|
||
Brief Definitive Report |
Address correspondence to Dr. Gabriela S. Dveksler, Department of Pathology, USUHS, 4301 Jones Bridge Rd., Bethesda, MD 20814-4799. Phone: 301-295-3332; Fax: 301-295-1640; E-mail: gdveksler{at}usuhs.mil
| Abstract |
|---|
|
|
|---|
Key Words: tetraspanins macrophages expression cloning placenta PSG
| Introduction |
|---|
|
|
|---|
Despite their isolation from maternal serum 30 years ago, the receptor(s) for these proteins has not yet been identified. PSGs have also been identified in nonprimates with hemochorial placentation including rats and mice. There are 14 murine PSG genes (PSG1429; reference 7) and the cDNAs that have been characterized showed exclusive expression by the placenta (8).
We recently reported that murine PSG17 and PSG18 mimic the biological effects of human PSGs, by inducing cytokines in murine macrophages and the RAW 264.7 macrophage cell line (9) and unpublished data. In addition, we showed that PSG17 binds to RAW cells with high affinity (unpublished data). For the purpose of cloning the PSG17 receptor, we screened a RAW cell cDNA expression library by panning. Positive clones were sequenced, and database queries revealed that the receptor for PSG17 is the tetraspanin CD9.
Sequence analysis of CD9 suggests that like other tetraspanins, it has four hydrophobic transmembrane domains and two extracellular loops, with two short intracytoplasmic tails at the amino and carboxyl termini (10, 11). In the membrane, CD9 associates with other tetraspanin family members (12, 13) and with ß1 integrins (1417). Other cell surface molecules present in tetraspanin complexes include HLA-DR and MHC class II glycoproteins, CD4, CD8, CD19, and a 135-kD protein designated CD9 partner 1 (12, 13, 1821). Treatments with Abs to different tetraspanins have implicated these proteins in cell migration, proliferation, activation, and adhesion (18). With such potentially diverse roles, they have been described as "molecular facilitators." This is the first report to identify the binding partner for a PSG family member, as well as a biological ligand for a member of the tetraspanin superfamily.
| Materials and Methods |
|---|
|
|
|---|
The murine CD53 and CD82 cDNAs were amplified by reverse transcription (RT)-PCR from RAW cell RNA and the murine CD81 cDNA was amplified from pBluescript containing the CD81 cDNA. The primer sets used for the amplifications were: for CD53: 5'ATGGGCATGAGCAGCCTGAAA and 5'TCACAGCCCTAAAGCCTGGC; for CD82: 5'CAGAATGGGGGCAGGCTGTG and 5'CAGCAACCTCAGTACTTGGGG; for CD81: 5'ATGGGGGTGGAGGGCTGC and 5'TCAGTACACGGAGCTGTTCCGG. After amplification with Vent DNA polymerase, the cDNAs were cloned into pEF6/V5-His Topo (Invitrogen), colonies were probed with oligonucleotides specific for each tetraspanin and the correct orientation was confirmed. The murine CD151 cDNA in pcDNA3.1 Zeo was obtained from Dr. L. Ashman, The Hanson Centre for Cancer Research, Adelaide, Australia, and the murine CD63 cDNA in pcDNA3.1/GS was purchased from Research Genetics.
PSG17N-Myc-Hiscoated plates were prepared as follows. Bacteriological culture dishes were layered with 10 µg/ml goat antimouse IgG, extra serum absorbed (XSA; KPL) in phosphate coating solution (KPL). The plates were rinsed with PBS and blocked with BSA buffer (KPL). Anti-myc mAb (1 µg/ml) (Invitrogen) was added to each dish followed by the addition of PSG17N-Myc-His with washes after each step.
Cell Culture.
RAW 264.7 (American Type Culture Collection) cells were cultured in DMEM with high glucose, 5 mM sodium pyruvate (Irvine Scientific), 100 U/ml penicillin, 100 µg/ml streptomycin, 0.25 µg/ml amphotericin B (PSA; Quality Biological), and 10% fetal bovine serum (FBS). Human embryonic kidney (HEK) 293T cells (Edge BioSystems) were cultured in DMEM, 10% FBS, 50 µg/ml gentamicin, 250 µg/ml G418 (Calbiochem), and PSA. HEK 293 EBNA cells (Invitrogen) were grown in DMEM, 10% FBS, PSA, and 250 µg/ml G418. Baby hamster kidney (BHK)21 cells (American Type Culture Collection) were sustained in DMEM with 10% FBS and PSA. All cell cultures were maintained at 37°C in a humidified atmosphere containing 5% CO2.
Generation of the RAW 264.7 cDNA Library and Recovery of cDNA Clones by Panning.
RNA was extracted from RAW 264.7 cells using TRIzol (Invitrogen) and was used to generate the cDNA expression library in the PEAK10CV vector (Edge BioSystems). The unamplified library yielded
4.3 x 106 primary transformants. For the first round of screening, 1.1 x 106 clones were plated on Luria-Bertani (LB) broth/agar plates with 100 µg/ml ampicillin (Sigma-Aldrich). After 16 h the plates were flooded with LB broth, the pooled bacteria were pelleted, and plasmid DNA was isolated.
Pooled purified plasmids from the library were transfected into HEK 293 EBNA cells. Positive transfectants were selected using 0.5 µg/ml puromycin (Edge BioSystems). At 72 h after selection, the cells were dislodged in PBS and 0.5 mM EDTA, and resuspended in binding buffer (PBS, 2% BSA). The detached cells were panned in PSG17N-Myc-His coated Petri dishes at 1.01.5 x 107 cells per dish. Non-adherent cells were removed by extensive washing with PBS/BSA and adherent cells were transferred to poly-L-lysine coated 96-well plates. An additional two rounds of panning were performed before the episomal plasmids were isolated and transformed into ElectroMAXTM DH10B cells (Invitrogen). Individual plasmids were purified and transfected into HEK 293T cells, after which the transfected cells were screened for their ability to bind PSG17N-Myc-His by ELISA (see below). Inserts from the plasmids that conferred PSG17N binding were sequenced with the ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit (PE Biosystems).
Detection of PSG17 Binding to Transfected HEK 293T Cells by ELISA.
HEK 293T cells were seeded in poly-L-lysine coated 96-well plates at 5 x 104 cells per well and transiently transfected with plasmid DNA recovered after library screening as described above or encoding the CD53, CD63, CD81, CD82, or CD151 cDNAs. At 48 h after transfection, the cells were washed with binding buffer containing 0.01% sodium azide and PSG17N-Myc-His (10 µg/ml) or no ligand was added to each well. After 1 h of incubation at room temperature, the ligand was aspirated and the cells were washed five times with binding buffer without sodium azide. To detect binding of PSG17N-Myc-His, anti-myc-horseradish peroxidase (HRP)-conjugated mAb was added to the cells for 1 h at room temperature at a concentration of 1 µg/ml in binding buffer. Binding of the antibody to the ligand was detected after the addition of tetramethylbenzidine (TMB)-peroxidase substrate (KPL) followed by 2 N H2SO4. The color change was quantitated at 450 nm on a microplate spectrophotometer.
Competition experiments were performed in CD9-pEF6/V5-His (Invitrogen) transfected HEK 293T cells by adding increasing concentrations of anti-murine CD9 mAb KMC8.8 (BD PharMingen) or an isotype-matched control (rat IgG2a) for 1 h at room temperature before treatment with 5 µg/ml PSG17N. Absorbance was normalized to background binding of PSG17N in the presence of anti-CD9 mAb to empty plasmid transfected HEK 293T cells.
In Situ Rosetting Assay.
For the in situ rosetting assay, HEK 293T cells transiently transfected with empty vector or CD9-pEF6/V5-His were seeded at low density into poly-L-lysine coated 60-mm dishes (Becton Dickinson). Attached cells were washed in binding buffer (PBS-2% BSA). PSG17N-Myc-His (90 pM) or binding buffer alone was added to the dishes for 1 h at room temperature. The cells were washed four times with PBS to remove any unbound ligand before the addition of 1 µg/ml anti-myc mAb in binding buffer for 1 h at room temperature. As a control, the anti-myc mAb was omitted from some plates. Dishes were washed again with PBS before the addition of 15 µg of rabbit antimouse Ig coated beads (Bio-Rad Laboratories). Unbound beads were removed by washing extensively with PBS and receptor positive cells were viewed by microscopy.
Flow Cytometry.
HEK 293T or BHK-21 cells were transfected with murine CD9-pEF/V5-His or empty vector. 48 h after transfection, the cells were washed twice with wash buffer (PBS; 3% FBS; 0.01% sodium azide), before the addition of 10 µg PSG17N-Myc-His for 30 min at room temperature. After two washes, cells were sequentially incubated for 30 min on ice with 0.5 µg anti-myc mAb (Invitrogen), 0.5 µg biotin-labeled goat antimouse IgG2a
(BD PharMingen) and 0.5 µg streptavidin- FITC (BD PharMingen) with two washes between each incubation. For inhibition experiments, 106 RAW 264.7 cells were preincubated with 1 µg of Fc block (BD PharMingen) and various concentrations of anti-CD9 mAb or isotype control mAb for 30 min on ice. After several washes, 2 µg of PSG17N-Myc-His were added to each tube followed by 0.7 µg of anti-myc mAb, and PE-labeled rat antimouse IgG1 (BD PharMingen). Binding of PSG17N-Myc-His to thioglycollate-induced peritoneal macrophages isolated from CD9-deficient mice or wild-type mice was determined after 24 h treatment of the macrophages with 10 ng/ml PMA followed by incubation with Fc block, PSG17N or a control myc-tagged protein, anti-myc mAb, and PE-labeled rat antimouse IgG1 as described above for the RAW cells. PSG17N binding to HEK 293T, BHK 21, RAW 264.7 cells and macrophages was analyzed by flow cytometry using an EPICS XL-MCL flow cytometer (Beckman Coulter) and the percent binding was determined with the System II Software program (Beckman Coulter). Overlays were produced with the WinList program (Verity Software House).
Alkaline Phosphatase Binding Assays.
The PSG17-alkaline phosphatase (PSG17-AP) fusion protein was generated by cloning the full length PSG17 cDNA into the AP-Tag 4 vector. CD9 binding assays with heat stable AP-PSG17 were performed as described by Flanagan and Cheng (22). Briefly, HEK 293T cells transiently transfected with murine CD9 or empty vector were cultured in poly-L-lysinecoated six-well plates. Increasing concentrations (43, 86, and 129 nM) of AP-PSG17 or the AP control protein were added to each well in triplicate for 90 min at room temperature. The cells were thoroughly washed, and the concentration of bound protein was measured from cleared, heat-inactivated cell lysates with dephosphorylation of p-nitrophenyl phosphate, which was quantitated by absorption at 405 nm using an ELISA plate reader.
| Results and Discussion |
|---|
|
|
|---|
To confirm binding of PSG17 to CD9, CD9-pEF6/V5-Histransfected HEK 293T cell were treated with PSG17N-Myc-His and analyzed by ELISA. PSG17N-Myc-His was shown to bind CD9-transfected cells in a dose response manner with a binding plateau at 10 µg/ml (Fig. 1 A). Rosetting experiments further confirmed binding of PSG17N-Myc-His to CD9. CD9-pEF6/V5-Histransfected cells treated with PSG17N-Myc-His and anti-myc mAb followed by rabbit antimouse Ig immunobeads showed a rosetting pattern. This pattern was not observed in the control dishes, lacking PSG17N treatment, anti-myc mAb, or expression of CD9 (data not shown).
|
|
97%) compared with controls (<5%) suggesting that CD9 expression may be sufficient for PSG17N binding in any cell type (Fig. 2 B).
Binding of Alkaline Phosphatase-PSG17 (AP-PSG17) to CD9-expressing Cells.
For the library screening and the binding experiments described above we used a truncated form of PSG17 consisting only of the N1-domain. We examined binding of the full length PSG17 to murine CD9 using a rAP-PSG17 fusion protein. HEK 293T cells transiently transfected with CD9-pEF6/V5-His were treated with increasing concentrations of AP-PSG17 or an AP control protein (Table I). AP-PSG17 binding to CD9 transfected cells was concentration dependent while binding of the AP-control protein remained at baseline levels.
|
CD9 Is the Receptor for PSG17 in RAW 264.7 Cells and Macrophages.
Scatchard analysis revealed that PSG17 has a single binding site in RAW 264.7 cells and murine macrophages (unpublished data). To determine whether this binding site is CD9, RAW 264.7 cells were pretreated with anti-CD9 mAb KMC8.8 or an isotype match control mAb before the addition of PSG17N-Myc-His and binding was determined by flow cytometry. Preincubation with 40 µg/ml of anti-CD9 mAb resulted in a significant reduction in median fluorescence intensity when compared with the median fluorescence intensity of the cells pretreated with the control isotype match mAb (Fig. 3). In addition, the extent of the inhibition of PSG17 binding to RAW 264.7 cells by the anti-CD9 mAb was dependent on the concentration of the anti-CD9 mAb employed (data not shown).
|
|
receptors in murine macrophages has been reported (25). CD9-/- have reduced female fertility linked to a defect in egg/sperm fusion (26, 27). CD9-/- mice produce some viable fetuses, indicating that CD9 is important for fertilization but is not essential for pregnancy success. Whether all murine PSGs use CD9 as their cellular receptor remains to be investigated. Different murine PSGs may have evolved to use different receptors and no single PSG may be essential for pregnancy success. In addition, we anticipate that pregnancy complications associated with lack of PSG-mediated cytokine secretion would be demonstrated in matings of mice with different genetic backgrounds.
Because CD9 is expressed in several cells of the immune system, including: macrophages, dendritic cells (data not shown), and T cells (28), PSGs have a potential role in regulating both the innate as well as the adaptive immune responses during pregnancy.
| Acknowledgments |
|---|
This work was supported by Grant HD35832 from the National Institutes of Health.
Submitted: October 16, 2001
Accepted: November 12, 2001
| References |
|---|
|
|
|---|
1
Bohn, H. 1971. Detection and characterization of pregnancy proteins in the human placenta and their quantitative immunochemical determination in sera from pregnant women. Arch. Gynakol. 210:440457.[CrossRef][Medline]
2
Lin, T.M., S.P. Halbert, and W.N. Spellacy. 1974. Measurement of pregnancy-associated plasma proteins during human gestation. J. Clin. Invest. 54:576582.
3
Arnold, L.L., T.M. Doherty, A.W. Flor, J.A. Simon, J.Y. Chou, W.Y. Chan, and B.C. Mansfield. 1999. Pregnancy-specific glycoprotein gene expression in recurrent aborters: a potential correlation to interleukin-10 expression. Am. J. Reprod. Immunol. 41:174182.
4
Silver, R.M., K.D. Heyborne, and K.K. Leslie. 1993. Pregnancy specific beta 1 glycoprotein (SP-1) in maternal serum and amniotic fluid; pre-eclampsia, small for gestational age fetus and fetal distress. Placenta. 14:583589.[CrossRef][Medline]
5
Bohn, H., and E. Weinmann. 1974. Immunological disruption of implantation in monkeys with antibodies to human pregnancy specific beta 1-glycoprotein (SP1) (author's transl). Arch. Gynakol. 217:209218.[Medline]
6
Snyder, S., D. Wessner, J. Wessells, R. Waterhouse, L.M. Wahl, W. Zimmermann, and G. Dveksler. 2001. Pregnancy-specific glycoproteins function as immunomodulators by inducing secretion of IL-10, IL-6 and TGF-Beta1 by human monocytes. AJRI. 45:205216.
7
Rudert, F., A.M. Saunders, S. Rebstock, J.A. Thompson, and W. Zimmermann. 1992. Characterization of murine carcinoembryonic antigen gene family members. Mamm. Genome. 3:262273.[CrossRef][Medline]
8
Kromer, B., D. Finkenzeller, J. Wessels, G. Dveksler, J. Thompson, and W. Zimmermann. 1996. Coordinate expression of splice variants of the murine pregnancy-specific glycoprotein (PSG) gene family during placental development. Eur. J. Biochem. 242:280287.[Medline]
9
Wessells, J., D. Wessner, R. Parsells, K. White, D. Finkenzeller, W. Zimmermann, and G. Dveksler. 2000. Pregnancy-specific glycoprotein 18 induces IL-10 expression in murine macrophages. Eur. J. Immunol. 30:18301840.[CrossRef][Medline]
10
Boucheix, C., P. Benoit, P. Frachet, M. Billard, R.E. Worthington, J. Gagnon, and G. Uzan. 1991. Molecular cloning of the CD9 antigen. A new family of cell surface proteins. J. Biol. Chem. 266:117122.
11
Lanza, F., D. Wolf, C.F. Fox, N. Kieffer, J.M. Seyer, V.A. Fried, S.R. Coughlin, D.R. Phillips, and L.K. Jennings. 1991. cDNA cloning and expression of platelet p24/CD9. Evidence for a new family of multiple membrane-spanning proteins. J. Biol. Chem. 266:1063810645.
12
Horvath, G., V. Serru, D. Clay, M. Billard, C. Boucheix, and E. Rubinstein. 1998. CD19 is linked to the integrin-associated tetraspans CD9, CD81, and CD82. J. Biol. Chem. 273:3053730543.
13
Rubinstein, E., F. Le Naour, C. Lagaudriere-Gesbert, M. Billard, H. Conjeaud, and C. Boucheix. 1996. CD9, CD63, CD81, and CD82 are components of a surface tetraspan network connected to HLA-DR and VLA integrins. Eur. J. Immunol. 26:26572665.[Medline]
14
Hirano, T., T. Higuchi, M. Ueda, T. Inoue, N. Kataoka, M. Maeda, H. Fujiwara, and S. Fujii. 1999. CD9 is expressed in extravillous trophoblasts in association with integrin alpha3 and integrin alpha5. Mol. Hum. Reprod. 5:162167.
15
Baudoux, B., D. Castanares-Zapatero, M. Leclercq-Smekens, N. Berna, and Y. Poumay. 2000. The tetraspanin CD9 associates with the integrin alpha6beta4 in cultured human epidermal keratinocytes and is involved in cell motility. Eur. J. Cell Biol. 79:4151.[CrossRef][Medline]
16
Park, K.R., T. Inoue, M. Ueda, T. Hirano, T. Higuchi, M. Maeda, I. Konishi, H. Fujiwara, and S. Fujii. 2000. CD9 is expressed on human endometrial epithelial cells in association with integrins alpha(6), alpha(3) and beta(1). Mol. Hum. Reprod. 6:252257.
17
Rubinstein, E., V. Poindessous-Jazat, F. Le Naour, M. Billard, and C. Boucheix. 1997. CD9, but not other tetraspans, associates with the beta1 integrin precursor. Eur. J. Immunol. 27:19191927.[Medline]
18
Maecker, H.T., S.C. Todd, and S. Levy. 1997. The tetraspanin superfamily: molecular facilitators. FASEB J. 11:428442.[Abstract]
19
Serru, V., P. Dessen, C. Boucheix, and E. Rubinstein. 2000. Sequence and expression of seven new tetraspans. Biochim. Biophys. Acta. 1478:159163.[CrossRef][Medline]
20
Angelisova, P., I. Hilgert, and V. Horejsi. 1994. Association of four antigens of the tetraspans family (CD37, CD53, TAPA- 1, and R2/C33) with MHC class II glycoproteins. Immunogenetics. 39:249256.[Medline]
21
Charrin, S., F. Le Naour, M. Oualid, M. Billard, G. Faure, S.M. Hanash, C. Boucheix, and E. Rubinstein. 2001. The major CD9 and CD81 molecular partner. Identification and characterization of the complexes. J. Biol. Chem. 276:1432914337.
22
Flanagan, J.G., and H.J. Cheng. 2000. Alkaline phosphatase fusion proteins for molecular characterization and cloning of receptors and their ligands. Methods Enzymol. 327:198210.[Medline]
23
Yauch, R.L., and M.E. Hemler. 2000. Specific interactions among transmembrane 4 superfamily (TM4SF) proteins and phosphoinositide 4-kinase. Biochem. J. 351:629637.
24
Zhang, X.A., A.L. Bontrager, and M.E. Hemler. 2001. Transmembrane-4 superfamily proteins associate with activated protein kinase C (PKC) and link PKC to specific beta(1) integrins. J. Biol. Chem. 276:2500525013.
25
Kaji, K., S. Takeshita, K. Miyake, T. Takai, and A. Kudo. 2001. Functional association of CD9 with the Fc gamma receptors in macrophages. J. Immunol. 166:32563265.
26
Le Naour, F., E. Rubinstein, C. Jasmin, M. Prenant, and C. Boucheix. 2000. Severely reduced female fertility in CD9-deficient mice. Science. 287:319321.
27
Miyado, K., G. Yamada, S. Yamada, H. Hasuwa, Y. Nakamura, F. Ryu, K. Suzuki, K. Kosai, K. Inoue, A. Ogura, et al. 2000. Requirement of CD9 on the egg plasma membrane for fertilization. Science. 287:321324.
28
Tai, X.G., Y. Yashiro, R. Abe, K. Toyooka, C.R. Wood, J. Morris, A. Long, S. Ono, M. Kobayashi, T. Hamaoka, et al. 1996. A role for CD9 molecules in T cell activation. J. Exp. Med. 184:753758.
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|