|
||
The Lectin-like Domain of Thrombomodulin Confers Protection from Neutrophil-mediated Tissue Damage by Suppressing Adhesion Molecule Expression via Nuclear Factor
B and Mitogen-activated Protein Kinase Pathways
2 Klinik und Poliklinik für Anästhesiologie und Operative Intensivmedizin, University of Muenster, D-48149 Muenster, Germany
3 McMaster University and Hamilton Civic Hospital Research Center, Hamilton L8V-1C3, Canada
4 The Blood Center for Southeastern Wisconsin, Milwaukee, WI 53233
5 Sanofi-Synthelabo, Thrombosis Research Department, 31036 Toulouse, France
Address correspondence to Edward M. Conway, Center for Transgene Technology and Gene Therapy, KU Leuven, Gasthuisberg O&N, 9th Floor, Herestraat 49, B-3000 Leuven, Belgium. Phone: +32-16-345780; Fax: +32-16-345990; E-mail: ed.conway{at}med.kuleuven.ac.be
| Abstract |
|---|
|
|
|---|
B and activation of ERK1/2, and rescues ECs from serum starvation, findings that may explain why plasma levels of soluble TM are inversely correlated with cardiovascular disease. These data suggest that TM has antiinflammatory properties in addition to its role in coagulation and fibrinolysis.
Key Words: inflammation coagulation endotoxin sepsis protein C
TM is composed of five structural domains. Extending from a short cytoplasmic tail and transmembrane domain is a serine/threoninerich region to which a chondroitin sulfate moiety that optimizes anticoagulant function is attached (2). Next is a domain that consists of six epidermal growth factor (EGF)-like repeats, four of which are responsible for the protein's anticoagulant and antifibrinolytic functions (3, 4). The NH2-terminal domain has two modules. The first, adjacent to the EGF-like domain, is an
Mutational analyses of TM have been restricted to patients with venous or cardiovascular disease and therefore its direct role in inflammation has not been evaluated. Although single nucleotide polymorphisms of TM have been weakly linked with heart disease, these amino acid changes are not within the structures responsible for PC activation (7). Soluble forms of TM derived from the extracellular domain of TM are found in plasma and urine (8, 9). Clinical studies reveal an inverse correlation between plasma levels of soluble TM and coronary artery disease and atherosclerosis (10). Although it has been proposed that the EGF-like repeats of soluble TM promote the generation of APC, which in turn inhibits atherogenesis, it is possible that other components of soluble TM have independent vasculo-protective and antiinflammatory functions.
To evaluate whether the NH2-terminal domain endows TM with properties distinct from its established role in coagulation and fibrinolysis, we generated mice lacking this structure. We report that the lectin-like domain of TM provides the vascular endothelium with natural antiinflammatory properties by interfering with PMN adhesion. Mice lacking the C-type lectin-like domain have an augmented response to systemic endotoxemia, proinflammatory stimuli in the lung, and myocardial ischemia/reperfusion (MI/R). The lectin-like domain, either soluble or as an intact transmembrane glycoprotein, suppresses intracellular mitogen-activated protein (MAP) kinase pathways, thereby dampening the inflammatory response. Soluble lectin-like domain further protects vascular endothelial cells (ECs) from serum deprivationinduced cell death. The ability of TM to provide natural antiinflammatory protection in concert with its anticoagulant and EC protective properties provides new insights for the development of novel therapies and the elucidation of the etiology of a variety of inflammatory/proliferative disorders.
![]()
Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Thrombomodulin (TM)* is a widely expressed glycoprotein receptor and cofactor for thrombin's activity in a physiologically important natural anticoagulant system. Formation of the thrombinTM complex limits thrombin's procoagulant and cellular-activating functions and results in thrombin-mediated catalytic transformation of protein C (PC) into activated PC (APC), which in turn down-regulates thrombin generation by degrading coagulation factors Va and VIIIa. TM is also a cofactor for thrombin-mediated activation of plasma procarboxypeptidase B, which is a fibrinolysis inhibitor. In humans, PC deficiency is associated with a hypercoagulable state. Although APC serves as an anticoagulant, it also has antiinflammatory properties, a finding that may explain why APC infusion reduces mortality in patients with sepsis (1). As the critical cofactor for thrombin-mediated activation of PC, TM is an important bridge that links coagulation and inflammation.
70amino acid residue hydrophobic region. The second, which is
155amino acid residues long, has homology to C-type lectins (5), which in many proteins participate in immune and inflammatory processes (6).
![]()
Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Generation of Mice Lacking the NH2-terminal Lectin-like Domain of TM via Homologous Recombination in Embryonic Stem (ES) Cells.
A 12-kb Kpn1 fragment of the murine TM gene containing the coding region was subcloned as previously described (11). The WT coding region was replaced with one that encodes TM lacking the NH2-terminal domain using PCR-based mutagenesis. Two PCRs were performed. In the first, primer TMs-240 (5'-TTCTGTGGTGGCGCCTGCAGGCCACGCCCG) was paired with antisense primer TMas287i (5'-ATTCTCCACGCTGCATAGTGCGGAGAGCCCCAGGCTAGC), resulting in a 541-bp fragment. In the second, sense primer TM.s1957i (5'-GGGCTCTCCGCACTATGCAGCGTGGAGAATGGTGGCTGT) and TM.as2613EO (5'-TGGACTAGTTAATTAAGATCTTCCTC-GAGGCGCGCCGTTCAGCTGAAATATTTTAGC) yielded a 1,633-bp fragment. The amplicons were used as the target for recombinant PCR with primers TM.s-240 and TM.as2613EO, the latter primer adding Asc1, Xho1, BglII, Pac1, and Spe1 restriction sites. The recombined 2,206-bp amplicon extends from a Nar1 site 230 bp upstream of the transcriptional start site, through the coding region, and 643 bp into the 3' untranslated region (UTR). The final translated protein product represents intact TM, retaining the first 20 amino acid residues that encompass a putative signal peptide and lacking the subsequent NH2-terminal 223 amino acid residues of the lectin-like domain (see Fig. 1 A).
|
Targeted ES cells were aggregated and introduced into pseudopregnant female Swiss white mice. Two chimeric male offspring resulted in the germline transmission of the mutant TM allele (TMLeDneo/wt). F1 and F2 offspring were intercrossed. Genotyping was performed on the tail DNA by Southern blotting and PCR (see Fig. 1 C). Chimeric males were backcrossed with C57Bl/6 and 129sv/ev mouse pedigrees for comparative purposes.
In Vivo Excision of loxP-flanked Neomycin Gene.
Mice with a single allele replaced with the mutant TMLeDneo (TMLeDneo/wt mice) were bred with mice homozygous for ubiquitous expression of Cre recombinase under the control of the phosphoglucokinase promoter (12). In vivo excision of the loxP-flanked neo from the TMLeDneo/wt mice was confirmed by PCR of gDNA and RT-PCR on RNA from several tissues of offspring (see Fig. 1, DG). The oligonucleotide primer pair TM.s2520 (5' GGCTTTGGGTATTTAGTCAGA) and TM.as2700 (antisense 5' CATAAAACCCAGGCTCACCC) yielded an amplicon of 256 bp when excision was accomplished, whereas the product was 174 bp in length from the WT allele. The resultant TMLeD/wt mice were intercrossed to generate mice with the TM mutation in both alleles. WT siblings from these matings were used as controls (TMwt/wt mice).
Quantitation of TM, Cytokines, and Fibrinopeptide A (FPA).
Expression of cell surface TM was confirmed by indirect immunofluorescence (13) using rabbit antirat TM antisera (provided by R. Jackman, Brigham and Women's Hospital, Boston, MA), and cofactor activity was evaluated by the activation of PC with thrombin (14). Tissue TM was quantified using a sandwich radioimmunoassay similar to that previously reported (15). ELISA kits (R&D Systems) were used to quantify plasma levels of TNF
, IL-1ß, IL-6, and IL-10. Plasma levels of murine FPA were measured as previously described (11).
Isolation and Growth of ECs.
ECs were isolated from murine tumors induced to grow after intraperitoneal injection of retrovirus carrying the middle T antigen of murine polyomavirus (PymT; reference 16). Primary cultures of lymphatic ECs were isolated from intraperitoneal lymphangiomas (17). Experiments were performed with passages three to eight ECs, which were cultured as previously described (13). >95% of the cells stained positive for TM and von Willebrand's factor. Cell survival assays of human umbilical vein ECs (HUVECs) were performed by plating 50,000 cells/well in a 96-well plate in complete media. After 24 h, cells were washed and incubated for 72 h in M199 with 0.05% serum and recombinant protein as indicated. Cell survival was measured with the CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega).
Flow Chamber Experiments.
PMNs were isolated from bone marrow (18) and the purity was >95% by Wright staining. Adhesion of PMNs to ECs in a flow chamber was performed as previously described (19). In brief, ECs on collagen-coated glass coverslips were mounted in a parallel flow chamber and superfused with PMN suspensions (2 x 105 cells/ml). Interactions of 2'7'-bis-(2-carboxyethyl)-5-(and 6)-carboxyfluoresceinacetoxymethyl ester (BCECF-AM; Molecular Probes) labeled PMNs with ECs were observed with an inverted epifluorescence microscope and images were analyzed with NIH Image1.6. Rolling PMNs were counted on five overlays of video frames spanning 50 s of a 5-min experiment. Firm adhesion was determined on 15 high power fields (hpf; 0.9 mm2/hpf) after rinsing for 5 min. Where noted, ECs were pretreated 4 h before experiments with 200 U/ml recombinant human TNF
(Biosource International).
Static Adhesion Assay.
ECs were grown to confluence in 24-well dishes, washed twice with HBSS, and BCECF-AMlabeled PMNs (50,000/well) were added in a final volume of 1 ml for 30 min. Monolayers were washed three times with HBSS and adherent PMNs were counted.
In Vivo Activation of PC.
100 µg human PC (Enzyme Research Labs) was injected intravenously into mice and 15 min later citrated plasma was obtained. Plasma levels of activated human PC were quantified using a capture immunoassay with mAb 7D7B10 (provided by A. Ralston and C. Orthner, American Red Cross, Washington, DC; references 20 and 21). Human PC in murine plasma was measured with the Coamatic PC Assay Kit (Chromogenix) using a standard curve with known quantities of human PC in pooled murine plasma. Each result reflects duplicate measures from at least five mice.
Flow Cytometry Analyses.
3 h after intraperitoneal injection of PBS or 20 µg/g LPS (0111:B4; Sigma-Aldrich), mice were anesthetized and lung vasculature was perfused with PBS. Cell suspensions from lungs (22) were incubated with biotinylated isolectin B1 (Bandeiraea simplicifolia I; Sigma-Aldrich) and 5 µg/ml FITC-conjugated rat antimouse vascular cell adhesion molecule (VCAM)-1 antibody (CD106) or PE-conjugated hamster antimouse intercellular adhesion molecule (ICAM)-1 antibody (CD54; BD Biosciences) at 37°C for 30 min. Suspensions with CD106 or CD54 were additionally incubated with PE-streptavidin or FITC-streptavidin, respectively, followed by final washes with PBS containing 10% FBS. Cell samples were analyzed by flow cytometry using a FACScanTM (Becton Dickinson), gating on isolectin positive ECs. Controls with appropriate irrelevant antibodies excluded nonspecific labeling.
Endotoxin Studies.
LPS was injected intraperitoneally into 1012-wk-old mice. For lethality studies, animals were monitored until the recovery or cessation of breathing. For lung inflammation, 1 mg/ml endotoxin solution was nebulized into mice housing for 10 min. Mice were killed 3 h later by urethane overdose. Blood samples were drawn and the lungs were lavaged five times through a tracheal catheter with 1 ml PBS/5% BSA at 37°C. Bronchoalveolar lavage (BAL) fluid was centrifuged at 4,000 g for 5 min. The cell pellet was washed and resuspended in PBS before cell counting and myeloperoxidase (MPO) activity measurements (23). Lungs were dissected and prepared for histological analyses.
MI/R.
Myocardial ischemia was induced as previously described (24). In brief, mice were ventilated and body temperature was maintained at 36°C. The left anterior descending coronary artery was ligated over PE-10 tubing. Ischemia of the left ventricle (LV) was maintained for 30 min and then the tubing was removed allowing reperfusion. 3 h later, heparinized saline was infused into the abdominal aorta until no blood was collected from a caval venotomy. The left anterior descending coronary artery was reoccluded and Evans blue was injected into the aortic catheter to delineate the area at risk (AAR). The heart was excised, cut into five slices, each
1-mm thick, which were immersed in 2% tetrazoliumchloride (25) for the determination of AAR, infarct area, and LV size by planimetry of digitized images.
Generation of Recombinant Protein.
Recombinant murine TM, representing the NH2-terminal 155 amino acids of the mature protein (TMlec155) that was deleted in the TMLeD/LeD mice (starting with AKLQPT...; see Fig. 1) was generated by Pichia expression (Invitrogen). Additional purification was accomplished by a series of chromatography steps, including elution of the culture media from a phenyl-Sepharose column, desalting of positive eluates on a G25 column, ion exchange and NaCl gradient elution from a Q-Sepharose column, and size fractionation with superdex-75 in PBS with 0.01% Tween 80. Positive fractions, confirmed by SDS-PAGE and Western blotting with anti-TM antisera, were pooled.
Recombinant TMlec155 was also generated as a glutathione S transferase (GST) fusion protein (TMlec155-GST) by subcloning the cDNA encoding the first 155 amino acids of TM into the vector pGEX-4T-3 for expression in Eschericia coli. Media containing TMlec155-GST was incubated with glutathione-Sepharose, washed, and the TMlec155-GST was eluted from the sepharose beads with excess free glutathione.
Animal Care.
Animal experiments were approved by the Institutional Animal Ethics Committee of the University of Leuven, Leuven, Belgium.
Statistical Analyses.
Statistical analyses were conducted with the computer programs StatView (Abacus Concepts Inc.) or InStat 2.03 (GraphPad Software). Means are provided with SD unless otherwise noted. P-values were determined using the unpaired t test and groupwise comparisons by Wilcox-ranked sum testing.
| Results |
|---|
|
|
|---|
20% (74 ± 18 cpm/µg) of those in TMwt/wt and TMLeD/LeD mice. All F2 progeny appeared healthy with no differences in weight, growth, or fertility. Backcrossing onto 129sv/se and C57/Bl6 backgrounds resulted in similar phenotypes as reported herein for the Swiss:129sv/se strain.
TMLeD/LeD Mice Have Increased Mortality and Heightened Cytokine Response to Endotoxin.
Baseline plasma levels of TNF
, IL-1ß, IL-6, and IL-10 were undetectable in all mice and circulating leukocyte counts were normal. 40 µg/g intraperitoneal LPS resulted in the death of >50% of TMLeD/LeD mice within 26 h, whereas <10% of TMwt/wt mice died during the same period (Fig. 2
A). After the addition of 20 µg/g intraperitoneal LPS, TNF
and IL-1ß levels at 6 h were significantly higher in mice lacking the NH2-terminal domain (P < 0.05, n = 18; Fig. 2 B). Peripheral leukocyte and PMN counts were not significantly different (P > 0.1). The additional defect of lower TM antigen levels in the TMLeDneo/LeDneo mice did not further affect the cytokine response as compared with TMLeD/LeD mice. Thus, the lack of the NH2-terminal domain of TM is the sole cause of increased cytokine levels and reduced survival in response to systemic endotoxemia.
|
As a trigger for leukocyte-induced lung injury, we exposed mice to inhaled LPS. Baseline MPO activities in BAL fluid were not significantly different between TMwt/wt and TMLeD/LeD mice (87 ± 17 and 92 ± 23 absorbance units, respectively; n = 4), consistent with our observation that most PMNs were restricted to the lung interstitium. After LPS inhalation, BAL MPO activity was 3.5-fold higher in the TMLeD/LeD mice than in the TMwt/wt mice (420 ± 31 and 120 ± 50 absorbance units, respectively; P < 0.005, n = 8), whereas absolute PMN counts were twofold higher. Ultrastructural examination of the LPS-exposed lungs showed mild interstitial PMN accumulation beyond the vessels in peribronchial sites and within the alveoli. Therefore, the lack of the lectin-like domain of TM results in enhanced PMN accumulation in the lungs, an effect that is exacerbated by local exposure to low levels of endotoxin.
TMLeD/LeD Mice Have Larger Infarcts after MI/R.
PMN extravasation and cytokine release are hallmarks of MI/R injury (26). In a murine model, the LV area and AAR (11.0 ± 0.9 mm2 and 10.6 ± 0.7 mm2, respectively; P > 0.1) were similar in TMLeD/LeD and TMwt/wt mice. However, infarct sizes were significantly larger in TMLed/Led than in TMwt/wt mice (Fig. 3, A and B)
, both as a function of LV size and AAR (P < 0.002). To correlate myocardial injury with PMN accumulation, we injected labeled PMNs upon reperfusion, counted adherent PMNs in sectioned hearts, and compared results in corresponding regions of the hearts from TMLed/Led and TMwt/wt mice (Fig. 3, C and D). An average of 22 ± 5 PMNs were found in the AAR of TMwt/wt mice. In the TMLed/Led mice, 2.5 ± 0.7-fold more and 4.8 ± 0.9-fold more PMNs were found in the right and LV, respectively, compared with TMwt/wt mice, indicating that the extravasation of PMNs after MI/R is significantly enhanced in the TMLeD/LeD mice (P < 0.05, n = 4 for each) within and outside the ischemic regions.
|
We first confirmed that the capacity to activate PC was intact in TMLeD/LeD mice by determining that the administration of human PC did not result in significant differences in plasma concentrations of APC in TMwt/wt and TMLeD/LeD mice (P > 0.5; Fig. 4 A). Although the addition of 20 µg/g intraperitoneal LPS 2 h before administering the PC yielded higher levels of APC, there was no difference between the responses of TMwt/wt and TMLeD/LeD mice. We then determined in vitro that the accumulation of TM mRNA and cell surface thrombin-dependent activation of PC by ECs derived from TMLeD/LeD and TMwt/wt mice (TMLeD/LeD ECs and TMwt/wt ECs, respectively) were similar for both cultured lymphatic ECs and PymT-transformed endothelioma cells (Fig. 4, B and C).
|
The results indicate that APC generation is not diminished in the TMLeD/LeD mice, supporting the conclusion that the NH2-terminal lectin-like domain of TM plays a direct role in interfering with the recruitment of inflammatory cells.
Conversion of PMN Rolling to Firm Adhesion Is More Efficient on TMLeD/LeD ECs.
We evaluated the mechanisms responsible for excess accumulation of PMNs in the tissues of TMLeD/LeD mice. Because PMNs and monocytes also synthesize TM (28, 29), increased leukocyte efflux could reflect altered TM expression on inflammatory cells/endothelium. To explore these possibilities, we first evaluated the trafficking of PMNs from TMwt/wt and TMLeD/LeD mice across fEND.5 cells, a PymT-transformed murine EC line that expresses TM. At a laminar shear rate of 120s-1 in a parallel plate flow chamber, the firm adhesion of PMNs from TMwt/wt and TMLeD/LeD mice to unperturbed fEND.5 cells was 62 ± 6 (SEM) and 63 ± 8 (SEM) cells per 15 hpf, respectively (n = 5 experiments). After TNF
activation of the fEND.5 cells, the number of rolling TMwt/wt and TMLeD/LeD PMNs and their rolling distances were similar, whereas the speed of TMLeD/LeD PMNs was marginally reduced by
20% (similar results on TMwt/wt ECs; P = 0.03). With TNF
activation of fEND.5 cells, the adhesion of TMwt/wt and TMLeD/LeD PMNs was similarly increased 1.62-fold. Therefore, TM expression by TMLeD/LeD PMNs does not appreciably contribute to the augmented PMN extravasation observed in vivo in the TMLeD/LeD mice.
To examine the effect of endothelial TM on PMN trafficking, we used PymT-transformed ECs from TMwt/wt and TMLeD/LeD mice. Three different clones of ECs of each genotype yielded similar results. Again, the source of the PMNs had no significant effect on rolling/adhesion parameters. Under resting conditions, 11.1 ± 6 (n = 6) PMNs rolled on TMwt/wt ECs, resulting in a permanent adhesion of 36 ± 9 PMNs (Fig. 5 A). Although the number of rolling PMNs on resting TMLeD/LeD ECs was not significantly different, the permanent adhesion of PMNs to the TMLeD/LeD ECs was 7.8-fold greater than to the TMwt/wt ECs. Rolling PMNs traveled 49 ± 5 µm on TMwt/wt ECs with an average speed of 0.7 ± 0.06 µm/sec (n = 82) before adhering or returning to the stream. In contrast, the distance traveled by PMNs on TMLeD/LeD ECs was 30% less, and the PMN rolling speed was 55% less than that seen with TMwt/wt ECs (P < 0.0001, n = 286), indicating that the conversion of PMNs from rolling to firm adhesion is more efficient on TMLeD/LeD ECs.
|
resulted in a 6.8-fold increase in firmly adhering PMNs as compared with resting TMwt/wt ECs (Fig. 5 A). Furthermore, the distance traveled by PMNs was reduced by 56%, and their speed by 58% (P < 0.0001, n = 41), evidence that TNF
enhances the conversion of PMN rolling to firm adhesion. This effect was more pronounced when TMLeD/LeD ECs were activated. PMN adhesion was increased an additional 3.1-fold over that observed with activated TMwt/wt ECs. Similar increases in PMN adhesion to TMLeD/LeD ECs were observed under static conditions (Fig. 5 A). Anti-TM antisera, directed against regions within and outside the NH2-terminal domain, increased PMN adhesion to TMwt/wt ECs (P < 0.005) to levels not different from those seen with TMLeD/LeD ECs (P > 0.05). However, the adhesion of PMNs to TMLeD/LeD ECs was unaffected by anti-TM anti-sera.
PMN Adhesion to TMLeD/LeD ECs Is ICAM-1dependent and independent.
To identify adhesion molecules mediating enhanced PMN extravasation in TMLeD/LeD mice, we first determined by flow cytometry that suspensions of ECs from lungs of TMLeD/LeD mice expressed more ICAM-1 (median fluorescence 20.2 vs. 4.8) and VCAM-1 (median fluorescence 2.1 vs. 1.6) than ECs from lungs of TMwt/wt mice (Fig. 6
A). Furthermore, the proportion of ECs from the lungs of TMwt/wt and TMLeD/Led mice staining positive for ICAM-1 was 68% and 98%, respectively, whereas for VCAM-1 it was 38% and 51%, respectively. Western blotting of heart lysates also showed greater expression of these adhesion molecules in TMLeD/LeD mice before and after LPS (Fig. 6 B). In view of the central role that ICAM-1 plays in PMNEC interactions, we characterized the extent of its involvement in PMN adhesion to the TMLeD/LeD ECs in dynamic studies (Fig. 5 B). ICAM-1 blocking did not affect PMN rolling on either TMLeD/LeD or TMwt/wt ECs in the presence or absence of TNF
, nor did it alter adhesion to resting TMwt/wt ECs. After TNF
activation of TMwt/wt ECs, saturating amounts of antiICAM-1 antibodies (25 µg/ml) blocked 72 ± 12% (n = 5) of PMN adhesion. In contrast, antiICAM-1 antibodies only reduced PMN adhesion to resting TMLeD/LeD ECs by 42 ± 4% (n = 4) and not to the level of adhesion seen with resting TMwt/wt ECs. AntiICAM-1 antibodies also only partially blocked PMN adhesion by 40 ± 8% (n = 7) to TNF
-stimulated TMLeD/LeD ECs. Indeed, suppression was not to the level of adhesion seen with activated TMwt/wt ECs. Although these studies suggest that ICAM-1independent adhesion is partly responsible for the increased PMN adhesion to TMLeD/LeD ECs, they also indicate that expression levels of ICAM-1 are significantly higher in TMLeD/LeD ECs than in TMwt/wt ECs under the same conditions (P < 0.03). Blocking both P-selectin and ICAM-1 suppressed PMN adhesion by >90% and rolling by 65% to TNF
-treated ECs from either TMLeD/LeD or TMwt/wt mice, which is evidence that the predominant defect in TMLeD/LeD ECPMN interactions occurs after initial contact and rolling. Recent studies have implicated VCAM-1 in mediating PMN emigration in some models of inflammation (30). Consistent with these observations, in preliminary studies maximal doses of antiVCAM-1 antibodies (25 µg/ml) suppressed TNF-induced PMN adhesion to TMLeD/LeD ECs by
40%. Overall, the results indicate that receptors involved in PMN rolling are intact in TMLeD/LeD ECs and both ICAM-1 and VCAM-1 enhance PMN adhesion to the TMLeD/LeD ECs, but additional ICAM-1 and VCAM-1independent pathways are also active in converting PMN rolling to firm adhesion.
|
Soluble Lectin-like Domain of TM Suppresses ERK1/2 Activation, Interferes with PMN Adhesion to ECs, and Rescues ECs from Serum-deprived Death.
To further evaluate the role of TM in PMN adhesion to ECs, we generated soluble recombinant forms of the molecule comprised of the C-type lectin-like structure in Pichia pastoris (TMlec155) and a GST-fusion protein (GSTTMlec155). In static assays (Fig. 7
A), TMlec155 significantly reduced PMN adhesion to unstimulated TMLeD/LeD ECs to levels observed with unstimulated TMwt/wt ECs, and adhesion to fEND.5 cells to levels below baseline. PMN adhesion to activated TMLeD/LeD ECs or activated fEND.5 cells was suppressed by TMlec155 in a dose-dependent manner. However, PMN adhesion to activated fEND.5 cells could be suppressed to the level observed with nonactivated fEND.5 cells, whereas TMlec155 suppressed adhesion to activated TMLeD/LeD ECs only to the level observed with activated TMwt/wt ECs (Figs. 5 A and 7 A). Although the extent of suppression varied in the cell lines tested, soluble lectin-like domain uniformly interfered with PMN adhesion to the ECs.
|
for 20 min. The accumulation of pERK1/2 and NF-
B were markedly suppressed, although not totally abrogated, by the addition of GST-TMlec155, whereas GST alone had no effect (Fig. 7 B). Total ERK1/2 levels remained unchanged. TMlec155 similarly interfered with TNF
-induced up-regulation of pERK1/2 and NF-
B expression by HUVECs, suggesting that the lectin-like domain of TM suppresses PMN adhesion to ECs via MAP kinase signaling. Because EC death is a pathway of sustained tissue damage, we evaluated whether TMlec155 was capable of rescuing HUVECs from serum starvationinduced cell death. After 3 d of serum deprivation, >95% of HUVECs died. Serum starvation with the addition of TMlec155 at concentrations of 1, 10, and 20 µg/ml rescued 2 ± 0.6%, 18 ± 7%, and 34 ± 14% of the cells (P = 0.69, P < 0.05, and P < 0.05, respectively, compared with serum-starved controls), indicating that soluble TM may also have prosurvival properties.
| Discussion |
|---|
|
|
|---|
Although it has long been recognized that the coagulation system modulates inflammation, only recently has the impact of this contribution been appreciated, and some of the molecular links been established. The PC pathway is particularly relevant (32), a fact highlighted by the demonstration that APC infusion reduces mortality in patients with sepsis (1).
As the critical cofactor for PC activation, TM is an obligate participant in the regulation of inflammation. Cytokines and PMN-derived elastase suppress endothelial TM functional and antigenic expression (33, 34), resulting in decreased APC generation, which contributes to the thrombotic and inflammatory components of coronary atheroma (35). Independent of its role in PC activation, we hypothesized that the NH2-terminal domain of TM might be important in immune defense because of its homology to C-type lectins.
The family of C-type lectins has several members including, for example, the selectins (36) and rat AA4 antigen (37). Through interactions with carbohydrate recognition domains, lectins participate in innate immune functions such as opsonization, complement activation, and leukocyte homing (6, 38). Electron microscopic analysis suggests that the lectin-like domain of TM is globular and well-situated for interactions with other proteins or cells (39), as it is located furthest from the membrane surface. The remarkable similarity between AA4 and TM in terms of their structural organization, cellular distribution, and colocalization of their genes to the same chromosomal region (40) suggests a common ancestry and possibly common functions. However, AA4 promotes leukocyte adhesion (40), whereas TM interferes with PMN adhesion. It will be interesting to explore the possibility that TM and AA4 play opposing roles in inflammation and do so via common interacting proteins/intracellular signaling pathways.
To elucidate the mechanism(s) by which the tissues of TMLed/Led mice accumulate more PMNs, we studied leukocyte trafficking and established that even though TM is expressed by PMNs, monocytes, and ECs (28, 29), the critical determinant regulating PMN adhesion is restricted to the NH2-terminal domain of endothelial TM. Enhanced PMN adhesion to resting TMLeD/LeD ECs suggests that these cells are in a basal proadhesive state, consistent with the findings of excess PMNs in the lungs and increased recruitment of PMNs to nonischemic regions of the hearts of TMLeD/LeD mice. In spite of enhanced firm adhesion to TMLeD/LeD ECs, flow chamber studies indicate that PMN rolling is not affected by lack of the lectin-like domain. Thus, it is possible that the lectin-like domain competes for selectin-mediated outside-in signaling, an event that initiates downstream firm adhesion (41). Consequently, lack of this domain would result in sustained signals and increased expression of proadhesive molecules. ICAM-1, which is higher in the lungs, hearts, and ECs of TMLed/Led mice, clearly contributes to augmented PMN adhesion in TMLed/Led mice. Interestingly, VCAM-1 expression was also augmented in the lungs and hearts of TMLeD/LeD mice. Although VCAM-1 has not traditionally been viewed as a major player in PMN trafficking, recent reports show that
4ß1 (VLA-4) integrin and VCAM-1 may contribute to PMN migration in some tissues in response to specific inflammatory stimuli (30, 42), notably including MI/R. As with antiICAM-1 antibodies, antiVCAM-1 antibodies only partially interfered with PMN adhesion to cytokine-stimulated TMLeD/LeD ECs. These data indicate that VCAM-1 and ICAM-1 mediate, in part, the proinflammatory phenotype of the TMLeD/LeD mice, but also suggest that other adhesion molecules, recruited via signals modulated by the lectin-like domain of TM, contribute to this phenomenon. Additional studies are necessary to explore the relative contribution of these and other proadhesive molecules in specific vascular beds under different inflammatory conditions.
Recent in vitro data indicate that APC mediates intracellular signals that down-regulate NF-
B, ICAM-1, VCAM-1, and E-selectin gene expression (43). The lectin-like domain of TM may function via similar intracellular pathways. Indeed, the lectin-like domain of TM when constitutively expressed on the cell surface, facilitates intracellular signaling that suppresses PMN adhesion. This interaction may be reversed in response to ischemic or inflammatory stimuli if this domain is cleaved by elastase, or expression of TM is down-regulated (14, 44). Lack of the lectin-like domain of TM in the heart and lungs of TMLeD/LeD mice results in the activation of MAP kinase ERK1/2, a signaling pathway that leads to the up-regulation of proinflammatory molecules (31). It is unlikely that the cytoplasmic domain of TM is directly involved in transmitting these signals, because mice lacking this domain do not have an altered cytokine response (unpublished data; reference 11). Alternatively, signaling may occur from the NH2-terminal domain of TM to other associated cell surface or extracellular soluble proteins, or via its transmembrane domain. Similar examples of cross talk between integrins and other membrane receptors have been documented (45).
Because the tertiary structure of TM is unknown, we cannot exclude the possibility that the NH2-terminal domain masks a proadhesive domain on TM. A likely candidate region would be the first two EGF-like repeats, these structures being classically involved in proteinprotein interactions. These EGF-like repeats could provide a receptor site for activated PMNs that is unmasked during inflammation by allosteric changes in the NH2-terminal domain or by its cleavage by proteases released from PMNs. Thus, our finding that exogenous soluble TM decreases activation of ERK1/2, NF-
B, and PMN adhesion could be explained in part by steric interference with the proadhesive effect of the EGF-like repeats.
Extravasation of activated PMNs during MI/R results in tissue injury that may be attenuated by preventing the expression of cell adhesion molecules such as P-selectin, E-selectin, and ICAM-1 (46). Two polymorphisms of TM, one within the sixth EGF-like repeat (A455V; reference 47) and one within the lectin-like domain (Ala25Thr; reference 48), are associated with increased risk of coronary artery disease/myocardial infarction. The increase in infarct size in the TMLed/Led mice after MI/R supports a direct cardioprotective role for the NH2-terminal domain, at least in part by interfering with PMN extravasation and cytokine generation. It is intriguing to consider that soluble TM, either the anticoagulant EGF-containing fractions or those fractions that contain the NH2-terminal domain, might be directly protective, thereby explaining the Atherosclerosis Risk in Communities Study results in which plasma TM levels were inversely correlated with incident coronary heart disease (10). This hypothesis is also supported by a report that soluble human urinary TM, composed of the entire extramembranous portion of TM, prevented hepatic ischemia/reperfusion injury in dogs (49).
Our observation that the lectin-like domain of TM attenuates MAP kinase activation is also interesting in light of clinical data demonstrating an inverse correlation between tumor cell proliferation and TM expression (50). MAP kinase signaling may enhance cellular proliferation by increasing cyclin D1. In tumor models, lack of the NH2-terminal domain of TM enhances cell growth (51), an effect that may reflect augmented MAP kinase activation. The clinical significance of these findings is highlighted by studies demonstrating that soluble TM has thrombin-independent antitumor effects (52).
Our studies show that the NH2-terminal lectin-like domain of TM modulates inflammation by attenuating MAP kinase activation and interfering with PMNEC interactions. We also demonstrate that soluble lectin-like domain enhances cell survival. TM is therefore an example of a highly regulated, multidomain molecule that provides molecular links between several biological systems. Consequently, we predict that mutations in different functional domains of TM produce distinct disease states. Searches have identified TM mutations that are associated with increased thrombotic risk (53, 54), and the Ala25Thr mutation/polymorphism in the lectin-like domain is linked with a higher risk of myocardial infarction (48). Computer modeling indicates that Ala25 is located on an exposed surface of the lectin-like structure. Thus, a mutation at Ala25 could alter the overall hydrophobicity and/or its interaction with other proteins, resulting in a change in function. This finding underlines the importance of considering TM mutations when searching for the etiology of inflammatory/proliferative disorders.
Lastly, the therapeutic potential of these findings cannot be overlooked. Although APC has been shown to provide protection from sepsis, this treatment is not uniformly effective nor is it without a risk of bleeding (1). Studies are underway to determine whether nonanticoagulant forms of soluble TM have therapeutic benefit.
| Acknowledgments |
|---|
G. Theilmeier was supported in part by Innovative Medizinishe Forschung grants TH110023 and IZKF C21.
Submitted: January 16, 2002
Revised: July 11, 2002
Accepted: July 26, 2002
| Footnotes |
|---|
| References |
|---|
|
|
|---|
1 Bernard, G.R., J.L. Vincent, P.F. Laterre, S.P. LaRosa, J.F. Dhainaut, A. Lopez-Rodriguez, J.S. Steingrub, G.E. Garber, J.D. Helterbrand, E.W. Ely, et al. 2001. Efficacy and safety of recombinant human activated protein C for severe sepsis. N. Engl. J. Med. 344:699709.
2 Nawa, K., K. Sakano, H. Fujiwara, Y. Sato, N. Sugiyama, T. Teruuchi, M. Iwamoto, and Y. Marumoto. 1990. Presence and function of chondroitin-4-sulfate on recombinant human soluble thrombomodulin. Biochem. Biophys. Res. Commun. 171:729737.[CrossRef][Medline]
3 Kokame, K., X. Zheng, and J. Sadler. 1998. Activation of thrombin-activatable fibrinolysis inhibitor requires epidermal growth factor-like domain 3 of thrombomodulin and is inhibited competitively by protein C. J. Biol. Chem. 273:1213512139.
4 Suzuki, K., T. Hayashi, J. Nishioka, Y. Kosaka, M. Zushi, G. Honda, and S. Yamamoto. 1989. A domain composed of epidermal growth factor-like structures of human thrombomodulin is essential for thrombin binding and for protein C activation. J. Biol. Chem. 264:48724876.
5 Petersen, T. 1988. The amino-terminal domain of thrombomodulin and pancreatic stone protein are homologous with lectins. FEBS Lett. 231:5153.[CrossRef][Medline]
6 Drickamer, K. 1988. Two distinct classes of carbohydrate-recognition domains in animal lectins. J. Biol. Chem. 263:95579560.
7 Ohlin, A.K., and R.A. Marlar. 1999. Thrombomodulin gene defects in families with thromboembolic diseasea report on four families. Thromb. Haemost. 81:338344.[Medline]
8 Takano, S., S. Kimura, S. Ohdama, and N. Aoki. 1990. Plasma thrombomodulin in health and diseases. Blood. 76:20242029.
9 Yamamoto, S., T. Mizoguchi, T. Tamaki, M. Ohkuchi, S. Kimura, and N. Aoki. 1993. Urinary thrombomodulin, its isolation and characterization. J. Biochem. (Tokyo). 113:433440.
10 Salomaa, V., C. Matei, N. Aleksic, L. Sansores-Garcia, A.R. Folsom, H. Juneja, L.E. Chambless, and K.K. Wu. 1999. Soluble thrombomodulin as a predictor of incident coronary heart disease and symptomless carotid artery atherosclerosis in the Atherosclerosis Risk in Communities (ARIC) Study: a case-cohort study. Lancet. 353:17291734.[CrossRef][Medline]
11 Conway, E.M., S. Pollefeyt, J. Cornelissen, I. DeBaere, M. Steiner-Mosonyi, J.I. Weitz, H. Weiler-Guettler, P. Carmeliet, and D. Collen. 1999. Structure-function analyses of thrombomodulin by gene-targeting in mice: the cytoplasmic domain is not required for normal fetal development. Blood. 93:34423450.
12 Lallemand, Y., B. Luria, R. Haffner-Krausz, and P. Lonai. 1998. Maternally expressed PGK-Cre transgene as a tool for early and uniform activation of the Cre site-specific recombinase. Transgenic Res. 7:105112.[CrossRef][Medline]
13 Conway, E., M. Boffa, B. Nowakowski, and M. Steiner-Mosonyi. 1992. An ultrastructural study of thrombomodulin endocytosis: internalization occurs via clathrin-coated and non-coated pits. J. Cell. Physiol. 151:604612.[CrossRef][Medline]
14 Conway, E.M., and R.D. Rosenberg. 1988. Tumor necrosis factor suppresses transcription of the thrombomodulin gene in endothelial cells. Mol. Cell. Biol. 8:55885592.
15 Kennel, S., T. Lankford, B. Hughes, and J. Hotchkiss. 1988. Quantitation of a murine lung endothelial cell protein, P112, with a double monoclonal antibody assay. Lab. Invest. 59:692701.[Medline]
16 Wagner, E.F., and W. Risau. 1994. Oncogenes in the study of endothelial cell growth and differentiation. Semin. Cancer Biol. 5:137145.[Medline]
17 Mancardi, S., G. Stanta, N. Dusetti, M. Gestagno, L. Jussila, M. Zweyer, G. Lunazzi, D. Dumont, K. Alitalo, and S. Burrone. 1999. Lymphatic endothelial tumors induced by intraperitoneal injection of Freund's adjuvant. Exp. Cell Res. 246:368375.[CrossRef][Medline]
18 Lowell, C.A., and G. Berton. 1998. Resistance to endotoxic shock and reduced neutrophil migration in mice deficient for the Src-family kinases Hck and Fgr. Proc. Natl. Acad. Sci. USA. 95:75807584.
19 Theilmeier, G., T. Lenaerts, C. Remacle, D. Collen, J. Vermylen, and M.F. Hoylaerts. 1999. Circulating activated platelets assist THP-1 monocytoid/endothelial cell interaction under shear stress. Blood. 94:27252734.
20 Orthner, C.L., B. Kolen, and W.N. Drohan. 1993. A sensitive and facile assay for the measurement of activated protein C activity levels in vivo. Thromb. Haemost. 69:441447.[Medline]
21 Weiler-Guettler, H., P. Christie, D. Beeler, A. Healy, W. Hancock, H. Rayburn, J. Edelberg, and R. Rosenberg. 1998. A targeted point mutation in thrombomodulin generates viable mice with a prethrombotic state. J. Clin. Invest. 101:19.[Medline]
22 Marelli-Berg, F.M., E. Peek, E.A. Lidington, H.J. Stauss, and R.I. Lechler. 2000. Isolation of endothelial cells from murine tissue. J. Immunol. Methods. 244:205215.[CrossRef][Medline]
23 Bradley, P.P., D.A. Priebat, R.D. Christensen, and G. Rothstein. 1982. Measurement of cutaneous inflammation: estimation of neutrophil content with an enzyme marker. J. Invest. Dermatol. 78:206209.[CrossRef][Medline]
24 Michael, L.H., M.L. Entman, C.J. Hartley, K.A. Youker, J. Zhu, S.R. Hall, H.K. Hawkins, K. Berens, and C.M. Ballantyne. 1995. Myocardial ischemia and reperfusion: a murine model. Am. J. Physiol. 269:H2147H2154.[Medline]
25 Fishbein, M.C., S. Meerbaum, J. Rit, U. Lando, K. Kanmatsuse, J.C. Mercier, E. Corday, and W. Ganz. 1981. Early phase acute myocardial infarct size quantification: validation of the triphenyl tetrazolium chloride tissue enzyme staining technique. Am. Heart J. 101:593600.[CrossRef][Medline]
26 Jordan, J.E., Z.Q. Zhao, and J. Vinten-Johansen. 1999. The role of neutrophils in myocardial ischemia-reperfusion injury. Cardiovasc. Res. 43:860878.
27 Weiler, H., V. Lindner, B. Kerlin, B. Isermann, S. Hendrickson, B. Cooley, D. Meh, M. Mosesson, N. Shworak, M. Post, et al. 2001. Characterization of a mouse model for thrombomodulin deficiency. Arterioscler. Thromb. Vasc. Biol. 21:15311537.
28 Conway, E., B. Nowakowski, and M. Steiner-Mosonyi. 1992. Human neutrophils synthesize thrombomodulin that does not promote thrombin-dependent protein C activation. Blood. 80:12541263.
29 McCachren, S.S., J. Diggs, J.B. Weinberg, and W.A. Dittman. 1991. Thrombomodulin expression by human blood monocytes and by human synovial tissue lining macrophages. Blood. 78:31283132.
30 Bowden, R.A., Z.M. Ding, E.M. Donnachie, T.K. Petersen, L.H. Michael, C.M. Ballantyne, and A.R. Burns. 2002. Role of
4 integrin and VCAM-1 in CD18-independent neutrophil migration across mouse cardiac endothelium. Circ. Res. 90:562569.
31 Hubbard, A.K., and R. Rothlein. 2000. Intercellular adhesion molecule-1 (ICAM-1) expression and cell signaling cascades. Free Radic. Biol. Med. 28:13791386.[CrossRef][Medline]
32 Esmon, C.T. 2001. Protein C anticoagulant pathway and its role in controlling microvascular thrombosis and inflammation. Crit. Care Med. 29:S48S52.[CrossRef][Medline]
33 Nawroth, P., and D. Stern. 1986. Modulation of endothelial cell hemostatic properties by tumor necrosis factor. J. Exp. Med. 163:740745.
34 Glaser, C., J. Morser, J. Clarke, E. Blasko, K. McLean, I. Kuhn, R.-J. Chang, J.-H. Lin, L. Vilander, W. Andrews, et al. 1992. Oxidation of a specific methionine in thrombomodulin by activated neutrophil products blocks cofactor activity. J. Clin. Invest. 90:25652573.[Medline]
35 Laszik, Z.G., X.J. Zhou, G.L. Ferrell, F.G. Silva, and C.T. Esmon. 2001. Down-regulation of endothelial expression of endothelial cell protein C receptor and thrombomodulin in coronary atherosclerosis. Am. J. Pathol. 159:797802.
36 Galustian, C., A. Lubineau, C. le Narvor, M. Kiso, G. Brown, and T. Feizi. 1999. L-selectin interactions with novel mono- and multisulfated LewisX sequences in comparison with the potent ligand 3'-sulfated Lewisa. J. Biol. Chem. 274:1821318217.
37 Dean, Y.D., E.P. McGreal, H. Akatsu, and P. Gasque. 2000. Molecular and cellular properties of the rat AA4 antigen, a C-type lectin-like receptor with structural homology to thrombomodulin. J Biol. Chem. 275:3438234392.
38 Vasta, G.R., M. Quesenberry, H. Ahmed, and N. O'Leary. 1999. C-type lectins and galectins mediate innate and adaptive immune functions: their roles in the complement activation pathway. Dev. Comp. Immunol. 23:401420.[CrossRef][Medline]
39 Weisel, J.W., C. Nagaswami, T.A. Young, and D.R. Light. 1996. The shape of thrombomodulin and interactions with thrombin as determined by electron microscopy. J. Biol. Chem. 271:3148531490.
40 Dean, Y.D., E.P. McGreal, and P. Gasque. 2001. Endothelial cells, megakaryoblasts, platelets and alveolar epithelial cells express abundant levels of the mouse AA4 antigen, a C-type lectin-like receptor involved in homing activities and innate immune host defense. Eur. J. Immunol. 31:13701381.[CrossRef][Medline]
41 Crockett-Torabi, E. 1998. Selectins and mechanisms of signal transduction. J. Leukoc. Biol. 63:114.[Abstract]
42 Burns, J.A., T.B. Issekutz, H. Yagita, and A.C. Issekutz. 2001. The alpha 4 beta 1 (very late antigen (VLA)-4, CD49d/CD29) and alpha 5 beta 1 (VLA-5, CD49e/CD29) integrins mediate beta 2 (CD11/CD18) integrin-independent neutrophil recruitment to endotoxin-induced lung inflammation. J. Immunol. 166:46444649.
43 Joyce, D.E., L. Gelbert, A. Ciaccia, B. DeHoff, and B.W. Grinnell. 2001. Gene expression profile of antithrombotic protein c defines new mechanisms modulating inflammation and apoptosis. J. Biol. Chem. 276:1119911203.
44 Hirokawa, K., and N. Aoki. 1991. Regulatory mechanisms for thrombomodulin expression in human umbilical vein endothelial cells in vitro. J. Cell. Physiol. 147:157165.[CrossRef][Medline]
45 Porter, J.C., and N. Hogg. 1998. Integrins take partners: cross-talk between integrins and other membrane receptors. Trends Cell Biol. 8:390396.[CrossRef][Medline]
46 Jones, S.P., S.D. Trocha, M.B. Strange, D.N. Granger, C.G. Kevil, D.C. Bullard, and D.J. Lefer. 2000. Leukocyte and endothelial cell adhesion molecules in a chronic murine model of myocardial reperfusion injury. Am. J. Physiol. Heart Circ. Physiol. 279:H2196H2201.
47 Wu, K.K., N. Aleksic, C. Ahn, E. Boerwinkle, A.R. Folsom, and H. Juneja. 2001. Thrombomodulin Ala455Val polymorphism and risk of coronary heart disease. Circulation. 103:13861389.
48 Doggen, C.J., G. Kunz, F.R. Rosendaal, D.A. Lane, H.L. Vos, P.J. Stubbs, V. Manger Cats, and H. Ireland. 1998. A mutation in the thrombomodulin gene, 127G to A coding for Ala25Thr, and the risk of myocardial infarction in men. Thromb. Haemost. 80:743748.[Medline]
49 Kaneko, H., N. Joubara, M. Yoshino, K. Yamazaki, A. Mitumaru, Y. Miki, H. Satake, and T. Shiba. 2000. Protective effect of human urinary thrombomodulin on ischemia-reperfusion injury in the canine liver. Eur. Surg. Res. 32:8793.[CrossRef][Medline]
50 Hamatake, M., T. Ishida, T. Mitsudomi, K. Akazawa, and K. Sugimachi. 1996. Prognostic value and clinicopathological correlation of thrombomodulin in squamous cell carcinoma of the human lung. Clin. Cancer Res. 2:763766.[Abstract]
51 Zhang, Y., H. Weiler-Guettler, J. Chen, O. Wilhelm, Y. Deng, F. Qiu, K. Nakagawa, M. Klevesath, S. Wilhelm, H. Bohrer, et al. 1998. Thrombomodulin modulates growth of tumor cells independent of its anticoagulant activity. J. Clin. Invest. 101:13011309.[Medline]
52 Hosaka, Y., T. Higuchi, M. Tsumagari, and H. Ishii. 2000. Inhibition of invasion and experimental metastasis of murine melanoma cells by human soluble thrombomodulin. Cancer Lett. 161:231240.[CrossRef][Medline]
53 Ireland, H., G. Kunz, K. Kyriakoulis, P.J. Stubbs, and D.A. Lane. 1997. Thrombomodulin gene mutations associated with myocardial infarction. Circulation. 96:1518.
54 Kunz, G., H.A. Ireland, P.J. Stubbs, M. Kahan, G.C. Coulton, and D.A. Lane. 2000. Identification and characterization of a thrombomodulin gene mutation coding for an elongated protein with reduced expression in a kindred with myocardial infarction. Blood. 95:569576.
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|