Published online 28 May 2002 doi:10.1084/jem.20020207
© Rockefeller University Press, 0022-1007/2002/6/1507/ $5.00
The Journal of Experimental Medicine, Volume 195, Number 11, June 3, 2002 1507-1512
Interferon-
and Interleukin-12 Are Induced Differentially by Toll-like Receptor 7 Ligands in Human Blood Dendritic Cell Subsets
Tomoki Ito1,
Ryuichi Amakawa1,
Tsuneyasu Kaisho2,4,
Hiroaki Hemmi2,3,
Kenichirou Tajima1,
Kazutaka Uehira1,
Yoshio Ozaki1,
Hideyuki Tomizawa5,
Shizuo Akira2,3 and
Shirou Fukuhara1
1 First Department of Internal Medicine, Kansai Medical University, Osaka 570-8506, Japan
2 Department of Host Defense, Research Institute for Microbial Diseases, Osaka University
3 Solution-oriented Research for Science and Technology, Japan Science and Technology Corporation, Osaka 565-0871, Japan
4 RIKEN Research Center for Allergy and Immunology, Kanagawa 230-0045, Japan
5 Pharmaceuticals and Biotechnology Laboratory, Japan Energy Corporation, Saitama 335-8502, Japan
Address correspondence to Ryuichi Amakawa, First Department of Internal Medicine, Kansai Medical University, 10-15 Fumizono-cho, Moriguchi City, Osaka 570-8506, Japan. Phone: 81-6-6993-9453; Fax: 81-6-6994-8344; E-mail: amakawa{at}takii.kmu.ac.jp
 |
Abstract
|
|---|
Dendritic cells (DCs) play a crucial role in the immune responses against infections by sensing microbial invasion through toll-like receptors (TLRs). In humans, two distinct DC subsets, CD11c- plasmacytoid DCs (PDCs) and CD11c+ myeloid DCs (MDCs), have been identified and can respond to different TLR ligands, depending on the differential expression of cognate TLRs. In this study, we have examined the effect of TLR-7 ligands on human DC subsets. Both subsets expressed TLR-7 and could respond to TLR-7 ligands, which enhanced the survival of the subsets and upregulated the surface expression of costimulatory molecules such as CD40, CD80, and CD86. However, the cytokine induction pattern was distinct in that PDCs and MDCs produced interferon (IFN)-
and interleukin (IL)-12, respectively. In response to TLR-7 ligands, the Th1 cell supporting ability of both DC subsets was enhanced, depending on the cytokines the respective subsets produced. This study demonstrates that TLR-7 exerts its biological effect in a DC subset-specific manner.
Key Words: immunity cytokines imidazoquinolines pathogen-associated molecular patterns Th cell responses
 |
Introduction
|
|---|
Dendritic cells (DCs) sense the presence of invading pathogens, engulf the pathogens, and degrade them intracellularly. The function of DCs is not primarily to destroy pathogens, but to prime naive T cells as professional APCs, thereby linking innate and adaptive immunity (1, 2). However, it remains unknown how DCs regulate the quality of T cell responses. Th cell development is mainly regulated by DC-derived cytokines, such as IL-12 or IFN-
/ß (2, 3). Therefore, it is important to clarify how cytokine production is regulated in the DCs. Recent progress in DC biology has suggested that cytokine production depends either on DC subsets (lineage model) or on stimuli that DCs receive (instruction model) (4).
Toll-like receptors (TLRs) are type I transmembrane proteins that are expressed on APCs including macrophages and DCs, and respond to pathogen-associated molecular patterns (PAMPs) (59). After pathogen recognition, TLR signaling can activate APCs to induce inflammatory cyto-kines and upregulation of costimulatory molecules (714). Expression of TLR family members (TLR-110) was investigated on two human blood DC subsets (1214), CD11c- plasmacytoid DCs (PDCs) and CD11c+ myeloid DCs (MDCs). Each subset expresses a different repertoire of TLRs. For example, MDCs and PDCs express TLR-4 and TLR-9, respectively (13, 14). In accordance with their TLR expression, they can respond to the respective TLR ligands, LPS, or CpG DNA (1214). These studies suggest that cytokine production is determined by TLR expression on DCs.
It has recently been demonstrated that imidazoquinoline compounds, imiquimod, and its derivative, R-848, are specific ligands for TLR-7 (15). TLR-7 ligands, imidazoquinoline compounds, have potent antiviral and antitumor properties in animals (1619). In fact, imiquimod has been clinically approved for the treatment of genital warts caused by human papillomavirus (20). In this study, we investigate the biological effects of TLR-7 ligands on human blood DC subsets, and show that (i) TLR-7 ligands are capable of affecting both PDCs and MDCs to enhance their survival and to upregulate costimulatory molecules, and that (ii) TLR-7 signaling selectively facilitates IFN-
production from PDCs and IL-12 production from MDCs, resulting in induction of Th1 balance. These results suggest that the cytokine induction pattern in response to TLR-7 ligands is determined not only by TLR-7 expression but also by cell lineage.
 |
Materials and Methods
|
|---|
Media and Reagents.
RPMI 1640 supplemented with 2 mM L-glutamine, 100 U/ml penicillin, 100 ng/ml streptomycin, and heat-inactivated 10% FCS (Irvine Scientific) was used for the cell culture throughout the experiments. Imiquimod (R-837) and R-848 were synthesized in Pharmaceuticals and Biotechnology Laboratory, Japan Energy Corporation (Saitama, Japan). CpG-oligodeoxynucleotides (ODNs), phosphorothioate form: 2006 (TCGTCGTTTTGTCGTTTTGTCGTT) and phosphodiester form: AAC-30 (ACCGATAACGTTGCCGGTGACGGCACCACG) were purchased from Hokkaido System Science. ODN 2006 and AAC-30 were used at concentrations of 10-6 M and 5 x 10-6 M, respectively. LPS (Salmonella typhimurium) (1 µg/ml) was purchased from Sigma-Aldrich. UV-irradiated Sendai virus (SV) (HVJ: Cantell strain, provided by Sumitomo Pharmaceuticals was used at 5 hemagglutinating U/ml. Recombinant human cytokines, GM-CSF (used at a concentration of 100 ng/ml) and IL-3 (at 10 ng/ml) were purchased from PeproTech EC.
Isolation of Blood DC Subsets.
Peripheral blood DC subsets (MDCs and PDCs) were isolated according to the modified protocol, as described previously (21, 22). Briefly, the DC-enriched population (CD4+/CD3-/CD14- cells) was obtained from PBMCs by negative and subsequent positive immunoselections. The CD11c+/lineage-/DR+ cells (MDCs) and CD11c-/lineage-/DR+ cells (PDCs) were sorted by an EPICS ALTRA® flow cytometer (Beckman Coulter) by using PE-labeled anti-CD11c (Leu-M5; Becton Dickinson), mixture of FITC-labeled mAbs against lineage markers, CD3 (M2AB; Exalpha), CD14 (FWKW-1; Exalpha), CD15 (Leu-M1; Becton Dickinson), CD16 (J5511; Exalpha), CD19 (SJ25C1; Becton Dickinson), and CD56 (NCAM16.2; Becton Dickinson), and allophycocyanin (APC)-labeled HLA-DR (Tü36; Becton Dickinson). Blood CD14+ CD16- monocytes were purified from PBMCs stained with PE-labeled anti-CD16 (J5511) and FITC-labeled CD14 (FWKW-1) by cell sorting. The purity of each group of cells was >98%.
Analyses of Cultured DCs.
The sorted blood DC subsets or PBMCs were cultured in 96-well, round-bottomed tissue culture plates at 3x104 cells in 200 µl of medium per well for 24 h. In the viability assay, viable cells were evaluated as annexin V-negative fractions using annexin V-FITC Apoptosis Detection kit (Genzyme) after cell debris was excluded by an appropriate forward scatter threshold. To analyze the expression of costimulatory molecules, the culture cells were stained with FITC-labeled anti-CD40 (5C3; BD PharMingen), CD86 (2331; BD PharMingen), or CD80 (BB-1; Ancell) and analyzed by a FACScanTM (Becton Dickinson). The production of cytokines in the culture supernatants was determined by ELISA 24 h later (kits for IL-12 p40+p70 and IFN-
were purchased from Endogen).
DCT Cell Coculture.
CD4+/CD45RA+ naive T cells were obtained from allogeneic healthy volunteers using CD4+ T cell Isolation kit (GmbH; Miltenyi Biotec) followed by positive selection with CD45RA-conjugated microbeads (Miltenyi Biotec). The purity of the cells was 95% or greater by reanalysis. MDC and PDC preincubated with GM-CSF, IL-3, or R-848 (10-6 M) for 24 h were washed and then cocultured with allogeneic CD4+/CD45RA+ naive T cells (105 cells per well, DCT ratio, 1:5) for 7 d in 96-well, round-bottomed tissue culture plates. In some experiments, neutralizing goat polyclonal antihuman IL-12 Ab (AB-219-NA: 20 µg/ml) (R&D Systems) or a mixture of neutralizing rabbit polyclonal antihuman IFN-
Ab (2,000 neutralization U/ml), neutralizing rabbit polyclonal antihuman IFN-ß Ab (1,000 neutralization U/ml), and mouse antihuman IFN-
/ß receptor mAb (20 µg/ml) (PBL Biomedical Laboratories) was added into the coculture.
Intracellular Cytokine Staining.
Intracellular cytokine staining in MDCs and PDCs was performed after 5 h R-848 (10-6 M) stimulation. 10 µg/ml brefeldin A (Sigma-Aldrich) was added during the last 1 h. After the stimulation, MDCs and PDCs were stained with Cy-Chrome-labeled CD40 (5C3; BD PharMingen), and then fixed, permeabilized (FIX and PERM kit; Caltag Laboratories), and stained with FITC-labeled antiIL-12 p40+p70 mAb (B-P24; DIACLONE Research) or unconjugated mouse antihuman IFN-
mAb (MC-16; Genzyme). FITC-labeled goat antimouse IgG F(ab')2 (Becton Dickinson) was used as the secondary antibody for antiIFN-
mAb after repermeabilization. For detection of intracellular T cell cytokines, T cells after the 7 d coculture were restimulated with PMA (50 ng/ml) and ionomycin (2 µg/ml) for 6 h, and brefeldin A (10 µg/ml) was added during the last 2 h (all from Sigma-Aldrich). The cells were stained with phycoerythrin-cyanin 5.1 (PC5)-labeled anti-CD4 (ImmunoTech), and then with PE-labeled antiIL-4 (Becton Dickinson) plus FITC-labeled antiIFN-
mAb (Becton Dickinson) using FIX and PERM kit.
RT-PCR for TLRs.
Total RNA was prepared from sorted MDCs, PDCs, and CD14+CD16- blood monocytes using TRIsol reagent (GIBCO BRL). RT reactions were performed on 2 µg of total RNA using an oligo dT primer with SuperScript II (GIBCO BRL). 1 µl aliquots of the DNA resulting from each RT reaction were then subjected to PCR. The temperature profiles of PCR were as follows: an initial denaturation step of 94°C for 5 min, followed by 35 cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, and a final elongation step of 72°C for 7 min. For detection of TLR mRNA, a primer set each of TLR4 and TLR9 and three primer sets of TLR-7, as described previously (1214), were used. The sequences of primers were as follows: TLR-4, forward: 5'-TTTCTGCAATGGATCAAGGACCA-3', reverse: 5'-GGACACCACAACAATCACCTTTC-3'; TLR-9, forward: 5'-TTATGGACTTCCTGCTGGAGGTGC-3', reverse: 5'-CTGCGTTTTGTCGAAGACCA-3'; the first set of TLR-7 (13), forward: 5'-TCTACCTGGGCCAAAACTGTT-3', reverse: 5'-GGCACATGCTGAAGAGAGTTA-3'; the second set of TLR-7 (12), forward: 5'-AGTGTCTAAAGAACCTGG-3', reverse: 5'-CTTGGCCTTACAGAAATG-3'; the third set of TLR-7 (14), forward: 5'-CGAACCTCACCCTCACCATTA-3', reverse: 5'-GGGACGGCTGTGACATTGTTA-3'; and ß-actin, forward: 5'-GACCCAGATCATGTTTGAGACCTTCAACAC-3', reverse: 5'-TACTTGCGCTCAGGAGGAGCAATGATCTTG-3'. A
X174 DNA-HaeIII Digest (New England BioLabs) was used as a DNA size marker.
 |
Results
|
|---|
Expression of TLR-7 in DCs.
First, we analyzed the expression of TLR-7 in MDCs and PDCs using the RT-PCR method (Fig. 1)
. Krug et al. (13), but not Jorossay et al.(14), observed TLR-7 expression in MDCs. Kadowaki et al. detected weak, but significant expression of TLR-7 in MDCs through real-time PCR (12). Taking this discrepancy into consideration, we investigated TLR-7 expression with the three different sets of PCR primers employed in these studies. TLR-7 mRNA was shown to be unequivocally expressed in both MDCs and PDCs (Fig. 1 and data not shown). On the other hand, MDCs and PDCs reciprocally expressed TLR-4 and TLR-9; MDCs expressed TLR-4 but not TLR-9, while PDCs expressed TLR-9 but not TLR-4.

View larger version (82K):
[in this window]
[in a new window]
|
Figure 1. mRNA expression of TLRs in MDCs and PDCs. mRNA expression of TLR-4, -7, and -9 was examined in purified blood MDCs, PDCs, and CD14+CD16- monocytes by RT-PCR. For the detection of TLR-7 mRNA, three sets of primers were used, and similar results were obtained when using each set. The results using the first set of TLR-7 primers (as described in Materials and Methods) are shown in the figure. The data shown are representative of two independent experiments.
| |
Effects of TLR-7 Ligands on Survival and Expression of Costimulatory Molecules on DCs.
We next examined the biological effects of TLR-7 ligands, imiquimod and its derivative, R-848 (15), on MDCs and PDCs. Isolated MDCs and PDCs were incubated with various agents for 24 h and were then analyzed for cell viability and the expression of costimulatory molecules. As shown in Fig. 2
, both DC subsets, especially PDCs, mostly died within 24 h in the absence of stimuli. GM-CSF prevented MDCs from dying, while IL-3 or CpG-ODNs (phosphorothioate form [2006] and phosphodiester form [AAC30]) efficiently blocked the cell death of PDCs, a result that was consistent with the previous studies (11, 13, 22). TLR-7 ligands were shown to enhance the survival of both MDCs and PDCs. The survival-promoting effect of R-848 was
100-fold more potent than that of imiquimod, which is consistent with their effects on murine cells (15).

View larger version (33K):
[in this window]
[in a new window]
|
Figure 2. TLR-7 ligands enhance the survival of both MDCs and PDCs. MDCs and PDCs were incubated for 24 h with various stimuli. The viable cells in each DC subset were evaluated as annexin V-negative fractions by flow cytometry. The results are representative of three independent experiments.
| |
Furthermore, TLR-7 ligands could upregulate the surface expression of the costimulatory molecules, CD40, CD80 and CD86 on both MDCs and PDCs (Fig. 3)
. Their expression levels were comparable between the two DC subsets. As previously demonstrated, CpG-ODNs (2006 or AAC30) could enhance surface expression of these costimulatory molecules on PDCs but not on MDCs (11, 13). The effects of TLR-7 ligands on PDCs were equivalent to those of CpG-ODN (2006). Collectively, these results suggest that TLR-7 signaling can enhance survival rates and costimulatory molecule expression on PDCs and MDCs at comparable levels.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 3. TLR-7 ligands upregulate the expression of costimulatory molecules on both MDCs and PDCs. After 24-h culture with various stimuli, the expression levels of CD40, CD80, and CD86 on each DC subset were analyzed by flow cytometry. Imiquimod and R-848 were used at concentrations of 10-5 M and 10-7 M, respectively. The results are shown as MFI, which is calculated by subtraction of MFI with the isotype-matched control from that with each mAb. The results shown here are representative of three independent experiments.
| |
Effects of TLR-7 Ligands on Cytokine Production of DCs.
Serum levels of IL-12 and IFN-
were elevated when mice were intraperitoneally injected with the TLR-7 ligands (15). Therefore, we next examined the effect of TLR-7 ligands on cytokine production from DCs, especially focusing on IL-12 and IFN-
. LPS and Sendai virus (SV) differentially activated MDCs and PDCs to produce large amounts of IL-12 p40+p70 (total IL-12) (Fig. 4
A) and IFN-
(Fig. 4 B), respectively.
Both imiquimod and R-848 definitely induced total IL-12 production from MDCs in a dosedependent manner (Fig. 4 A). However, these compounds as well as the other stimuli tested were much less effective or had no effect on IL-12 production from PDCs. By contrast, TLR-7 ligands were demonstrated to be potent stimulators of IFN-
production of PDCs (Fig. 4 B). The effects were manifested in a dosedependent manner and were even more potent than those of the CpG-ODNs tested. However, the TLR-7 ligands had no capacity to induce IFN-
production from MDCs. Titration analysis again demonstrated that the effect of the imidazoquinolines on cytokine induction (IL-12 from MDCs and IFN-
from PDCs) was
100-fold stronger in R-848 than in imiquimod.
Intracellular cytokine staining also showed that R-848 induced the synthesis of IL-12 and IFN-
in MDCs and PDCs, respectively (Fig. 4 C). Both IL-12producing MDCs and IFN-
producing PDCs exclusively expressed CD40, indicating that DCs maturated by TLR-7 ligands produce cytokines.
Effects of TLR-7 Ligands on DC-mediated Th Polarization.
To elucidate how TLR-7 ligands affect the DC-mediated T cell responses, MDCs and PDCs were preincubated with R-848 for 24 h, and then cocultured with allogeneic naive CD4+ T cells. As shown in Fig. 5
, GM-CSFtreated MDCs preferentially induced Th1 development, while IL-3treated PDCs facilitated Th2 skewing, in agreement with the previous reports (2224). TLR-7 ligand-stimulated MDCs more strongly induced Th1 development than GM-CSFtreated MDCs, and this effect was markedly blocked by the addition of antiIL-12 Ab (IL-12
Ab), but not by the addition of a mixture of antiIFN-
Ab, antiIFN-ß Ab, and antiIFN-
/ß R Ab (IFN-
s Abs). TLR-7 ligand-stimulated PDCs also developed IFN-
producing cells. This Th1 induction was substantially inhibited by the addition of IFN-
s Abs, but not by the addition of IL-12
Ab. Thus, both PDCs and MDCs can augment their Th1 cell supporting ability in response to TLR-7 ligands through distinct cytokines.
 |
Discussion
|
|---|
It remains a key issue whether DC response is determined by cell lineage or by stimuli. TLRs on DCs are major receptors for various pathogenic stimuli. Therefore, it is quite important to evaluate how DCs are activated by TLR signaling. Of the TLRs, TLR-2, -4, and -9 are expressed in either MDCs or PDCs (1214). In accordance with the expression of TLR-2, -4, and -9, each DC subset differentially responds to respective TLR ligands. MDCs can secrete IL-12 through TLR-2 or TLR-4 signaling (1214), whereas PDCs can produce IFN-
/ß through TLR-9 signaling (1114, 25, 26). Thus, human DCs can produce subset-specific cytokines in response to PAMPs. These findings favor the idea that the DC lineage is critical for establishing DC response. However, TLRs for these PAMPs are differentially expressed in the DC subsets (1214, and Fig. 1). Therefore, it cannot formally be concluded whether the microbial response is determined by TLR expression or DC lineage.
Unlike TLR-4 and -9, TLR-7 was constitutively expressed on both PDCs and MDCs (Fig. 1). In this context, TLR-7 ligands should be useful tools to clarify how the same pattern recognition stimuli lead to activation of distinct DC subsets. Consistent with the TLR-7 expression, the ligands, imiquimod and R-848, enhanced the survival of both PDCs and MDCs (Fig. 2) and induced their phenotypical maturation (Fig. 3). In contrast, TLR-7 ligands showed differential cytokine-inducing effects on different DC subsets; IFN-
from PDCs (Fig. 4 B) versus IL-12 from MDCs (Fig. 4 A). These results indicate that the TLR-7induced cytokine induction pattern is determined not only by TLR expression but also by DC lineage. In other words, DC lineage as well as instructive stimuli are decisive factors affecting DC response, at least in the TLR-7 system.
At present, it remains unknown why TLR-7 exerts differential outcomes in distinct DC subsets. In response to TLR-4 ligand, cytokine induction depends on MyD88, whereas DC maturation can proceed without MyD88, indicating that MyD88 is a bifurcation point in TLR-4 signaling (27). However, all effects of TLR-7 signaling depend on MyD88 (15). Therefore, it is likely there is another bifurcation point leading to the expression of IFN-
or IL-12.
In determining Th responses, the DC system shows not only lineage heterogeneity, but also functional plasticity depending on the signals or environmental instruction (2, 4, 2224, 28). In the microbial environment, MDCs acquire Th1-inducing activity in response to TLR-2 or TLR-4 ligands (1214). Meanwhile, PDCs can also support Th1 cell development in response to a TLR-9 ligand, CpG DNA (25, 26). These immunogenic Th1 responses are mediated by IL-12 and IFN-
/ß from MDCs and PDCs, respectively (22, 29). In line with this paradigm of Th1 responses, this study shows that TLR-7 signaling affects both DC subsets so that they support the differentiation of naive Th cells also toward Th1 cells, depending on the cytokines each DC subset secretes (Fig. 5). Thus, DC subsets are programmed to make different innate responses in terms of cytokine production, but can both eventually cause the same Th1 induction.
In conclusion, TLR-7 ligands, imiquimod and its derivative, had discernible immunostimulatory effects on both human PDCs and MDCs. In addition, our results uncovered a possible new member of TLRs that has the potential to evoke IFN-
production from PDCs. Remarkably, the TLR-7dependent cytokine production pattern is determined by the lineage commitment of the DC subsets.
 |
Acknowledgments
|
|---|
This work was supported by a grant from Research Fellowships of the Japan Society for the Promotion of Science for Young Scientists.
Submitted: February 7, 2002
Revised: April 2, 2002
Accepted: April 18, 2002
 |
References
|
|---|
1
Mellman, I., and R.M. Steinman. 2001. Dendritic cells: specialized and regulated antigen processing machines. Cell. 106:255258.[CrossRef][Medline]
2
Liu, Y.-J. 2001. Dendritic cell subsets and lineages, and their functions in innate and adaptive immunity. Cell. 106:259262.[CrossRef][Medline]
3
Lanzavecchia, A., and F. Sallusto. 2001. Regulation of T cell immunity by dendritic cells. Cell. 106:263266.[CrossRef][Medline]
4
Liu, Y.-J., H. Kanzler, V. Soumelis, and M. Gilliet. 2001. Dendritic cell lineage, plasticity and cross-regulation. Nat. Immunol. 2:585589.[CrossRef][Medline]
5
Medzhihtov, R., and C. Janeway, Jr. 1997. Innate immunity: the virtues of a nonclonal system of recognition. Cell. 91:295298.[CrossRef][Medline]
6
Medzhihtov, R., and C. Janeway, Jr. 2000. Innate immune recognition: mechanism and pathways. Immunol. Rev. 173:8997.[CrossRef][Medline]
7
Aderem, A., and R.J. Ulevitch. 2000. Toll-like receptors in the induction of the innate immune response. Nature. 406:782787.[CrossRef][Medline]
8
Akira, S., K. Takada, and T. Kaisho. 2001. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2:675680.[CrossRef][Medline]
9
Kaisho, T., and S. Akira. 2001. Dendritic-cell function in toll-like receptor- and MyD88-knockout mice. Trends Immunol. 22:7883.[CrossRef][Medline]
10
Thoma-Uszynski, S., S.M. Kiertscher, M.T. Ochoa, D.A. Bouis, M.V. Norgard, K. Miyake, P.J. Godowski, M.D. Roth, and R.L. Modlin. 2000. Activation of toll-like receptor 2 on human dendritic cells triggers induction of IL-12, but not IL-10. J. Immunol. 165:38043810.[Abstract/Free Full Text]
11
Kadowaki, N., S. Antonenko, and Y.-J. Liu. 2001. Distinct CpG DNA and polyinosinic-polycytidylic acid double-stranded RNA, respectively, stimulate CD11c- type 2 dendritic cell precursors and CD11c+ dendritic cells to produce type I IFN. J. Immunol. 166:22912295.[Abstract/Free Full Text]
12
Kadowaki, N., S. Ho, S. Antonenko, R.W. Malefyt, R.A. Kastelein, F. Bazan, and Y.-J. Liu. 2001. Subsets of human dendritic cell precursors express different toll-like receptors and respond to different microbial antigens. J. Exp. Med. 194:863869.[Abstract/Free Full Text]
13
Krug, A., A. Towarowski, S. Britsch, S. Rothenfusser, V. Hornung, R. Bals, T. Giese, H. Engelmann, S. Endres, A.M. Krieg, et al. 2001. Toll-like receptor expression reveals CpG DNA as a unique microbial stimulus for plasmacytoid dendritic cells which synergizes with CD40 ligand to induce high amounts of IL-12. Eur. J. Immunol. 31:30263037.[CrossRef][Medline]
14
Jarrossay, D., G. Napolitani, M. Colonna, F. Sallusto, and A. Lanzavecchia. 2001. Specialization and complementarity in microbial molecule recognition by human myeloid and plasmacytoid dendritic cells. Eur. J. Immunol. 31:33883393.[CrossRef][Medline]
15
Hemmi, H., T. Kaisho, O. Takeuchi, S. Sato, H. Sanjo, K. Hoshino, T. Horiuchi, H. Tomizawa, K. Takeda, and S. Akira. 2002. Small anti-viral compounds activate immune cells via TLR7-MyD88-dependent signaling pathway. Nat. Immunol. 3:196200.[CrossRef][Medline]
16
Miller, R.L., J.F. Gerster, M.L. Owens, H.B. Slade, and M.A. Tomai. 1999. Imiquimod applied topically: a novel immune response modifier and new class of drug. Int. J. Immunopharmacol. 21:114.[CrossRef][Medline]
17
Harrison, C.J., R.L. Miller, and D.I. Bernstein. 1994. Posttherapy suppression of genital herpes simplex virus (HSV) recurrences and enhancement of HSV-specific T-cell memory by imiquimod in guinea pigs. Antimicrob. Agents Chemother. 38:20592064.[Abstract/Free Full Text]
18
Chen, M., B.P. Griffith, H.L. Lucia, and G.D. Hsiung. 1988. Efficacy of S26308 against guinea pig cytomegalovirus infection. Antimicrob. Agents Chemother. 32:678683.
19
Bernstein, D.I., C.J. Harrison, M.A. Tomai, and R.L. Miller. 2001. Daily or weekly therapy with resiquimod (R-848) reduces genital recurrences in herpes simplex virus-infected guinea pigs during and after treatment. J. Infect. Dis. 183:844849.[CrossRef][Medline]
20
von Krogh, G., C.J. Lacey, G. Gross, R. Barrasso, and A. Schneider. 2000. European course on HPV associated pathology: guideline for primary case physicians for the diagnosis and management of anogenital warts. Sex. Transm. Infect. 76:162168.[Abstract/Free Full Text]
21
Ito, T., M. Inaba, K. Inaba, J. Toki, S. Sogo, T. Iguchi, Y. Adachi, K. Yamaguchi, R. Amakawa, J. Valladeau, et al. 1999. A CD1a+/CD11c+ subset of human blood dendritic cells is a direct precursor of Langerhans cells. J. Immunol. 163:14091419.[Abstract/Free Full Text]
22
Ito, T., R. Amakawa, M. Inaba, S. Ikehara, K. Inaba, and S. Fukuhara. 2001. Differential regulation of human blood dendritic cell subsets by IFNs. J. Immunol. 166:29612969.[Abstract/Free Full Text]
23
Rissoan, M.-C., V. Soumelis, N. Kadowaki, G. Grouard, F. Briere, R.W. Malefyt, and Y.-J. Liu. 1999. Reciprocal control of T helper cell and dendritic cell differentiation. Science. 283:11831186.[Abstract/Free Full Text]
24
Kadowaki, N., S. Antonenko, J.Y.-N. Lau, and Y.-J. Liu. 2000. Natural interferon
/ß-producing cells link innate and adaptive immunity. J. Exp. Med. 192:219225.[Abstract/Free Full Text]
25
Krug, A., S. Rothenfusser, V. Hornung, B. Jahrsdörfer, S. Blackwell, Z.K. Ballas, S. Endres, A.M. Krieg, and G. Hartmann. 2001. Identification of CpG oligonucleotide sequences with high induction of IFN-
/ß in plasmacytoid dendritic cells. Eur. J. Immunol. 31:21542163.[CrossRef][Medline]
26
Bauer, M., V. Redecke, J.W. Ellwart, B. Scherer, J.-P. Kremer, H. Wagner, and G.B. Lipford. 2001. Bacterial CpG-DNA triggers activation and maturation of human CD11c-, CD123+ dendritic cells. J. Immunol. 166:50005007.[Abstract/Free Full Text]
27
Kaisho, T., O. Takeuchi, T. Kawai, K. Hoshino, and S. Akira. 2001. Endotoxin-induced maturation of MyD88-deficient dendritic cells. J. Immunol. 166:56885694.[Abstract/Free Full Text]
28
Vieira, P.L., E.C. de Jong, E.A. Wierenga, M.L. Kapsenberg, and P. Kaliñski. 2000. Development of Th1-inducing capacity in myeloid dendritic cells requires environmental instruction. J. Immunol. 164:45074512.[Abstract/Free Full Text]
29
Cella, M., F. Facchetti, A. Lanzavecchia, and M. Colonna. 2000. Plasmacytoid dendritic cells activated by influenza virus and CD40L drive a potent TH1 polarization. Nat. Immunol. 1:305310.[CrossRef][Medline]

CiteULike
Complore
Connotea
Del.icio.us
Digg
Facebook
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
-
Chamorro, S., Garcia-Vallejo, J. J., Unger, W. W. J., Fernandes, R. J., Bruijns, S. C. M., Laban, S., Roep, B. O., 't Hart, B. A., van Kooyk, Y.
(2009). TLR Triggering on Tolerogenic Dendritic Cells Results in TLR2 Up-Regulation and a Reduced Proinflammatory Immune Program. J. Immunol.
183: 2984-2994
[Abstract]
[Full Text]
-
de Vos, A. F., Pater, J. M., van den Pangaart, P. S., de Kruif, M. D., van 't Veer, C., van der Poll, T.
(2009). In Vivo Lipopolysaccharide Exposure of Human Blood Leukocytes Induces Cross-Tolerance to Multiple TLR Ligands. J. Immunol.
183: 533-542
[Abstract]
[Full Text]
-
Liang, H., Russell, R. S., Yonkers, N. L., McDonald, D., Rodriguez, B., Harding, C. V., Anthony, D. D.
(2009). Differential Effects of Hepatitis C Virus JFH1 on Human Myeloid and Plasmacytoid Dendritic Cells. J. Virol.
83: 5693-5707
[Abstract]
[Full Text]
-
Ablasser, A., Poeck, H., Anz, D., Berger, M., Schlee, M., Kim, S., Bourquin, C., Goutagny, N., Jiang, Z., Fitzgerald, K. A., Rothenfusser, S., Endres, S., Hartmann, G., Hornung, V.
(2009). Selection of Molecular Structure and Delivery of RNA Oligonucleotides to Activate TLR7 versus TLR8 and to Induce High Amounts of IL-12p70 in Primary Human Monocytes. J. Immunol.
182: 6824-6833
[Abstract]
[Full Text]
-
Zeng, J., Cai, S., Yi, Y., He, Y., Wang, Z., Jiang, G., Li, X., Du, J.
(2009). Prevention of Spontaneous Tumor Development in a ret Transgenic Mouse Model by Ret Peptide Vaccination with Indoleamine 2,3-Dioxygenase Inhibitor 1-Methyl Tryptophan. Cancer Res.
69: 3963-3970
[Abstract]
[Full Text]
-
Larange, A., Antonios, D., Pallardy, M., Kerdine-Romer, S.
(2009). TLR7 and TLR8 agonists trigger different signaling pathways for human dendritic cell maturation. J. Leukoc. Biol.
85: 673-683
[Abstract]
[Full Text]
-
Zhang, X., Jin, J., Tang, Y., Speer, D., Sujkowska, D., Markovic-Plese, S.
(2009). IFN-{beta}1a Inhibits the Secretion of Th17-Polarizing Cytokines in Human Dendritic Cells via TLR7 Up-Regulation. J. Immunol.
182: 3928-3936
[Abstract]
[Full Text]
-
Douagi, I., Gujer, C., Sundling, C., Adams, W. C., Smed-Sorensen, A., Seder, R. A., Karlsson Hedestam, G. B., Lore, K.
(2009). Human B Cell Responses to TLR Ligands Are Differentially Modulated by Myeloid and Plasmacytoid Dendritic Cells. J. Immunol.
182: 1991-2001
[Abstract]
[Full Text]
-
Liu, B., Woltman, A. M., Janssen, H. L. A., Boonstra, A.
(2009). Modulation of dendritic cell function by persistent viruses. J. Leukoc. Biol.
85: 205-214
[Abstract]
[Full Text]
-
Torii, Y., Ito, T., Amakawa, R., Sugimoto, H., Amuro, H., Tanijiri, T., Katashiba, Y., Ogata, M., Yokoi, T., Fukuhara, S.
(2008). Imidazoquinoline Acts as Immune Adjuvant for Functional Alteration of Thymic Stromal Lymphopoietin-Mediated Allergic T Cell Response. J. Immunol.
181: 5340-5349
[Abstract]
[Full Text]
-
Ju, X., Zenke, M., Hart, D. N. J., Clark, G. J.
(2008). CD300a/c regulate type I interferon and TNF-{alpha} secretion by human plasmacytoid dendritic cells stimulated with TLR7 and TLR9 ligands. Blood
112: 1184-1194
[Abstract]
[Full Text]
-
Smits, E. L. J. M., Ponsaerts, P., Berneman, Z. N., Van Tendeloo, V. F. I.
(2008). The Use of TLR7 and TLR8 Ligands for the Enhancement of Cancer Immunotherapy. The Oncologist
13: 859-875
[Abstract]
[Full Text]
-
Adams, S., O'Neill, D. W., Nonaka, D., Hardin, E., Chiriboga, L., Siu, K., Cruz, C. M., Angiulli, A., Angiulli, F., Ritter, E., Holman, R. M., Shapiro, R. L., Berman, R. S., Berner, N., Shao, Y., Manches, O., Pan, L., Venhaus, R. R., Hoffman, E. W., Jungbluth, A., Gnjatic, S., Old, L., Pavlick, A. C., Bhardwaj, N.
(2008). Immunization of Malignant Melanoma Patients with Full-Length NY-ESO-1 Protein Using TLR7 Agonist Imiquimod as Vaccine Adjuvant. J. Immunol.
181: 776-784
[Abstract]
[Full Text]
-
Forsbach, A., Nemorin, J.-G., Montino, C., Muller, C., Samulowitz, U., Vicari, A. P., Jurk, M., Mutwiri, G. K., Krieg, A. M., Lipford, G. B., Vollmer, J.
(2008). Identification of RNA Sequence Motifs Stimulating Sequence-Specific TLR8-Dependent Immune Responses. J. Immunol.
180: 3729-3738
[Abstract]
[Full Text]
-
Fransen, F., Boog, C. J., van Putten, J. P., van der Ley, P.
(2007). Agonists of Toll-Like Receptors 3, 4, 7, and 9 Are Candidates for Use as Adjuvants in an Outer Membrane Vaccine against Neisseria meningitidis Serogroup B. Infect. Immun.
75: 5939-5946
[Abstract]
[Full Text]
-
Dudek, A. Z., Yunis, C., Harrison, L. I., Kumar, S., Hawkinson, R., Cooley, S., Vasilakos, J. P., Gorski, K. S., Miller, J. S.
(2007). First in Human Phase I Trial of 852A, a Novel Systemic Toll-like Receptor 7 Agonist, to Activate Innate Immune Responses in Patients with Advanced Cancer. Clin. Cancer Res.
13: 7119-7125
[Abstract]
[Full Text]
-
Ku, C.-L., von Bernuth, H., Picard, C., Zhang, S.-Y., Chang, H.-H., Yang, K., Chrabieh, M., Issekutz, A. C., Cunningham, C. K., Gallin, J., Holland, S. M., Roifman, C., Ehl, S., Smart, J., Tang, M., Barrat, F. J., Levy, O., McDonald, D., Day-Good, N. K., Miller, R., Takada, H., Hara, T., Al-Hajjar, S., Al-Ghonaium, A., Speert, D., Sanlaville, D., Li, X., Geissmann, F., Vivier, E., Marodi, L., Garty, B.-Z., Chapel, H., Rodriguez-Gallego, C., Bossuyt, X., Abel, L., Puel, A., Casanova, J.-L.
(2007). Selective predisposition to bacterial infections in IRAK-4 deficient children: IRAK-4 dependent TLRs are otherwise redundant in protective immunity. JEM
204: 2407-2422
[Abstract]
[Full Text]
-
Marshall, J. D., Heeke, D. S., Gesner, M. L., Livingston, B., Van Nest, G.
(2007). Negative regulation of TLR9-mediated IFN-{alpha} induction by a small-molecule, synthetic TLR7 ligand. J. Leukoc. Biol.
82: 497-508
[Abstract]
[Full Text]
-
Meier, A., Alter, G., Frahm, N., Sidhu, H., Li, B., Bagchi, A., Teigen, N., Streeck, H., Stellbrink, H.-J., Hellman, J., van Lunzen, J., Altfeld, M.
(2007). MyD88-Dependent Immune Activation Mediated by Human Immunodeficiency Virus Type 1-Encoded Toll-Like Receptor Ligands. J. Virol.
81: 8180-8191
[Abstract]
[Full Text]
-
Piccioli, D., Tavarini, S., Borgogni, E., Steri, V., Nuti, S., Sammicheli, C., Bardelli, M., Montagna, D., Locatelli, F., Wack, A.
(2007). Functional specialization of human circulating CD16 and CD1c myeloid dendritic-cell subsets. Blood
109: 5371-5379
[Abstract]
[Full Text]
-
Uematsu, S., Akira, S.
(2007). Toll-like Receptors and Type I Interferons. J. Biol. Chem.
282: 15319-15323
[Abstract]
[Full Text]
-
Fernandez, S., Palmer, D. R., Simmons, M., Sun, P., Bisbing, J., McClain, S., Mani, S., Burgess, T., Gunther, V., Sun, W.
(2007). Potential Role for Toll-Like Receptor 4 in Mediating Escherichia coli Maltose-Binding Protein Activation of Dendritic Cells. Infect. Immun.
75: 1359-1363
[Abstract]
[Full Text]
-
Boonstra, A., Rajsbaum, R., Holman, M., Marques, R., Asselin-Paturel, C., Pereira, J. P., Bates, E. E. M., Akira, S., Vieira, P., Liu, Y.-J., Trinchieri, G., O'Garra, A.
(2006). Macrophages and Myeloid Dendritic Cells, but Not Plasmacytoid Dendritic Cells, Produce IL-10 in Response to MyD88- and TRIF-Dependent TLR Signals, and TLR-Independent Signals. J. Immunol.
177: 7551-7558
[Abstract]
[Full Text]
-
Flacher, V., Bouschbacher, M., Verronese, E., Massacrier, C., Sisirak, V., Berthier-Vergnes, O., de Saint-Vis, B., Caux, C., Dezutter-Dambuyant, C., Lebecque, S., Valladeau, J.
(2006). Human Langerhans Cells Express a Specific TLR Profile and Differentially Respond to Viruses and Gram-Positive Bacteria. J. Immunol.
177: 7959-7967
[Abstract]
[Full Text]
-
Petrovas, C., Casazza, J. P., Brenchley, J. M., Price, D. A., Gostick, E., Adams, W. C., Precopio, M. L., Schacker, T., Roederer, M., Douek, D. C., Koup, R. A.
(2006). PD-1 is a regulator of virus-specific CD8+ T cell survival in HIV infection. JEM
203: 2281-2292
[Abstract]
[Full Text]
-
Hubert, F.-X., Voisine, C., Louvet, C., Heslan, J.-M., Ouabed, A., Heslan, M., Josien, R.
(2006). Differential Pattern Recognition Receptor Expression but Stereotyped Responsiveness in Rat Spleen Dendritic Cell Subsets. J. Immunol.
177: 1007-1016
[Abstract]
[Full Text]
-
Montoya, C. J., Jie, H.-B., Al-Harthi, L., Mulder, C., Patino, P. J., Rugeles, M. T., Krieg, A. M., Landay, A. L., Wilson, S. B.
(2006). Activation of Plasmacytoid Dendritic Cells with TLR9 Agonists Initiates Invariant NKT Cell-Mediated Cross-Talk with Myeloid Dendritic Cells. J. Immunol.
177: 1028-1039
[Abstract]
[Full Text]
-
Hussain, S. F., Yang, D., Suki, D., Aldape, K., Grimm, E., Heimberger, A. B.
(2006). The role of human glioma-infiltrating microglia/macrophages in mediating antitumor immune responses. Neuro Oncol Duke
8: 261-279
[Abstract]
[Full Text]
-
Gorski, K. S., Waller, E. L., Bjornton-Severson, J., Hanten, J. A., Riter, C. L., Kieper, W. C., Gorden, K. B., Miller, J. S., Vasilakos, J. P., Tomai, M. A., Alkan, S. S.
(2006). Distinct indirect pathways govern human NK-cell activation by TLR-7 and TLR-8 agonists. Int Immunol
18: 1115-1126
[Abstract]
[Full Text]
-
Greene, J. A., DeVecchio, J. L., Gould, M. P., Auletta, J. J., Heinzel, F. P.
(2006). In vivo and In vitro Regulation of Type I IFN Synthesis by Synergistic Effects of CD40 and Type II IFN. J. Immunol.
176: 5995-6003
[Abstract]
[Full Text]
-
Yrlid, U., Milling, S. W. F., Miller, J. L., Cartland, S., Jenkins, C. D., MacPherson, G. G.
(2006). Regulation of Intestinal Dendritic Cell Migration and Activation by Plasmacytoid Dendritic Cells, TNF-{alpha} and Type 1 IFNs after Feeding a TLR7/8 Ligand. J. Immunol.
176: 5205-5212
[Abstract]
[Full Text]
-
Arimilli, S., Alexander-Miller, M. A., Parks, G. D.
(2006). A Simian Virus 5 (SV5) P/V Mutant Is Less Cytopathic than Wild-Type SV5 in Human Dendritic Cells and Is a More Effective Activator of Dendritic Cell Maturation and Function.. J. Virol.
80: 3416-3427
[Abstract]
[Full Text]
-
Ito, T., Kanzler, H., Duramad, O., Cao, W., Liu, Y.-J.
(2006). Specialization, kinetics, and repertoire of type 1 interferon responses by human plasmacytoid predendritic cells. Blood
107: 2423-2431
[Abstract]
[Full Text]
-
Wille-Reece, U., Flynn, B. J., Lore, K., Koup, R. A., Kedl, R. M., Mattapallil, J. J., Weiss, W. R., Roederer, M., Seder, R. A.
(2005). HIV Gag protein conjugated to a Toll-like receptor 7/8 agonist improves the magnitude and quality of Th1 and CD8+ T cell responses in nonhuman primates. Proc. Natl. Acad. Sci. USA
102: 15190-15194
[Abstract]
[Full Text]
-
Gunzer, M., Riemann, H., Basoglu, Y., Hillmer, A., Weishaupt, C., Balkow, S., Benninghoff, B., Ernst, B., Steinert, M., Scholzen, T., Sunderkotter, C., Grabbe, S.
(2005). Systemic administration of a TLR7 ligand leads to transient immune incompetence due to peripheral-blood leukocyte depletion. Blood
106: 2424-2432
[Abstract]
[Full Text]
-
McIlroy, D., Tanguy-Royer, S., Le Meur, N., Guisle, I., Royer, P.-J., Leger, J., Meflah, K., Gregoire, M.
(2005). Profiling dendritic cell maturation with dedicated microarrays. J. Leukoc. Biol.
78: 794-803
[Abstract]
[Full Text]
-
Urosevic, M., Dummer, R., Conrad, C., Beyeler, M., Laine, E., Burg, G., Gilliet, M.
(2005). Disease-Independent Skin Recruitment and Activation of Plasmacytoid Predendritic Cells Following Imiquimod Treatment. JNCI J Natl Cancer Inst
97: 1143-1153
[Abstract]
[Full Text]
-
Morita, R., Uchiyama, T., Hori, T.
(2005). Nitric Oxide Inhibits IFN-{alpha} Production of Human Plasmacytoid Dendritic Cells Partly via a Guanosine 3',5'-Cyclic Monophosphate-Dependent Pathway. J. Immunol.
175: 806-812
[Abstract]
[Full Text]
-
Wille-Reece, U., Wu, C.-y., Flynn, B. J., Kedl, R. M., Seder, R. A.
(2005). Immunization with HIV-1 Gag Protein Conjugated to a TLR7/8 Agonist Results in the Generation of HIV-1 Gag-Specific Th1 and CD8+ T Cell Responses. J. Immunol.
174: 7676-7683
[Abstract]
[Full Text]
-
Korman, N., Moy, R., Ling, M., Matheson, R., Smith, S., McKane, S., Lee, J. H.
(2005). Dosing With 5% Imiquimod Cream 3 Times per Week for the Treatment of Actinic Keratosis: Results of Two Phase 3, Randomized, Double-blind, Parallel-Group, Vehicle-Controlled Trials. Arch Dermatol
141: 467-473
[Abstract]
[Full Text]
-
Tissari, J., Siren, J., Meri, S., Julkunen, I., Matikainen, S.
(2005). IFN-{alpha} Enhances TLR3-Mediated Antiviral Cytokine Expression in Human Endothelial and Epithelial Cells by Up-Regulating TLR3 Expression. J. Immunol.
174: 4289-4294
[Abstract]
[Full Text]
-
Kamogawa-Schifter, Y., Ohkawa, J., Namiki, S., Arai, N., Arai, K.-i., Liu, Y.
(2005). Ly49Q defines 2 pDC subsets in mice. Blood
105: 2787-2792
[Abstract]
[Full Text]
-
Uematsu, S., Sato, S., Yamamoto, M., Hirotani, T., Kato, H., Takeshita, F., Matsuda, M., Coban, C., Ishii, K. J., Kawai, T., Takeuchi, O., Akira, S.
(2005). Interleukin-1 receptor-associated kinase-1 plays an essential role for Toll-like receptor (TLR)7- and TLR9-mediated interferon-{alpha} induction. JEM
201: 915-923
[Abstract]
[Full Text]
-
Siren, J., Pirhonen, J., Julkunen, I., Matikainen, S.
(2005). IFN-{alpha} Regulates TLR-Dependent Gene Expression of IFN-{alpha}, IFN-{beta}, IL-28, and IL-29. J. Immunol.
174: 1932-1937
[Abstract]
[Full Text]
-
Gorden, K. B., Gorski, K. S., Gibson, S. J., Kedl, R. M., Kieper, W. C., Qiu, X., Tomai, M. A., Alkan, S. S., Vasilakos, J. P.
(2005). Synthetic TLR Agonists Reveal Functional Differences between Human TLR7 and TLR8. J. Immunol.
174: 1259-1268
[Abstract]
[Full Text]
-
McKenna, K., Beignon, A.-S., Bhardwaj, N.
(2005). Plasmacytoid Dendritic Cells: Linking Innate and Adaptive Immunity. J. Virol.
79: 17-27
[Full Text]
-
Takeda, K., Akira, S.
(2005). Toll-like receptors in innate immunity. Int Immunol
17: 1-14
[Abstract]
[Full Text]
-
Re, F., Strominger, J. L.
(2004). IL-10 Released by Concomitant TLR2 Stimulation Blocks the Induction of a Subset of Th1 Cytokines That Are Specifically Induced by TLR4 or TLR3 in Human Dendritic Cells. J. Immunol.
173: 7548-7555
[Abstract]
[Full Text]
-
Gilliet, M., Conrad, C., Geiges, M., Cozzio, A., Thurlimann, W., Burg, G., Nestle, F. O., Dummer, R.
(2004). Psoriasis Triggered by Toll-like Receptor 7 Agonist Imiquimod in the Presence of Dermal Plasmacytoid Dendritic Cell Precursors. Arch Dermatol
140: 1490-1495
[Abstract]
[Full Text]
-
Rossi, R. J., Muralimohan, G., Maxwell, J. R., Vella, A. T.
(2004). Staphylococcal enterotoxins condition cells of the innate immune system for Toll-like receptor 4 stimulation. Int Immunol
16: 1751-1760
[Abstract]
[Full Text]
-
Jackson, D. C., Lau, Y. F., Le, T., Suhrbier, A., Deliyannis, G., Cheers, C., Smith, C., Zeng, W., Brown, L. E.
(2004). A totally synthetic vaccine of generic structure that targets Toll-like receptor 2 on dendritic cells and promotes antibody or cytotoxic T cell responses. Proc. Natl. Acad. Sci. USA
101: 15440-15445
[Abstract]
[Full Text]
-
Palamara, F., Meindl, S., Holcmann, M., Luhrs, P., Stingl, G., Sibilia, M.
(2004). Identification and Characterization of pDC-Like Cells in Normal Mouse Skin and Melanomas Treated with Imiquimod. J. Immunol.
173: 3051-3061
[Abstract]
[Full Text]
-
Dai, J., Megjugorac, N. J., Amrute, S. B., Fitzgerald-Bocarsly, P.
(2004). Regulation of IFN Regulatory Factor-7 and IFN-{alpha} Production by Enveloped Virus and Lipopolysaccharide in Human Plasmacytoid Dendritic Cells. J. Immunol.
173: 1535-1548
[Abstract]
[Full Text]
-
Urosevic, M., Oberholzer, P. A., Maier, T., Hafner, J., Laine, E., Slade, H., Benninghoff, B., Burg, G., Dummer, R.
(2004). Imiquimod Treatment Induces Expression of Opioid Growth Factor Receptor: A Novel Tumor Antigen Induced by Interferon-{alpha}?. Clin. Cancer Res.
10: 4959-4970
[Abstract]
[Full Text]
-
Hubert, F.-X., Voisine, C., Louvet, C., Heslan, M., Josien, R.
(2004). Rat Plasmacytoid Dendritic Cells Are an Abundant Subset of MHC Class II+ CD4+CD11b-OX62- and Type I IFN-Producing Cells That Exhibit Selective Expression of Toll-Like Receptors 7 and 9 and Strong Responsiveness to CpG. J. Immunol.
172: 7485-7494
[Abstract]
[Full Text]
-
Mazzoni, A., Segal, D. M.
(2004). Controlling the Toll road to dendritic cell polarization. J. Leukoc. Biol.
75: 721-730
[Abstract]
[Full Text]
-
Dillon, S., Agrawal, A., Van Dyke, T., Landreth, G., McCauley, L., Koh, A., Maliszewski, C., Akira, S., Pulendran, B.
(2004). A Toll-Like Receptor 2 Ligand Stimulates Th2 Responses In Vivo, via Induction of Extracellular Signal-Regulated Kinase Mitogen-Activated Protein Kinase and c-Fos in Dendritic Cells. J. Immunol.
172: 4733-4743
[Abstract]
[Full Text]
-
Pichyangkul, S., Yongvanitchit, K., Kum-arb, U., Hemmi, H., Akira, S., Krieg, A. M., Heppner, D. G., Stewart, V. A., Hasegawa, H., Looareesuwan, S., Shanks, G. D., Miller, R. S.
(2004). Malaria Blood Stage Parasites Activate Human Plasmacytoid Dendritic Cells and Murine Dendritic Cells through a Toll-Like Receptor 9-Dependent Pathway. J. Immunol.
172: 4926-4933
[Abstract]
[Full Text]
-
Anders, H.-J., Banas, B., Schlondorff, D.
(2004). Signaling Danger: Toll-Like Receptors and their Potential Roles in Kidney Disease. J. Am. Soc. Nephrol.
15: 854-867
[Abstract]
[Full Text]
-
Ito, T., Amakawa, R., Inaba, M., Hori, T., Ota, M., Nakamura, K., Takebayashi, M., Miyaji, M., Yoshimura, T., Inaba, K., Fukuhara, S.
(2004). Plasmacytoid Dendritic Cells Regulate Th Cell Responses through OX40 Ligand and Type I IFNs. J. Immunol.
172: 4253-4259
[Abstract]
[Full Text]
-
Ahonen, C. L., Doxsee, C. L., McGurran, S. M., Riter, T. R., Wade, W. F., Barth, R. J., Vasilakos, J. P., Noelle, R. J., Kedl, R. M.
(2004). Combined TLR and CD40 Triggering Induces Potent CD8+ T Cell Expansion with Variable Dependence on Type I IFN. JEM
199: 775-784
[Abstract]
[Full Text]
-
Izaguirre, A., Barnes, B. J., Amrute, S., Yeow, W.-S., Megjugorac, N., Dai, J., Feng, D., Chung, E., Pitha, P. M., Fitzgerald-Bocarsly, P.
(2003). Comparative analysis of IRF and IFN-alpha expression in human plasmacytoid and monocyte-derived dendritic cells. J. Leukoc. Biol.
74: 1125-1138
[Abstract]
[Full Text]
-
Agrawal, S., Agrawal, A., Doughty, B., Gerwitz, A., Blenis, J., Van Dyke, T., Pulendran, B.
(2003). Cutting Edge: Different Toll-Like Receptor Agonists Instruct Dendritic Cells to Induce Distinct Th Responses via Differential Modulation of Extracellular Signal-Regulated Kinase-Mitogen-Activated Protein Kinase and c-Fos. J. Immunol.
171: 4984-4989
[Abstract]
[Full Text]
-
Nagase, H., Okugawa, S., Ota, Y., Yamaguchi, M., Tomizawa, H., Matsushima, K., Ohta, K., Yamamoto, K., Hirai, K.
(2003). Expression and Function of Toll-Like Receptors in Eosinophils: Activation by Toll-Like Receptor 7 Ligand. J. Immunol.
171: 3977-3982
[Abstract]
[Full Text]
-
Lore, K., Betts, M. R., Brenchley, J. M., Kuruppu, J., Khojasteh, S., Perfetto, S., Roederer, M., Seder, R. A., Koup, R. A.
(2003). Toll-Like Receptor Ligands Modulate Dendritic Cells to Augment Cytomegalovirus- and HIV-1-Specific T Cell Responses. J. Immunol.
171: 4320-4328
[Abstract]
[Full Text]
-
Mohty, M., Vialle-Castellano, A., Nunes, J. A., Isnardon, D., Olive, D., Gaugler, B.
(2003). IFN-{alpha} Skews Monocyte Differentiation into Toll-Like Receptor 7-Expressing Dendritic Cells with Potent Functional Activities. J. Immunol.
171: 3385-3393
[Abstract]
[Full Text]
-
Urosevic, M., Maier, T., Benninghoff, B., Slade, H., Burg, G., Dummer, R.
(2003). Mechanisms Underlying Imiquimod-Induced Regression of Basal Cell Carcinoma In Vivo. Arch Dermatol
139: 1325-1332
[Abstract]
[Full Text]
-
Hurwitz, D. J., Pincus, L., Kupper, T. S.
(2003). Imiquimod: A Topically Applied Link Between Innate and Acquired Immunity. Arch Dermatol
139: 1347-1350
[Full Text]
-
Jefford, M., Schnurr, M., Toy, T., Masterman, K.-A., Shin, A., Beecroft, T., Tai, T. Y., Shortman, K., Shackleton, M., Davis, I. D., Parente, P., Luft, T., Chen, W., Cebon, J., Maraskovsky, E.
(2003). Functional comparison of DCs generated in vivo with Flt3 ligand or in vitro from blood monocytes: differential regulation of function by specific classes of physiologic stimuli. Blood
102: 1753-1763
[Abstract]
[Full Text]
-
Lund, J., Sato, A., Akira, S., Medzhitov, R., Iwasaki, A.
(2003). Toll-like Receptor 9-mediated Recognition of Herpes Simplex Virus-2 by Plasmacytoid Dendritic Cells. JEM
198: 513-520
[Abstract]
[Full Text]
-
Doxsee, C. L., Riter, T. R., Reiter, M. J., Gibson, S. J., Vasilakos, J. P., Kedl, R. M.
(2003). The Immune Response Modifier and Toll-Like Receptor 7 Agonist S-27609 Selectively Induces IL-12 and TNF-{alpha} Production in CD11c+CD11b+CD8- Dendritic Cells. J. Immunol.
171: 1156-1163
[Abstract]
[Full Text]
-
Kerkmann, M., Rothenfusser, S., Hornung, V., Towarowski, A., Wagner, M., Sarris, A., Giese, T., Endres, S., Hartmann, G.
(2003). Activation with CpG-A and CpG-B Oligonucleotides Reveals Two Distinct Regulatory Pathways of Type I IFN Synthesis in Human Plasmacytoid Dendritic Cells. J. Immunol.
170: 4465-4474
[Abstract]
[Full Text]
-
Hemmi, H., Kaisho, T., Takeda, K., Akira, S.
(2003). The Roles of Toll-Like Receptor 9, MyD88, and DNA-Dependent Protein Kinase Catalytic Subunit in the Effects of Two Distinct CpG DNAs on Dendritic Cell Subsets. J. Immunol.
170: 3059-3064
[Abstract]
[Full Text]
-
Mazzoni, A., Leifer, C. A., Mullen, G. E. D., Kennedy, M. N., Klinman, D. M., Segal, D. M.
(2003). Cutting Edge: Histamine Inhibits IFN-{alpha} Release from Plasmacytoid Dendritic Cells. J. Immunol.
170: 2269-2273
[Abstract]
[Full Text]
-
Tsujimura, H., Tamura, T., Ozato*, K.
(2003). Cutting Edge: IFN Consensus Sequence Binding Protein/IFN Regulatory Factor 8 Drives the Development of Type I IFN-Producing Plasmacytoid Dendritic Cells. J. Immunol.
170: 1131-1135
[Abstract]
[Full Text]
-
Miller, J. L., Anders, E. M.
(2003). Virus-cell interactions in the induction of type 1 interferon by influenza virus in mouse spleen cells. J. Gen. Virol.
84: 193-202
[Abstract]
[Full Text]