheim, K. Chikamatsu, W. Gooding, W.J. Storkus, and T.L. Whiteside. 2002. Application of IL-5 ELISPOT assays to quantitation of antigen-specific T helper responses. J. Immunol. Methods. 261:145–156.[CrossRef][Medline]

41 Kharkevitch, D.D., D. Seito, G.C. Balch, T. Maeda, C.M. Balch, and K. Itoh. 1994. Characterization of autologous tumor-specific T-helper 2 cells in tumor-infiltrating lymphocytes from a patient with metastatic melanoma. Int. J. Cancer. 58:317–323.[Medline]

42 Maeurer, M.J., D.M. Martin, C. Castelli, E. Elder, G. Leder, W.J. Storkus, and M.T. Lotze. 1995. Host Immune response in renal cell cancer: IL-4 and IL-10 mRNA are frequently detected in freshly collected tumor infiltrating lymphocytes. Cancer Immunol. Immunother. 41:111–121.[Medline]

43 Geiger, J.D., R.J. Hutchinson, L.F. Hohenkirk, E.A. McKenna, G.A. Yanik, J.E. Levine, A.E. Chang, T.M. Braun, and J.J. Mule. 2001. Vaccination of pediatric solid tumor patients with tumor lysate-pulsed dendritic cells can expand specific T cells and mediate tumor regression. Cancer Res. 61:8513–8519.[Abstract/Free Full Text]

44 Jonuleit, H., A. Giesecke-Tuettenberg, T. Tueting, B. Thurner-Schuler, T.B. Stuge, L. Paragnik, A. Kandemir, P.P. Lee, G. Schuler, J. Knop, and A.H. Enk. 2001. A comparison of two types of dendritic cell as adjuvants for the induction of melanoma-specific T-cell responses in humans following intranodal injection. Int. J. Cancer. 93:243–251.[CrossRef][Medline]

45 de Jong, E.C., P.L. Vieira, P. Kalinski, J.H. Schuitemaker, Y. Tanaka, E.A. Wierenga, M. Yazdanbakhsh, and M.I. Kapsenberg. 2002. Microbial compounds selectively induce Th1 cell-promoting or Th2 cell-promoting dendritic cells in vitro with diverse Th cell-polarizing signals. J. Immunol. 168:1704–1709.[Abstract/Free Full Text]

46 Rissoan, M.C., V. Soumelis, N. Kadowaki, G. Grouard, F. Briere, R. de Waal Malefyt, and Y.J. Liu. 1999. Reciprocal control of T helper cell and dendritic cell differentiation. Science. 283:1183–1186.[Abstract/Free Full Text]

47 Zhang, X., T. Brunner, L. Carter, R.W. Dutton, P. Rogers, L. Bradley, T. Sato, J.C. Reed, D. Green, and S.L. Swain. 1997. Unequal death in T helper cell (Th)1 and Th2 effectors: Th1, but not Th2, effectors undergo rapid Fas/FasL-mediated apoptosis. J. Exp. Med. 185:1837–1849.[Abstract/Free Full Text]

48 Bellone, G., A. Turletti, E. Artusio, K. Mareschi, A. Carbone, D. Tibaudi, A. Robecchi, G. Emanuelli, and U. Rodeck. 1999. Tumor-associated transforming growth factor-beta and interleukin-10 contribute to a systemic Th2 immune phenotype in pancreatic carcinoma patients. Am. J. Pathol. 155:537–547.[Abstract/Free Full Text]

49 Zou, W., V. Machelon, A. Coulomb-L'Hermin, J. Borvak, F. Nome, T. Isaeva, S. Wei, R. Krzysiek, I. Durand-Gasselin, A. Gordon, et al. 2001. Stromal-derived factor-1 in human tumors recruits and alters the function of plasmacytoid precursor dendritic cells. Nat. Med. 7:1339–1346.[CrossRef][Medline]

50 Kourilsky, P., and P. Truffa-Bachi. 2001. Cytokine fields and the polarization of the immune response. Trends Immunol. 22:502–509.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 114K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tatsumi, T.
Right arrow Articles by Storkus, W. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tatsumi, T.
Right arrow Articles by Storkus, W. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?


  Home | Help | Feedback | Subscriptions | Archive | Search
TABLE OF CONTENTS