|
||
Intrinsic Defect in T Cell Production of Interleukin (IL)-13 in the Absence of Both IL-5 and Eotaxin Precludes the Development of Eosinophilia and Airways Hyperreactivity in Experimental Asthma
2 University Children's Hospital of Freiburg, D-79106 Freiburg, Germany
3 Department of Molecular Biosciences, University of Adelaide, South Australia 5005, Australia
4 Division of Allergy and Immunology, Department of Pediatrics, Children's Hospital Medical Center, Cincinnati, OH 45229
5 Medical Research Council Laboratory of Molecular Biology, Cambridge CB2 2QH, United Kingdom
Address correspondence to Paul S. Foster, Allergy and Inflammation Group, Division of Biochemistry and Molecular Biology, The John Curtin School of Medical Research, Australian National University, Canberra, ACT, 0200, Australia. Phone: 61-261252032; Fax: 61-261250415; E-mail: Paul.Foster{at}anu.edu.au
| Abstract |
|---|
|
|
|---|
Key Words: allergy cytokines eosinophils lung inflammation
| Introduction |
|---|
|
|
|---|
Although the etiology and pathophysiology of asthma are complex, two independent models have been proposed as possible key mechanisms whereby Th2 cells regulate disease processes that predispose to structural and functional alterations of the airways. The first model identifies IL-5regulated eosinophilia as a central pathogenic pathway. IL-5 regulates eosinophil function (development, activation, migration, and survival) and is a critical molecular switch for the induction of blood and tissue eosinophilia. This model is based on extensive clinical and experimental investigations that show a strong correlation between IL-5, eosinophils, and their secreted products with the severity and exacerbation of disease (312). The second model provides evidence that IL-13 underscores the development of mucus hypersecretion and AHR in the allergic lung, and implies dissociation between eosinophilia and these phenomena (13, 14). Although in comparison to IL-5 the data on the role of IL-13 in asthma are limited, the potency of this molecule in inducing AHR and mucus hypersecretion in experimental models has provided compelling evidence for a key pathogenic role in the induction of airways obstruction (1315). Furthermore, production or expression of IL-13 and its receptor subunits have been directly linked to asthma and cells that play key roles in pathogenesis (1618). Although these two models have been viewed as independent effector pathways, IL-13 has been shown to promote eosinophilia by IL-5 and eotaxin- (a CC chemokine) regulated mechanisms, which suggests that these molecules may cooperate to regulate certain aspects of the asthma phenotype (1921).
Although extensive investigations have implicated IL-5regulated eosinophilia as a central effector mechanism in asthma and an important clinical target for the resolution of this disease, the role of this pathway in the development and exacerbation of pathogenesis remains highly controversial. In experimental models, the inhibition of the actions of IL-5 consistently suppress pulmonary eosinophilia in response to antigen inhalation, however, this effect does not always correlate with a reduction of AHR (9, 10, 2225). Indeed, this dichotomy is highlighted by findings from our laboratory in which allergic IL-5deficient (IL-5-/-) mice of the C57BL/6 strain (10) do not develop antigen-induced AHR, whereas BALB/c mice develop enhanced reactivity independently of this factor (23). Recent clinical trials with humanized monoclonal antibodies raised against IL-5 limited eosinophil migration into the lung, but also failed to resolve AHR (26). In a small number of studies, eosinophils have also been dissociated from the induction of AHR in asthma (27, 28).
These antiIL-5 studies indicate that mechanisms may operate in the allergic lung independently of this cytokine and eosinophils to induce disease, however, they do not unequivocally dissociate this cell from pathological processes. Although we and others have observed that eosinophil trafficking to the allergic lung is profoundly attenuated in IL-5-/- mice or those treated with antiIL-5 antibodies by comparison to wild-type (WT) responses, a significant residual tissue eosinophilia can persist in these mice after allergen inhalation (9, 10, 22, 23, 25). Often, eosinophils in IL-5depleted mice are present in the tissue even though they are almost absent from bronchalveolar lavage fluid. Furthermore, the degree of residual tissue eosinophilia directly correlates with the development of AHR and is under genetic regulation. In allergic IL-5-/- mice, tissue eosinophilia is 10100-fold greater in the BALB/c strain where AHR persists in comparison to the C57BL/6 strain where airways reactivity is abolished (10, 23). Thus, it is important to recognize that antiIL-5 treatment may not completely inhibit the accumulation of eosinophils in the allergic lung and that the residual cells may still contribute to pathogenesis through other regulatory processes.
One possibility is that local chemokine systems can operate independently of IL-5 to recruit eosinophils into the allergic lung. Of particular interest in allergic inflammation is the role of the eosinophil chemokine, eotaxin, because of its demonstrated potency and selectivity for eosinophil recruitment in experimental models and its strong clinical association with disease in humans (18, 2933). Eotaxin production is also regulated by IL-13. Furthermore, although IL-5 is a cofactor for eotaxin-induced eosinophilia, we have also observed that this chemokine can regulate eosinophil migration independently of IL-5 (29). Similarly, we have shown that eotaxin plays a more pronounced role in contrast to IL-5 in regulating eosinophil recruitment to sites of allergic inflammation of the gastrointestinal tract (34). Thus, the secretion of IL-13 from activated Th2 cells may promote eotaxin production and eosinophil accumulation, and this pathway may contribute to disease processes independently of IL-5.
To investigate the possibility that pathways operated by eotaxin in the allergic lung can contribute to eosinophil accumulation and disease progression in the absence of IL-5, we generated BALB/c mice deficient in both IL-5 and eotaxin (IL-5/eotaxin-/-). Our data show that eotaxin plays a critical role in regulating eosinophil accumulation in the allergic lung independently of IL-5. Eotaxin and IL-5 deficiency not only abolished tissue accumulation of eosinophils, but also impaired the ability of antigen-specific CD4+ T cells to produce IL-13 and precluded the development of AHR. Thus, IL-5 and eotaxin not only regulate eosinophil migration, they also supply intrinsic signals that either directly or indirectly modulate Th2 cell production of IL-13 and subsequently, bronchoconstriction.
| Materials and Methods |
|---|
|
|
|---|
49 transgene copies, male, 68-wk-old, and backcrossed to the 12th generation [35]) were obtained from the University of Adelaide (South Australia, Australia). Mice were treated according to the Australian National University Animal Welfare guidelines and were housed in an approved containment facility.
Induction of Allergic Airways Disease by OVA Sensitization.
68-wk-old mice were sensitized by intraperitoneal injection of 50 µg OVA/1 mg alhydrogel (Commonwealth Serum Laboratories) in 0.9% sterile saline. Nonsensitized mice received 1 mg alhydrogel in 0.9% saline. On days 12, 14, 16, and 18, all groups of mice were aeroallergen challenged with OVA (antigen) as previously described (10). 24 h after the last challenge, AHR was measured, the mice were killed by cervical dislocation, and T cell responses and inflammation and morphological changes to the airways were characterized.
Isolation of Donor Eosinophils.
Donor eosinophils for in vivo transfer and in vitro stimulation were derived from the peritoneal cavity of naive IL-5 Tg BALB/c mice and isolated using a FACStarTM Plus flow cytometer (Becton Dickinson) based on the forward, side, and light scatter properties of these cells as previously described (29). The purity of the eosinophils was measured on cytospin preparations and was
98%. The contaminating population consisted of macrophages and neutrophils and was devoid of lymphocytes (unpublished data).
Generation of Allergen-specific CD4+ T Cells.
OVA-specific CD4+ T cells were derived from mice that had been sensitized with OVA as previously described. In some experiments, mice received 2 x 106 eosinophils by intraperitoneal injection on the day of sensitization and again 3 d later. 6 d after sensitization, recipient mice were killed by cervical dislocation, the spleens were excised, and the splenocytes were disaggregated. Erythrocytes were lysed and the washed splenocytes were resuspended at 5 x 106 cells/ml in MLC with 10% heat-inactivated FCS, L-glutamine (2 mM), and neomycin sulfate (50 mg/liter). Splenocytes were then cultured for 4 d at 37°C in the presence of 200 µg/ml OVA to generate OVA-specific T cells. CD4+ T cells were then isolated using high gradient magnetic MiniMACS separation columns (Miltenyi Biotec) as previously described (15). 2 x 106 purified CD4+ T cells were then washed and resuspended in PBS and transferred to naive recipients. Purified CD4+ T cell populations were also analyzed for OVA-specific cytokine production. The purity of the enriched CD4+ cell fraction was uniformly >96% as determined by flow cytometry (unpublished data) and was devoid of granulocytes.
Antigen-specific Cytokine Production from Purified CD4+ T Cell Populations.
T cells (5 x 105 cells/well) were incubated with 25 µg/ml freshly isolated mitomycin Ctreated splenocytes (5 x 105 cells/well) or purified eosinophils (2.5 x 105 cells/well) in complete medium in the presence of 200 µg/ml OVA in 96-well plates (250 µl/well) for 96 h to determine cytokine production. Cell-free culture supernatants were then collected and stored in aliquots at -70°C until analysis.
The Role of CD4+ T Cellderived IL-13 in the Induction of AHR.
2 x 106 CD4+ T cells (WT or IL-13deficient) were injected intravenously to naive recipient BALB/c WT or IL-5/eotaxin-/- mice. Control mice received PBS vehicle intravenously. 24 h after the adoptive transfer, mice were exposed to an aerosol of 10 mg/ml OVA in 0.9% saline for 30 min and then every day for 6 d. AHR to methacholine was measured 24 h after the last aeroallergen challenge and lung inflammation and morphology were characterized as previously described (10, 15, 36). In some experiments, recombinant murine IL-13 or PBS was instilled to the trachea of IL-5/eotaxin-/- mice as previously described (20) and AHR was measured 48 h later.
Characterization of Lung Morphology.
Lung tissue representing the central (bronchi-bronchiole) and peripheral (alveoli) airways were fixed in 10% phosphate-buffered formalin, sectioned, and stained with Carbol's chromotrope-hematoxylin for the identification of eosinophils. The number of eosinophils in the central bronchibronchiole area were identified by morphological criteria and quantified as previously described (10, 36).
Stimulation of Peribronchial Lymph Nodes (PBLNs).
PBLNs were excised and filtered through nylon mesh (70 µm). The filtrate was then centrifuged at 500 g for 5 min at 4°C and the cell pellet was resuspended in red blood cell lysis solution and centrifuged at 500 g for 5 min at 4°C. The resulting pellet was cultured (5 x 105 cells/well) in complete medium in the presence of 200 µg/ml OVA in 96-well plates (250 µl/well) for 96 h. Cell-free culture supernatants were then collected and stored in aliquots at -70°C until cytokine levels were determined.
Analysis of Cytokines by ELISA.
IL-13 (R&D Systems), IL-4, and IL-5 (both from BD PharMingen) concentrations were determined in culture supernatants from OVA-stimulated CD4+ T cells and OVA-stimulated PBLN homogenates by ELISA according to the manufacturer's protocol.
Measurement of AHR.
Responsiveness to ß-methacholine (methacholine) was assessed in conscious, unrestrained mice by barometric plethysmography, using apparatus and software supplied by Buxco Electronics. This system yields a dimensionless parameter known as enhanced pause (Penh) that reflects changes in wave form of the pressure signal from the plethysmography chamber combined with a timing comparison of early and late expiration. Measurement was performed as previously described (36). Notably, we have confirmed in the BALB/c strain that changes in Penh in response to methacholine directly correlate with changes in airway resistance to this spasmogen (20). Thus, measuring changes in Pehn reflects alterations in resistance and is indicative of enhanced airways responsiveness.
Stimulation of Purified Eosinophils.
2 x 106 FACS®-purified eosinophils were incubated with 10 µg/ml antimouse CD28 for 18 h in complete medium in 24-well culture plates in the presence or absence of recombinant IL-5 (20 ng/ml). For stimulation with IgA/anti-IgA, highly purified eosinophils were first incubated with secretory IgA at a final concentration of 5 µg/ml. After 1 h of incubation at 37°C, cells were transferred into 24-well plates and stimulated with 10 µg/ml anti-IgA monoclonal antibody for 18 h in the presence of recombinant IL-5 (20 ng/ml). After an 18-h culture, cell viability was determined by trypan blue exclusion (>90% viable cells) and RNA was extracted from
2 x 106 eosinophils.
Reverse Transcription (RT)-PCR Analysis.
Total RNA was isolated from PBLN cells and eosinophils by standard methods with RNAzol B (Biotech Laboratories). An RT-PCR procedure was performed as previously described (37) to determine the relative quantities of mRNA for various cytokines. The primers and probes for all genes were purchased from GIBCO BRL. Primer and probe sequences for HPRT have been described elsewhere (38). Primer and probe sequences for IL-4, IL-5, IL-13, IL-12, CCR3, IL-18, and eotaxin are as follows: IL-4: sense, GAATGTACCAGGAGCCATATC, antisense, CTCAGTACTACGAGTAATCCA, probe, AGGGCTTCCAAGGTGCTTCGCA; IL-5: sense, GACAAGCAATGAGACACGATGAGG, antisense, GAACTCTGCAGGTAATCCAGG, probe, GGGGGTACTGTGGAAATGCTTAT; IL-13: sense, CTCCCTCTGACCCTTAAGGAG, antisense, GAAGGGGCCGTGGCGAAA-CAG, probe, TCCAATTGCAATGCCATCTAC; IL-12(p40): sense, CGTGCTCATGGCTGGTGCAAAG, antisense, CTTCATCTGCAAGTTCTTGGGC, probe, TCTGTCTGCAGAGAAGGTCACA; CCR3: sense, AAG TAC AGG AAG CTA CAA ATT ATG, antisense, AGC AGA GTT TTA ATG ATT CCT GAG, probe, GGCCTTGCAGGACTGGCAGC; IL-18: sense, ACT GTACAACCGCAGTAATACGG, antisense, AGTGAACATTACAGATTTATCCC, probe, GAACAAGATCATTTCCTTTGAGG; and eotaxin: sense, TCCACCATGCAGAGCTCCACAG, antisense, CCCACATCTCCTTTCAT-GCCCC, probe, GGAACACAATGGGACGAGTTAGG. After the appropriate number of PCR cycles, the amplified DNA was analyzed by gel electrophoresis and Southern blotting, and detected using the enhanced chemiluminescence detection system as recommended by the manufacturer (Amersham Pharmacia Biotech). PCR amplification with the HPRT reference gene was performed to assess variations in cDNA or total RNA loading between samples.
Generation of Th2 Cells from Naive CD4+ T Cells.
CD4+ T cells from naive mice were isolated from splenocytes with magnetic-activated cell sorting and cultured at 5 x 106 cells/ml in complete medium in the presence of anti-CD3 (50 ng/ml; clone 2C11), recombinant murine IL-4 (20 ng/ml), and antiIFN-
(40 µg/ml; clone R46A2) for 4 d to generate Th2 cells (15). In some experiments, recombinant IL-18 (20 or 200 ng/ml; R&D Systems) was also added to the cultures. Th2 cells (1.25 x 106 cells/well) were then restimulated in the presence of anti-CD3 (50 ng/ml) and anti-CD28 (1 µg/ml) in 96-well plates (250 µl/well) for 72 h to determine cytokine release. Cell-free culture supernatants were collected and stored in aliquots at -70°C until analysis by ELISA.
Collection of Sputum Samples.
Children with moderate, persistent asthma were recruited from the outpatient department at the University Children's Hospital of Freiburg (Freiburg, Germany). The diagnosis of asthma was based according to the criteria of the American Thoracic Society (39). The patients were in a stable condition and had been free of respiratory infections. All patients were under continuous inhalation treatment with 400800 µg budesonide per day. Sputum induction was performed as previously described (40). In brief, 10 min after the inhalation of 200 µg salbutamol, subjects inhaled hypertonic saline (3, 4, and 5%) via an ultrasonic nebulizer (Ultraneb 2000; De Villbiss) with the output set at maximum (4.5 ml/min) for three consecutive periods of 10 min for each concentration. Lung function was recorded before the procedure and every 5 min for safety by using a Masterscope 4.0 (Jaeger). To collect sputum, subjects were asked to rinse their mouth, blow their nose, swallow water, and then expectorate the sputum onto a plastic Petri dish after the first 10-min period of inhalation and every 5 min thereafter. Adequate plugs of sputum were selected to reduce contamination with saliva and were processed immediately. Sputum processing was performed as previously described (40). In brief, the weight of selected plugs was determined and twice their volume of dithiothreitol 0.1% (sputalysin; Calbiochem) was added. Samples were placed in a water bath at 37°C for 15 min to ensure the complete dissolution and PBS was added to achieve a 25-fold diluted final concentration. Cell-free supernatant was stored at -70°C until additional analysis was performed. Eosinophil cationic protein (ECP; detection limit: 4 ng/ml, diluted sample: 100 ng/ml; Pharmacia & Upjohn) and IL-18 (detection limit: 12 pg/ml, diluted sample: 300 pg/ml; Medical & Biological Laboratories Co Ltd.) were measured in the supernatants of the selected plugs. The study was approved by the ethics committee of the Albert-Ludwigs University of Freiburg (Freiburg, Germany) and written informed consent from parents and patients was obtained in advance.
Statistical Analysis.
The significance of the differences between experimental groups was analyzed using Student's unpaired t test. Values were reported as the mean ± SEM. Differences in mean values were considered significant if P < 0.05. The relation between variables was calculated using Spearmann's rank correlation coefficients.
| Results |
|---|
|
|
|---|
|
IL-13 Production by Antigen-specific CD4+ T Cells and in PBLNs Is Impaired in the Absence of IL-5 and Eotaxin.
As signals elicited by CD4+ T cells have been shown to play an obligatory role in the induction of AHR (2), the impact of IL-5/eotaxin deficiency on CD4+ T cell production of IL-13, IL-4, and IL-5 was examined after their isolation from allergic WT, IL-5-/-, eotaxin-/-, and IL-5/eotaxin-/- mice. After in vitro antigen stimulation of whole splenocyte populations taken from allergic mice, CD4+ T cells were isolated and restimulated at equivalent numbers (5 x 105 cells/well = 2 x 106 cells/ml) with antigen-loaded mitomycin Ctreated splenocytes (Fig. 2 , ac). Stimulation of IL-5-/-, eotaxin-/-, IL-5/eotaxin-/-, and WT CD4+ T cells under identical conditions promoted the production of equivalent levels of IL-4 but not IL-13 (Fig. 2, a and b). The level of IL-13 produced by IL-5-/-, eotaxin-/-, or IL-5/eotaxin-/- CD4+ T cells was significantly reduced when compared with those derived from WT mice (Fig. 2 a). Notably, the levels of IL-13 in IL-5/eotaxin-/- CD4+ T cell cultures were 10-fold less compared with WT cultures and were further reduced in comparison to the levels observed with IL-5-/- or eotaxin-/- mice. The reduced levels of IL-13 did not correlate with an overall suppression in Th2-type cytokine production, as IL-5 levels produced by eotaxin-/- CD4+ T cells and IL-4 levels in all cultures were similar to those observed in WT CD4+ T cell cultures (Fig. 2, b and c).
|
Transfer of IL-13producing Antigen-specific CD4+ T Cells to Naive IL-5/Eotaxin-/- Mice Reconstitutes Normal IL-13 Levels in the Allergic Lung and Induces AHR and Eosinophilia.
The observations in allergic IL-5/eotaxin-/- mice suggested that the absence of these molecules resulted in the abolition of AHR by limiting the ability of CD4+ T cells to produce IL-13. Therefore, we adoptively transferred WT antigen-specific CD4+ T cells that are competent in their ability to produce IL-4, IL-5, and IL-13 to naive WT and IL-5/eotaxin-/- mice to directly determine the contribution of T cellderived IL-13 (in association with IL-5) to the induction of disease. Transfer of these CD4+ T cells (2 x 106) into naive WT mice followed by the subsequent delivery of antigen (OVA) to the airways induced the hallmark features of allergic airways inflammation, which included AHR, mucus hypersecretion (unpublished data), and peripheral blood and pulmonary eosinophilia (Fig. 3
, ac). Adoptive transfer of this CD4+ T cell population into naive IL-5/eotaxin-/- mice also induced AHR to levels observed in WT mice (Fig. 3 a). However, in the absence of endogenous IL-5 and eotaxin, although peripheral blood and pulmonary eosinophilia were induced, responses were attenuated in comparison to the WT (Fig. 3, b and c). Concomitant with the transfer of CD4+ T cells, the levels of IL-4, IL-5, and IL-13 increased in the lung (PBLN; Fig. 3, df). Stimulation of PBLN cultures from IL-5/eotaxin-/- and WT-recipient mice with antigen promoted the production of IL-4, IL-13, and IL-5 (Fig. 3, df). The levels of IL-13 and IL-4 produced in PBLN cultures from IL-5/eotaxin-/- mice were similar to those observed in WT mice (Fig. 3, d and e). In contrast, the level of IL-5 produced from IL-5/eotaxin-/- cultures was significantly lower than that observed in WT mice (Fig. 3 f). This latter finding can be explained by the inability of the recipient's endogenous PBLN cells to produce IL-5 and is consistent with the observed reduction in peripheral blood and pulmonary eosinophilia in IL-5/eotaxin-/- mice receiving CD4+ T cells in comparison with WT responses (Fig. 3, b and c). Thus, by overcoming the functional defect in the production of IL-13 and IL-5 within the CD4+ T cell compartment, the hallmarks of allergic asthma could be induced in IL-5/eotaxin-/- mice. These data also show that T cell activation processes by antigen are functional in IL-5/eotaxin-/- mice.
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
chain, which is essential for IL-5 signal transduction, is expressed in B lymphocytes and in limited studies has been implicated in the generation of cytotoxic T lymphocytes, its expression in CD4+ Th cells has not been observed (43, 44). A direct effect of IL-5 on this subclass of lymphocyte is therefore unlikely. Furthermore, CD4+ T cell production of IL-5 was not impaired in allergic eotaxin-/- mice (Fig. 2), which suggests that the T cell defect was not due solely to the absence of IL-5, but to involved processes downstream of these molecules. Notably, in allergic IL-5-/- C57BL/6 mice, IL-13 levels (unpublished data) in PBLN were lower than those reported here in IL-5-/- BALB/c mice, further linking total tissue eosinophil numbers with IL-13 production and the development of AHR. Our data support recent investigations that show eosinophils can modulate CD4+ T cell function. Eosinophils in the allergic lung can present antigen and traffic to local lymph nodes where they colocalize with T cells (45) and this granulocyte can induce proliferation and cytokine secretion from Th2 cells (46). Eosinophils can also secrete a wide range of T cell growth and chemotactic factors (47). Thus, evidence is emerging that eosinophils may not only act as terminal effector cells, but can also actively modulate allergic inflammation by amplifying type 2 cytokine responses.
Notably, eosinophil deficiency did not predispose to a generalized deficiency in CD4+ T cell cytokine production, nor in the ability of the immune system to activate this T cell. IL-4 secretion was not significantly altered in CD4+ T cells derived from mice deficient in IL-5, eotaxin, or IL-5 and eotaxin. Furthermore, the transfer of WT CD4+ T cells to eotaxin/IL-5-/- mice not only highlighted the importance of T cells and presumably T cellderived IL-13 for the onset of AHR and pathophysiology, but also demonstrated that normal activation mechanisms for T cells can operate in the absence of eosinophils. The specific role for IL-13 in the mechanism of AHR was demonstrated by the transfer of IL-13deficient T cells to eotaxin/IL-5-/- mice where AHR did not develop, and the delivery of IL-13 alone to the airway microenvironment, inducing AHR, of these factor-deficient mice. Thus, these data suggest that the CD4+ T cell defect may relate specifically to impaired production of IL-13 and that eosinophils can provide a factor that either directly or indirectly regulates IL-13 production. The limitation in T cell IL-13 production predisposes to the abrogation of AHR.
The molecular mechanisms that regulate IL-13 production in T cells are largely unknown. However, we were interested in the role of IL-18 as this cytokine has been identified not only as a modulator of both Th1 and Th2 development (41, 48), but more importantly as a potent cofactor for the regulation of the expression of IL-13 from T cells (41). Notably, in the allergic lymph nodes from WT, IL-5-/-, or IL-5/eotaxin-/- mice, the levels of expression of IL-18 directly correlated with the levels of IL-13, the production of IL-13 mRNA, and the number of eosinophils localized to this compartment. Furthermore, eosinophils primed with IL-5 and stimulated with molecules that promote cytokine production in this cell showed that IL-18 expression was up-regulated. Thus, eosinophils, through the secretion of IL-18, may potentially regulate IL-13 production from CD4+ T cells located within the same microenvironment. Indeed, we were able to show a direct correlation between the number of eosinophils within the microenvironment of naive CD4+ T cells and their subsequent ability to produce IL-13 after clonal expansion to the Th2 phenotype. Th2 cells derived from the spleens of IL-5/eotaxin-/- mice where eosinophils are absent were limited in their ability to produce IL-13, whereas Th2 cells generated from the spleens of IL-5 Tg mice where eosinophils are overly abundant produced exaggerated levels of this cytokine in comparison to WT Th2 cells. Furthermore, the addition of IL-18 to cultures during polarization restored the ability of Th2 cells derived from eosinophil-deficient mice to produce normal levels of IL-13. Current data on the role of IL-18 in the regulation of Th2 immune responses are paradoxical (41, 48) as it has been shown to both suppress and amplify allergic responses. However, this cytokine has been shown to regulate IL-13 production from Th2 cells and promote eotaxin production and eosinophilia (49, 50). Recently, higher serum levels of IL-18 have been observed in patients with acute asthma exacerbation. Our data in stable asthmatics indicate a close correlation between IL-18 and ECP in induced sputum. This result, derived directly from the bronchial system, further supports a link between IL-18, eosinophils, and the pathogenesis of allergic airways inflammation.
The synonymous association between IL-5 and eosinophilia in conjunction with clinical trial data has propagated the concept that eosinophils are not central mediators of asthma but rather bystander cells recruited to the airways in response to aberrant Th2 cell activation. This concept is also supported by some studies in animal models. However, these investigations have failed to consider the relevance of pathways that may recruit eosinophils into tissues independently of IL-5 to disease processes. Here we demonstrate that eosinophils might be recruited to the allergic lung independently of IL-5 by eotaxin-dependent mechanisms and that this eosinophilia is directly linked to the development of disease. Eosinophilia, albeit reduced, is also a predominant feature in the lung of IL-5-/- mice infected with Toxocara canis (51). Thus, although eotaxin and IL-5 cooperate to regulate eosinophil recruitment to the allergic lung, they can also operate independently of one another to induce eosinophil accumulation. However, in the absence of both of these molecules, eosinophil accumulation in the allergic lung was ablated and AHR did not develop. These data indicate that although IL-5 can amplify eosinophil recruitment to the allergic lung, the primary role of this cytokine appears to be in the promotion of eosinophilia in the blood and bone marrow compartments in response to antigen provocation. Notably, in the absence of IL-5, eotaxin induced the recruitment of eosinophils to the lung without significant blood eosinophilia or expansion of the eosinophil pool in the bone marrow. Apparently, eosinophils produced by steady-state hematopoiesis and/or residing in tissues can be efficiently recruited by eotaxin to the allergic lung in the absence of IL-5. In previous investigations eotaxin has been shown not only to promote eosinophil accumulation in tissues, but also induce the release of this cell and its progenitors from the bone marrow (52). The lower abundance of eosinophils in the blood of allergic IL-5-/- mice may mask the development of eosinophilia in this compartment in response to eotaxin. Further, it is likely that once eosinophils and/or progenitors enter the circulation in IL-5-/- mice in response to eotaxin they are rapidly sequestered into the allergic lung. Indeed, evidence is accumulating for a local pulmonary role for eosinophil progenitors in the pathogenesis of allergic disease (53). Potentially, in the absence of IL-5, eotaxin may regulate the recruitment of eosinophils and progenitors to the allergic lung that then undergo maturation in the Th2 immune environment.
In summary, our data demonstrate that eosinophils are able to accumulate in allergic lungs of BALB/c mice in the absence of IL-5 and promote disease. A key role for eosinophils appears to be in the modulation of IL-13 production from CD4+ T cells. It is tempting to speculate that within the allergic lung, eosinophils may sequester antigen and localize to regional lymph nodes where they modulate IL-13 production from T cells during expansion by the secretion of IL-18. This mechanism may have evolved to promote the expulsion of parasites from the intestinal mucosa. Eosinophils loaded with parasitic antigens may enhance the production of IL-13 by T cells in gut-associated lymphoid tissue, which subsequently promotes the expulsion of the pathogen by increasing gastrointestinal motility by amplifying cholinergic responsiveness and enhancing mucus secretion. Collectively, our findings indicate that IL-5 and IL-13 signaling systems are not necessarily mutually exclusive effector mechanisms, and may also be integrated through eosinophils to regulate certain aspects of allergic disease. The observation that eosinophils may regulate disease processes in the absence of IL-5 has important implications for therapeutic approaches to allergic disorders. It is potentially dangerous to conclude that eosinophils do not play a role in generating AHR or other pathologies by using data from treatments that attenuate, but do not critically reduce eosinophil numbers in the allergic airways. Finally, our investigations are the first to identify a fundamental link between the innate (eosinophils) and adaptive (T cells) immune responses for the regulation of IL-13 production.
| Acknowledgments |
|---|
This work was supported by a Human Frontiers grant (R90262/1999-M 102) to P.S. Foster and M.E. Rothenberg, and a grant by the German Research Association (MA2241/1) to J. Mattes.
Submitted: January 3, 2002
Revised: April 3, 2002
Accepted: April 15, 2002
| Footnotes |
|---|
| References |
|---|
|
|
|---|
1
Bochner, B.S., B.J. Undem, and L.M. Lichtenstein. 1994. Immunological aspects of allergic asthma. Annu. Rev. Immunol. 12:295335.[CrossRef][Medline]
2
Wills-Karp, M. 1999. Immunological basis of antigen-induced airway hyperresponsiveness. Annu. Rev. Immunol. 17:255281.[CrossRef][Medline]
3
Gleich, G.J., and C. Adolphson. 1993. Bronchial hyperreactivity and eosinophil granule proteins. Agents Actions Suppl. 43:223230.[Medline]
4
Azzawi, M., B. Bradley, P.K. Jeffery, A.J. Frew, A.J. Wardlaw, G. Knowles, B. Assoufi, J.V. Collins, S. Durham, and A.B. Kay. 1990. Identification of activated T lymphocytes and eosinophils in bronchial biopsies in stable atopic asthma. Am. Rev. Respir. Dis. 142:14071413.[Medline]
5
Bentley, A.M., Q. Meng, D.S. Robinson, Q. Hamid, A.B. Kay, and S.R. Durham. 1993. Increases in activated T lymphocytes, eosinophils, and cytokine mRNA expression for interleukin-5 and granulocyte/macrophage colony-stimulating factor in bronchial biopsies after allergen inhalation challenge in atopic asthmatics. Am. J. Respir. Cell Mol. Biol. 8:3542.[Medline]
6
Sur, S., G.J. Gleich, M.C. Swanson, K.R. Bartemes, and D.H. Broide. 1995. Eosinophilic inflammation is associated with elevation of interleukin-5 in the airways of patients with spontaneous symptomatic asthma. J. Allergy Clin. Immunol. 96:661668.[CrossRef][Medline]
7
Jarjour, N.N., W.J. Calhoun, E.A. Kelly, G.J. Gleich, L.B. Schwartz, and W.W. Busse. 1997. The immediate and late allergic response to segmental bronchopulmonary provocation in asthma. Am. J. Respir. Crit. Care Med. 155:15151521.[Abstract]
8
Hamid, Q., M. Azzawi, S. Ying, R. Moqbel, A.J. Wardlaw, C.J. Corrigan, B. Bradley, S.R. Durham, J.V. Collins, P.K. Jeffery, et al. 1991. Expression of mRNA for interleukin-5 in mucosal bronchial biopsies from asthma. J. Clin. Invest. 87:15411546.[Medline]
9
Hamelmann, E., A. Oshiba, J. Loader, G.L. Larsen, G. Gleich, J. Lee, and E.W. Gelfand. 1997. Antiinterleukin-5 antibody prevents airway hyperresponsiveness in a murine model of airway sensitization. Am. J. Respir. Crit. Care Med. 155:819825.[Abstract]
10
Foster, P.S., S.P. Hogan, A.J. Ramsay, K.I. Matthaei, and I.G. Young. 1996. Interleukin 5 deficiency abolishes eosinophilia, airways hyperreactivity, and lung damage in a mouse asthma model. J. Exp. Med. 183:195201.
11
Gleich, G.J., N.A. Flavahan, T. Fujisawa, and P.M. Vanhoutte. 1988. The eosinophil as a mediator of damage to respiratory epithelium: a model for bronchial hyperreactivity. J. Allergy Clin. Immunol. 81:776781.[CrossRef][Medline]
12
Robinson, D., Q. Hamid, A. Bentley, S. Ying, A.B. Kay, and S.R. Durham. 1993. Activation of CD4+ T cells, increased TH2-type cytokine mRNA expression, and eosinophil recruitment in bronchoalveolar lavage after allergen inhalation challenge in patients with atopic asthma. J. Allergy Clin. Immunol. 92:313324.[CrossRef][Medline]
13
Grunig, G., M. Warnock, A.E. Wakil, R. Venkayya, F. Brombacher, D.M. Rennick, D. Sheppard, M. Mohrs, D.D. Donaldson, R.M. Locksley, et al. 1998. Requirement for IL-13 independently of IL-4 in experimental asthma. Science. 282:22612263.
14
Wills-Karp, M., J. Luyimbazi, X. Xu, B. Schofield, T.Y. Neben, C.L. Karp, and D.D. Donaldson. 1998. Interleukin-13: central mediator of allergic asthma. Science. 282:22582261.
15
Mattes, J., M. Yang, A. Siqueira, K. Clark, J. MacKenzie, A.N. McKenzie, D.C. Webb, K.I. Matthaei, and P.S. Foster. 2001. IL-13 induces airways hyperreactivity independently of the IL-4R alpha chain in the allergic lung. J. Immunol. 167:16831692.
16
Kroegel, C., P. Julius, H. Matthys, J.C. Virchow, Jr., and W. Luttmann. 1996. Endobronchial secretion of interleukin-13 following local allergen challenge in atopic asthma: relationship to interleukin-4 and eosinophil counts. Eur. Respir. J. 9:899904.[Abstract]
17
Huang, S.K., H.Q. Xiao, J. Kleine-Tebbe, G. Paciotti, D.G. Marsh, L.M. Lichtenstein, and M.C. Liu. 1995. IL-13 expression at the sites of allergen challenge in patients with asthma. J. Immunol. 155:26882694.[Abstract]
18
Ying, S., D.S. Robinson, Q. Meng, J. Rottman, R. Kennedy, D.J. Ringler, C.R. Mackay, B.L. Daugherty, M.S. Springer, S.R. Durham, et al. 1997. Enhanced expression of eotaxin and CCR3 mRNA and protein in atopic asthma. Association with airway hyperresponsiveness and predominant co-localization of eotaxin mRNA to bronchial epithelial and endothelial cells. Eur. J. Immunol. 27:35073516.[Medline]
19
Matsukura, S., C. Stellato, S.N. Georas, V. Casolaro, J.R. Plitt, K. Miura, S. Kurosawa, U. Schindler, and R.P. Schleimer. 2001. Interleukin-13 upregulates eotaxin expression in airway epithelial cells by a STAT6-dependent mechanism. Am. J. Respir. Cell Mol. Biol. 24:755761.
20
Yang, M., S.P. Hogan, P.J. Henry, K.I. Matthaei, A.N. McKenzie, I.G. Young, M.E. Rothenberg, and P.S. Foster. 2001. Interleukin-13 mediates airways hyperreactivity through the IL-4 receptor-alpha chain and STAT-6 independently of IL-5 and eotaxin. Am. J. Respir. Cell Mol. Biol. 25:522530.
21
Zhu, Z., R.J. Homer, Z. Wang, Q. Chen, G.P. Geba, J. Wang, Y. Zhang, and J.A. Elias. 1999. Pulmonary expression of interleukin-13 causes inflammation, mucus hypersecretion, subepithelial fibrosis, physiologic abnormalities, and eotaxin production. J. Clin. Invest. 103:779788.[Medline]
22
Corry, D.B., H.G. Folkesson, M.L. Warnock, D.J. Erle, M.A. Matthay, J.P. Wiener-Kronish, and R.M. Locksley. 1996. Interleukin 4, but not interleukin 5 or eosinophils, is required in a murine model of acute airway hyperreactivity. J. Exp. Med. 183:109117 (erratum published 185:1715).
23
Hogan, S.P., K.I. Matthaei, J.M. Young, A. Koskinen, I.G. Young, and P.S. Foster. 1998. A novel T cell-regulated mechanism modulating allergen-induced airways hyperreactivity in BALB/c mice independently of IL-4 and IL-5. J. Immunol. 161:15011509.
24
Mauser, P.J., A. Pitman, A. Witt, X. Fernandez, J. Zurcher, T. Kung, H. Jones, A.S. Watnick, R.W. Egan, W. Kreutner, et al. 1993. Inhibitory effect of the TRFK-5 anti-IL-5 antibody in a guinea pig model of asthma. Am. Rev. Respir. Dis. 148:16231627.[Medline]
25
Nagai, H., S. Yamaguchi, N. Inagaki, N. Tsuruoka, Y. Hitoshi, and K. Takatsu. 1993. Effect of anti-IL-5 monoclonal antibody on allergic bronchial eosinophilia and airway hyperresponsiveness in mice. Life Sci. 53:L243L247.[CrossRef]
26
Leckie, M.J., A. ten Brinke, J. Khan, Z. Diamant, B.J. O'Connor, C.M. Walls, A.K. Mathur, H.C. Cowley, K.F. Chung, R. Djukanovic, et al. 2000. Effects of an interleukin-5 blocking monoclonal antibody on eosinophils, airway hyper-responsiveness, and the late asthmatic response. Lancet. 356:21442148.[CrossRef][Medline]
27
Djukanovic, R., J.W. Wilson, K.M. Britten, S.J. Wilson, A.F. Walls, W.R. Roche, P.H. Howarth, and S.T. Holgate. 1990. Quantitation of mast cells and eosinophils in the bronchial mucosa of symptomatic atopic asthmatics and healthy control subjects using immunohistochemistry. Am. Rev. Respir. Dis. 142:863871.[Medline]
28
McFadden, E.R., Jr. 1994. Asthma: morphologic-physiologic interactions. Am. J. Respir. Crit. Care Med. 150:S23S26.[Medline]
29
Mould, A.W., K.I. Matthaei, I.G. Young, and P.S. Foster. 1997. Relationship between interleukin-5 and eotaxin in regulating blood and tissue eosinophilia in mice. J. Clin. Invest. 99:10641071.[Medline]
30
Rothenberg, M.E., J.A. MacLean, E. Pearlman, A.D. Luster, and P. Leder. 1997. Targeted disruption of the chemokine eotaxin partially reduces antigen-induced tissue eosinophilia. J. Exp. Med. 185:785790.
31
Lamkhioued, B., P.M. Renzi, S. Abi-Younes, E.A. Garcia-Zepada, Z. Allakhverdi, O. Ghaffar, M.D. Rothenberg, A.D. Luster, and Q. Hamid. 1997. Increased expression of eotaxin in bronchoalveolar lavage and airways of asthmatics contributes to the chemotaxis of eosinophils to the site of inflammation. J. Immunol. 159:45934601.[Abstract]
32
Palframan, R.T., P.D. Collins, T.J. Williams, and S.M. Rankin. 1998. Eotaxin induces a rapid release of eosinophils and their progenitors from the bone marrow. Blood. 91:22402248.
33
Jose, P.J., D.A. Griffiths-Johnson, P.D. Collins, D.T. Walsh, R. Moqbel, N.F. Totty, O. Truong, J.J. Hsuan, and T.J. Williams. 1994. Eotaxin: a potent eosinophil chemoattractant cytokine detected in a guinea pig model of allergic airways inflammation. J. Exp. Med. 179:881887.
34
Hogan, S.P., A. Mishra, E.B. Brandt, M.P. Royalty, S.M. Pope, N. Zimmermann, P.S. Foster, and M.E. Rothenberg. 2001. A pathological function for eotaxin and eosinophils in eosinophilic gastrointestinal inflammation. Nat. Immunol. 2:353360.[CrossRef][Medline]
35
Dent, L.A., M. Strath, A.L. Mellor, and C.J. Sanderson. 1990. Eosinophilia in transgenic mice expressing interleukin 5. J. Exp. Med. 172:14251431.
36
Webb, D.C., A.N. McKenzie, A.M. Koskinen, M. Yang, J. Mattes, and P.S. Foster. 2000. Integrated signals between IL-13, IL-4, and IL-5 regulate airways hyperreactivity. J. Immunol. 165:108113.
37
Wynn, T.A., I. Eltoum, A.W. Cheever, F.A. Lewis, W.C. Gause, and A. Sher. 1993. Analysis of cytokine mRNA expression during primary granuloma formation induced by eggs of Schistosoma mansoni. J. Immunol. 151:14301440.[Abstract]
38
Mahalingam, S., J.M. Farber, and G. Karupiah. 1999. The interferon-inducible chemokines MuMig and Crg-2 exhibit antiviral activity in vivo. J. Virol. 73:14791491.
39
American Thoracic Society. 1987. Standards for the diagnosis and care of patients with chronic obstructive pulmonary disease (COPD) and asthma. This official statement of the American Thoracic Society was adopted by the ATS Board of Directors, November 1986. Am. Rev. Respir. Dis. 136:225244.[Medline]
40
Mattes, J., K. Storm van's Gravesande, U. Reining, K. Alving, G. Ihorst, M. Henschen, and J. Kuehr. 1999. NO in exhaled air is correlated with markers of eosinophilic airway inflammation in corticosteroid-dependent childhood asthma. Eur. Respir. J. 13:13911395.[Abstract]
41
Yoshimoto, T., H. Mizutani, H. Tsutsui, N. Noben-Trauth, K. Yamanaka, M. Tanaka, S. Izumi, H. Okamura, W.E. Paul, and K. Nakanishi. 2000. IL-18 induction of IgE: dependence on CD4+ T cells, IL-4 and STAT6. Nat. Immunol. 1:132137.[CrossRef][Medline]
42
Woerly, G., N. Roger, S. Loiseau, D. Dombrowicz, A. Capron, and M. Capron. 1999. Expression of CD28 and CD86 by human eosinophils and role in the secretion of type 1 cytokines (interleukin 2 and interferon
): inhibition by immunoglobulin A complexes. J. Exp. Med. 190:487495.
43
Takatsu, K., Y. Kikuchi, T. Takahashi, T. Honjo, M. Matsumoto, N. Harada, N. Yamaguchi, and A. Tominaga. 1987. Interleukin 5, a T-cell-derived B-cell differentiation factor also induces cytotoxic T lymphocytes. Proc. Natl. Acad. Sci. USA. 84:42344238.
44
Harada, N., M. Matsumoto, N. Koyama, A. Shimizu, T. Honjo, A. Tominaga, and K. Takatsu. 1987. T cell replacing factor/interleukin 5 induces not only B-cell growth and differentiation, but also increased expression of interleukin 2 receptor on activated B-cells. Immunol. Lett. 15:205215.[CrossRef][Medline]
45
Shi, H.Z., A. Humbles, C. Gerard, Z. Jin, and P.F. Weller. 2000. Lymph node trafficking and antigen presentation by endobronchial eosinophils. J. Clin. Invest. 105:945953.[Medline]
46
MacKenzie, J.R., J. Mattes, L.A. Dent, and P.S. Foster. 2001. Eosinophils promote allergic disease of the lung by regulating CD4(+) TH2 lymphocyte function. J. Immunol. 167:31463155.
47
Rothenberg, M.E. 1998. Eosinophilia. N. Engl. J. Med. 338:15921600.
48
Nakanishi, K., T. Yoshimoto, H. Tsutsui, and H. Okamura. 2001. Interleukin-18 regulates both Th1 and Th2 responses. Annu. Rev. Immunol. 19:423474.[CrossRef][Medline]
49
Wild, J.S., A. Sigounas, N. Sur, M.S. Siddiqui, R. Alam, M. Kurimoto, and S. Sur. 2000. IFN-gamma-inducing factor (IL-18) increases allergic sensitization, serum IgE, Th2 cytokines, and airway eosinophilia in a mouse model of allergic asthma. J. Immunol. 164:27012710.
50
Campbell, E., S.L. Kunkel, R.M. Strieter, and N.W. Lukacs. 2000. Differential roles of IL-18 in allergic airway disease: induction of eotaxin by resident cell populations exacerbates eosinophil accumulation. J. Immunol. 164:10961102.
51
Takamoto, M., K.S. Ovington, C.A. Behn, K. Sugane, I.G. Young, and K.I. Matthaei. 1997. Eosinophilia, parasite burden and lung damage in Toxocara canis infection in C57Bl/6 mice genetically deficient in IL-5. Immunology. 90:511517.[CrossRef][Medline]
52
Gibson, P.G., J. Dolovich, A. Girgis-Gabardo, M.M. Morris, M. Anderson, F.E. Hargreave, and J.A. Denburg. 1990. The inflammatory response in asthma exacerbation: changes in circulating eosinophils, basophils and their progenitors. Clin. Exp. Allergy. 20:661668.[CrossRef][Medline]
53
Inman, M.D., R. Ellis, J. Wattie, J.A. Denburg, and P.M. O'Byrne. 1999. Allergen-induced increase in airway responsiveness, airway eosinophilia, and bone-marrow eosinophil progenitors in mice. Am. J. Respir. Cell Mol. Biol. 21:473479.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|