|
|
|
|
|
|
|
||
Original Article |
sreiner{at}mail.med.upenn.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
3 cell divisions of expansion, most progeny will succumb to either proliferative arrest or death over the ensuing three cell divisions. The quantitative precision of the counterbalance hinges on the graded, time-independent induction of CTLA-4 expression during the first three cell divisions. In contrast to the limits imposed on unpolarized cells, T helper type 1 (Th1) and Th2 effector progeny may be rescued from proliferative arrest by interleukin (IL)-12 and IL-4 signaling, respectively, allowing appropriately stimulated progeny to proceed to the stage of tissue homing. These results suggest that the cell-autonomous regulation of CTLA-4 induction may be a central checkpoint of clonal expansion of CD4+ T cells, allowing temporally and spatially restricted growth of progeny to be dictated by the nature of the threat posed to the host.
Key Words: lymphocyte • CTLA-4 • cell cycle • CD4+ • CCR7
The phenotype of cytotoxic T lymphocyte antigen 4 (CTLA-4) deficiency in mice 91011 suggests that this receptor plays a central role in homeostasis. Together with other gain- and loss-of-function experiments, CTLA-4 has been implicated as a regulator of cell cycle 121314, anergy, tolerance 151617, autoimmunity 18, transplantation 18, effector choice 192021, and immunity to tumors 22 and foreign pathogens 232425. One explanation for how negative regulation by CTLA-4 might be involved in many disparate immunologic reactions is that its regulation and function are coupled to the proliferative program. It has become evident that the cell cycle organizes some changes in gene expression in CD4+ T cells that are critical for effector subset choice 262728 and effector-memory homing 2930. This suggests that many immunologic reactions, despite being cued by extrinsic variables, have levels of cell-autonomous control that are determined by the lineage relationship of proliferating cells 234.
We wished to determine the precise lineage relationship between cells that were engaged in a proliferative response when well-characterized variables of activation were experimentally manipulated. Using the dilution of carboxy-fluorescein diacetate succinimidyl ester (CFSE) to assess cell division 31, in conjunction with quantitation of cellularity and apoptosis, CD4+ T cells were found to have a cell-intrinsic mechanism to control their proliferation. The control mechanism can be ascribed to the graded, cell cycle–coupled regulation of the expression and function of the CTLA-4 receptor. These findings suggest that vastly different immunologic outcomes mediated by CD4+ T cells result from the integration of extrinsic stimuli with a cell-autonomous program of gene regulation that is linked to cell division.
Cell Culture.
Flow Cytometry.
Live, unfixed cells were washed in HBSS 1% FCS before staining. All antibodies were obtained from BD PharMingen, unless indicated. Flow cytometry was performed using a Becton Dickinson FACSCaliburTM instrument and CELLQuestTM software. Throughout the article, data represent only CD4+ events, based on specific staining with fluorochrome-conjugated anti-CD4 mAbs (Caltag). Unless specified, analysis includes only live (as determined by forward and side light scatter), CD4+ events. Gates for specific staining of surface or intracellular proteins were determined using fluorochrome-conjugated species-matched and, where possible, isotype-matched, control mAbs.
Cell Death and DNA Content.
Reverse Transcription PCR of CC Chemokine Receptor 7 Expression.
Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Proliferation and differentiation of CD4+ T cells are regulated by numerous extrinsic signaling pathways. Variables such as the amount of antigen, inflammation, costimulatory ligands, and cytokine milieu all serve to multiply the potential outcomes of an immune response 1. Despite the seemingly limitless possibilities, there are certain behaviors of activated CD4+ T cells that suggest a level of invariant, autonomous control 23. One strikingly uniform feature in the activation of helper T cells is the finding that clonal expansion seems invariably accompanied by clonal contraction 4. Activation-induced cell death is generally regarded as the major mechanism for lymphocyte homeostasis during an immune response 567. CD4+ T cells can be induced to undergo apoptosis through a mechanism that is linked to their activation, but how the processes are coupled is not well understood. Whether nonapoptotic mechanisms exist to limit lymphocyte expansion is also uncertain 8.
Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Mice.
Wild-type C57BL/6 and BALB/c mice were obtained from The Jackson Laboratory. CTLA-4–/– 9, CD28–/– 32, BCl-xL (under the control of the CMV promoter and Eµ enhancer) transgenic 33, and DO11.10 TCR transgenic 34 mice were generated as described. CTLA-4–/– DO11.10 TCR transgenic mice were used to delay onset of disease in CTLA-4–/– animals 1735, and wild-type DO11.10 TCR transgenic, CD28–/– DO11.10 TCR transgenic, and Bcl-xL transgenic DO11.10 TCR transgenic mice were used as their controls. All mutant mice were backcrossed to the BALB/c or B10.D2 background six times before intercross with mice from the same background. Animals were genotyped using PCR and flow cytometry. All animal work was done in accordance with guidelines of the University of Pennsylvania.
In experiments with nontransgenic mice, splenocytes were depleted of CD8+ cells using magnetic beads (PerSeptive Biosystems), and stimulated (2 x 106 cells/ml) using soluble anti-CD3 mAb (2.0 µg/ml; BD PharMingen) as described 26, unless indicated. Anti-CD28 mAb (BD PharMingen), human rIL-2 (Life Sciences), murine rIL-4 (Roche), rIL-12 (BD PharMingen), anti–IL-4 mAb (BD PharMingen), and anti–IL-12 mAb (BD PharMingen) were used at concentrations indicated in the figure legends. Stimulations of DO11.10 transgenic splenocytes were performed as described for wild-type cells, except without prior CD8 depletion. All cells were labeled with CFSE (Molecular Probes) as described previously 26. Briefly, cells (2 x 107 cells/ml) were incubated in PBS with CFSE (5 µM) for 9 min at room temperature. Labeling was quenched with an equal volume of FCS, and then cells were washed twice with HBSS supplemented with 10% FCS.
Flow cytometric analysis was performed on fixed cells as described previously 26. Briefly, cells were washed with PBS and fixed in 4% paraformaldehyde for 11 min at room temperature. Fixed cells were stained in permeabilization buffer (PBS with 0.2% saponin, 1% FCS, and 0.1% sodium azide). Phycoerythrin-conjugated mAbs against CTLA-4, CD25, CD44, and allophycocyanin-conjugated mAbs against IFN-
and IL-4 were used where indicated. For intracellular cytokine staining only, cells were restimulated with PMA (50 ng/ml; Sigma-Aldrich) and ionomycin (500 ng/ml; Sigma-Aldrich) for 4 h, with brefeldin A (2.0 µg/ml; Sigma-Aldrich) added for the final 2 h, before fixation.
Binding of PE-conjugated Annexin V (BD PharMingen) was performed on unfixed cells according to the manufacturer's instructions. Propidium iodide (P.I.) exclusion was performed by resuspending unfixed cells in PBS with P.I. (1.0 µg/ml; Sigma-Aldrich) 5 min before flow cytometry. ToPro-3 (Molecular Probes) was used to assess DNA content in fixed, permeabilized cells. Cells were first stained with mAbs, and then washed, fixed, and incubated in PBS with saponin (0.3%), RNase A (50 µg/ml), EDTA (5 mM), and ToPro-3 (1.0 µM) for 30 min at 4°C before analysis by flow cytometry.
CD8-depleted, CFSE-labeled cells were stimulated for 4 d in the cytokine conditions indicated in the figure legend, and then stained with fluorochrome-conjugated anti-CD4 mAb, before sorting of live-gated, CD4+ events into separate generations by flow cytometry, using a MoFlo instrument (Cytomation). Cells were washed and total RNA was extracted using Trizol Reagent (Life Technologies) and reverse transcribed using random hexamer primers (Amersham Pharmacia Biotech), as described 36. cDNA levels were equalized by reverse transcription (RT)-PCR, using a competitive template of hypoxanthine guanine phosphoribosyl transferase (HPRT) cDNA as an internal standard, as described 36. The competitive template, because of its higher molecular weight, migrates slower than authentic HPRT cDNA during electrophoresis. PCR for CC chemokine receptor (CCR)7 was performed on equalized cDNA samples. Each reaction was performed at least three times. The following primer sets were used: CCR7 sense CTACAGCCCCCAGAGCACCAT, CCR7 antisense GAAGGGAAGAATTAGGAGGAAAAG, HPRT sense GTTGGAGACAGGCCAGACTTTGTTG, and HPRT antisense GAGGGTAGGCTGGCC-TATAGGCT.
Results
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Limits on Clonal Expansion Are Regulated by the Cell Division Cycle.
CFSE labeling was used to resolve individual cell divisions by the quantitative dilution of green fluorescence that accompanies cytokinesis 31. CD8-depleted splenocytes were stimulated with soluble anti-CD3 mAb, using endogenous accessory cells to cross-link the anti-CD3 mAb and provide a natural source of ligands for CD28 and CTLA-4. We first performed a quantitative analysis of relative cellularity as a function of cell division in an asynchronously dividing population that encompassed at least five cell divisions. By comparing the relative number of live CD4+ T cells in each successive division, we found that the dynamics of clonal expansion follow a highly reproducible pattern over a range of conditions (Fig. 1). The greatest number of cells was typically found in the population having completed the third or fourth cell division. Although many cells continued through 1–3 more cell divisions, cellular expansion was limited not only by proliferative arrest, but apoptosis (see below). As a result, fewer than 5% of the viable cells in culture completed the sixth cell division.
|
The distribution of cell death within discrete cell divisions was examined by analyzing the binding of Annexin V to apoptotic membranes (Fig. 1 B). As expected, there was significant cell death among activated, proliferating cells. We consistently observed, however, that the majority of apoptosis occurred after the third cell division, and increased substantially in later cell divisions (Fig. 1 B). Identical results were obtained using exclusion of propidium iodide as a parameter of survival (see below). Thus, over a wide range of conditions, clonal expansion of CD4+ T cells is limited by a combination of cell cycle arrest and apoptosis.
CTLA-4 Limits Clonal Expansion.
The fact that each experiment followed the same fundamental pattern was quite unexpected since the incorporation of radioactive thymidine yielded orders-of-magnitude differences between the experimental variables we employed (data not shown). Although CD28 costimulation could increase the percentage of cells that complete the fifth division before arresting and dying, there appeared to be an absolute barrier past which cells did not proceed, or if they did, underwent apoptosis. This reproducible pattern under different stimulatory conditions and at different time points suggests the possibility that clonal expansion is limited by a division-dependent counterbalance that is metered in a cell-autonomous manner.
We observed both a failure to proceed past five divisions and increasing cell death in later divisions even in cells that were deficient in FAS (data not shown), suggesting that FAS, although potentially important to subsequent cell elimination, was not required for the termination of proliferative expansion. CTLA-4–/– mice were bred to DO11.10 TCR transgenic mice, to delay the onset of disease seen in CTLA-4–deficient animals 1735. Although CTLA-4–/– cells from mice of this age may contain up to fivefold more activated cells than wild-type cells (9), we used only younger CTLA-4–/– DO11.10 animals and excluded from analysis any mice with grossly enlarged spleens or lymph nodes. CTLA-4–/– DO11.10 TCR transgenic cells were compared with those from DO11.10 TCR transgenic mice, and CD28–/– DO11.10 TCR transgenic mice. CD4+ T cells from CD28–/– mice had a profound proliferative defect compared with normal cells (Fig. 2 A). CD28–/– cells did not achieve significant cellular expansion, despite many precursors undergoing at least one division, because many of the cells in culture underwent apoptosis (Fig. 2 A).
|
Genetic confirmation that CTLA-4 regulates cell division was recently observed in vivo using recombination activating gene (RAG)–/–CTLA-4–/– TCR transgenic cells 17. RAG-proficient CTLA-4–/– TCR transgenic cells, however, might proliferate differently from normal cells because they often contain higher percentages of activated cells 1735. To control for such secondary effects within CTLA-4–/– cells, and to determine whether the mechanism limiting clonal expansion might be quantitative, we also studied CTLA-4-haplo-insufficient cells (Fig. 2 B), which do not have increased numbers of activated cells (data not shown). We found that CTLA-4+/– cells had both increased number of cells and decreased frequency of apoptosis in later divisions compared with cells from CTLA-4+/+ littermates. Among CTLA-4-haplo-insufficient cells, a greater percentage completed six divisions than did wild-type cells maximally costimulated through CD28 (Fig. 2 B and 1 A, respectively). Thus, CTLA-4, in a dose-dependent manner, is a critical regulator of clonal expansion of CD4+ T cells.
Clonal expansion is regulated at the level of proliferation and survival 8. We, therefore, tested whether proliferative arrest could be experimentally separated from apoptosis as a cause for the decline in cellularity with increasing division. CD4+ T cells expressing a Bcl-xL transgene had substantially reduced apoptosis compared with normal cells, but no significant enhancement of proliferation (Fig. 3 A). In contrast, we could correct the proliferative defect in CD28–/– cells by adding rIL-2 (Fig. 3 A), however, few viable cells remained that could complete the sixth cell division. Thus, CTLA-4 antagonizes both proliferative and survival signals mediated by costimulation from CD28, which can be separately attributed to the actions of IL-2 and Bcl-xL, respectively 37. In addition, we tested the effect of a relative decrease in B7 ligands by stimulating highly purified CD4+ cells with immobilized anti-CD3 plus anti-CD28 and rIL-2. In the absence of antigen-presenting cells, we found that division-dependent changes in apoptosis were substantially attenuated (Fig. 3 B).
|
3 cell divisions (Fig. 4 A). Addition of anti-CD28 and rIL-2, positive regulators of CTLA-4 expression 39, did not influence the pattern of induction per cell division but did accelerate its induction in relation to time, by causing more cells to be represented in later divisions over a fixed time (data not shown).
|
CTLA-4 can be recycled between intracellular pools and the cell surface 3941. We, therefore, compared staining of CTLA-4 in permeabilized cells and unpermeabilized cells. The intensity of surface CTLA-4 expression in unpermeabilized cells was in a lower range than intensity of total cellular expression in permeablized cells. Nonetheless, surface expression still increased in a step-wise fashion from lowest levels in undivided cells to highest levels after the third division (Fig. 4 C).
The division-dependent induction of CTLA-4 in naive cells, and its more rapid reiteration in immunologically experienced cells 42, suggested that gene expression might be regulated by epigenetic mechanisms of repression. To test this, we cultured cells in the presence of sodium butyrate, an inhibitor of histone deacetylase 43 that is capable of derepressing some silent genes. The graded pattern of total cellular CTLA-4 expression in the initial cell divisions was substantially increased (Fig. 4C and Fig. D) by the addition of butyrate. Trichostatin A, a more specific inhibitor of histone deacetylation, and 5-aza-2-deoxycytidine, an inhibitor of cytosine methylation, also caused increases in the level of CTLA-4 induction within the first three cell divisions (data not shown). Thus, chromatin structure might be a rate-limiting factor in the induction of CTLA-4.
The augmentation of CTLA-4 expression with agents that modify chromatin structure and the requirement of cell cycling to induce CTLA-4 expression suggested that activation of this gene might be coupled to DNA replication. To dissect the contributions of cytoplasmic from nuclear division, cells were cultured with cytochalasin B, an inhibitor of actin polymerization 44. Cytochalasin B–treated cells were unable to undergo cytokinesis (Fig. 4 E), but, in stark contrast to cells arrested in G1 (Fig. 4 A), were able to express near-maximal levels of CTLA-4 (Fig. 4 E). When we analyzed which cells had undergone gene induction, we found that the level of CTLA-4 expression was directly linked to DNA content. Lowest levels of CTLA-4 expression (4 geometric mean-fluorescence-intensity units above background) were found in cells with 2N DNA content, and highest levels (61 geometric mean-fluorescence-intensity units above background) were found in cells with 8N DNA content (Fig. 4 E). It is unlikely this 15-fold increase is due simply to the quadrupling of alleles as, in a separate analysis, we found that levels of CD25 and CD44 increased only 4-fold while levels of CTLA-4 increased 13-fold. Thus, CTLA-4 gene expression may be progressively induced in the first three cell divisions because of a mechanism coupled to DNA replication. That such small changes in protein expression between the initial cell divisions might indeed mediate significant biological effects is further suggested by the observation that the differences in levels of CTLA-4 expression in CTLA-4+/+ and CTLA-4+/– cells (Fig. 4 F) were found to closely parallel their differences in survival and cell division (Fig. 2 B).
Growth and Maturation Signals Can Counteract the Limits on Clonal Expansion.
During analysis of proliferating CTLA-4+/+ and CTLA-4–/– cells, we noted that CTLA-4 functions in activated cells to limit their size as well as their proliferation (data not shown). Comparison of cells at day 4 demonstrated that the over-representation of CTLA-4–/– cells in later cell divisions was accompanied by increased cell size, as measured by forward light scatter, in comparison to control cells (Fig. 5 A). This suggested that CTLA-4 function was restricting not only proliferation but also cell growth.
|
IL-12 4647 and IL-4 4849 promote growth and maturation of committed Th1 and Th2 subsets, respectively. We, therefore, examined the effects of IL-12 and IL-4 on cell division and cell size during polarized immune responses. In the presence of rIL-12, newly differentiating, IFN-–positive, Th1 cells were able to undergo more division and grow to substantially larger size than undifferentiated, IFN-–negative cells within the same culture (Fig. 5 C). In the presence of rIL-4, newly differentiating, IL-4–positive, Th2 cells were able to undergo more division and grow to substantially larger size than undifferentiated, IL-4–negative cells in the same culture. A large proportion of differentiated cells progressed past the fifth cell division, while only a small fraction of undifferentiated cells could do so (Fig. 5 C). Thus, in subsets of cells that are specifically responsive, growth signals can successfully counteract CTLA-4–mediated proliferative- and growth-arrest.
In human CD4+ T cells, expression of CCR7 protein begins to be downregulated after five cell divisions 30, giving progeny that achieved greater cell division the potential to migrate from lymphoid organs to peripheral tissues 29. To determine whether the pattern of expression in relation to cell division was similar in the mouse and, further, whether this was the result of transcriptional repression, we analyzed mRNA levels of CCR7 using RT-PCR among individual sorted cell generations of CD4+ T cells that had been stimulated in Th1- and Th2-polarizing conditions (Fig. 5 D). In either cytokine milieu, the expression of CCR7 was highest in cells that had divided less than five times. After 5 cell divisions levels of CCR7 mRNA became low-to-undetectable in both cytokine conditions (Fig. 5 D). Therefore, as is the case in human cells 30, expression of murine CCR7 in Th cells is regulated by cell division. Thus, cytokines that mediate polarization of immunity might function to ensure that subsets of effector T cells can overcome clonal arrest and selectively achieve division numbers (Fig. 5 C) that allow their emigration from lymph nodes 229.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
The unique regulation of CTLA-4 gene expression allows the CD28 receptor, the nondominant member of the pair for binding B7 52, to become engaged initially without complete interference from CTLA-4. Counterbalance from CTLA-4 is then allotted in a precisely controlled manner by the cell cycle and its ability to permit gene induction in proportion to proliferation. We are still determining whether there is actual repression in cis at the CTLA-4 locus, in trans at the locus of an activator of the CTLA-4 promoter, or some other explanation for the graded, division-dependent gene induction. Nonetheless, cell cycle–coupled regulatory and epigenetic effects might be the mechanistic explanation for what others have recently recognized as a level of cell-autonomous control in the way lymphocytes respond to extrinsic signals 24.
There are surely some redundant or cooperative negative controls for CD4+ T cells since CTLA-4–/– cells do not behave as though immortalized. These are likely to be the death receptors and the in vivo limitations or niches that permit survival or growth, such as nonpolarizing and polarizing cytokines. The phenotype of cells with CTLA-4 deficiency that have been stimulated in vitro is strikingly similar to the behavior of wild-type Th1 cells cultured in IL-12 or wild-type Th2 cells cultured in IL-4. These results support a model in which programming of selective growth factor reception 46474849 is a proximate event in effector lineage commitment 53. Early in differentiation, Th1 cells become uniquely programmed for IL-12Rβ2 expression 535455, and Th2 cells become uniquely competent in IL-4R signal transduction 5657. Subsets of differentiated cells might, therefore, receive selective signaling from the cytokine milieu to progress to a CCR7-negative stage and thereby mediate immunity in tissues (Fig. 6). This checkpoint, thus, sharpens polarity from cytokines, and also restricts important fate transitions in the effector and memory response 22930.
Our results may provide insight into the elusive basis of long-lived immunologic memory, as well as the unusual auto-aggressive phenotype of CTLA-4–null mice, wherein peripheral tissues are the primary targets of inflammation. The limitation on the number of divisions a cell undergoes, provided by CTLA-4 (Fig. 6), may ensure a long-lived remnant of CCR7-positive clonal progeny in central lymphoid compartments, which can be rapidly mobilized during rechallenge 5859. If T cells are fated to linear, terminal differentiation as they divide, a proliferative arrest of some progeny may be the only way to maintain self-renewal of clonally selected cells. The substantial increase in division number that is readily achieved by CTLA-4–deficient cells would, therefore, be compatible with predominantly peripheral tissue inflammation (Fig. 6).
In double-positive thymocytes, variations in signal transduction through the antigen receptor are integrated into vastly different outcomes by intrinsic rheostats, such as Grb2 60. In the periphery, where TCR signaling is coupled to proliferation, and perhaps obligatory for survival 616263, CTLA-4 gene induction and function appears to be an intrinsic rheostat that may be a central checkpoint of antigen-driven clonal expansion (Fig. 6). Further maturation and expansion might then become dependent on nonantigenic extrinsic signals, such as those provided by inflammatory cytokines, which can mediate avoidance of clonal arrest.
|
Acknowledgments |
|---|
This work was supported by grants from the National Institutes of Health (A1-42370 to S.L. Reiner, AI-35294 to C.B. Thompson, and DK-07006 for A.M. Doyle).
Submitted: 27 March 2001
Revised: 23 July 2001
Accepted: 17 August 2001
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Janeway C.A. & Bottomly K.. Signals and signs for lymphocyte responses, Cell., 76, 1994, 275–285.[Medline]
Lanzavecchia A. & Sallusto F.. Dynamics of T lymphocyte responsesintermediates, effectors, and memory cells, Science., 290, 2000, 92–97.
Reiner S.L. & Seder R.A.. Dealing from the evolutionary pawnshophow lymphocytes make decisions, Immunity., 11, 1999, 1–10.[Medline]
Gett A.V. & Hodgkin P.D.. A cellular calculus for signal integration by T cells, Nat. Immunol., 1, 2000, 239–244.[Medline]
Ucker D.S., Ashwell J.D. & Nickas G.. Activation-driven T cell death. I. Requirements for de novo transcription and translation and association with genome fragmentation, J. Immunol., 143, 1989, 3461–3469.[Abstract]
Lenardo M.J.. Interleukin-2 programs mouse alpha beta T lymphocytes for apoptosis, Nature., 353, 1991, 858–861.[Medline]
Chan K.F., Siegel M.R. & Lenardo J.M.. Signaling by the TNF receptor superfamily and T cell homeostasis, Immunity., 13, 2000, 419–422.[Medline]
Van Parijs L. & Abbas A.K.. Homeostasis and self-tolerance in the immune systemturning lymphocytes off, Science., 280, 1998, 243–248.
Waterhouse P., Penninger J.M., Timms E., Wakeham A., Shahinian A., Lee K.P., Thompson C.B., Griesser H. & Mak T.W.. Lymphoproliferative disorders with early lethality in mice deficient in Ctla-4, Science., 270, 1995, 985–988.
Tivol E.A., Borriello F., Schweitzer A.N., Lynch W.P., Bluestone J.A. & Sharpe A.H.. Loss of CTLA-4 leads to massive lymphoproliferation and fatal multiorgan tissue destruction, revealing a critical negative regulatory role of CTLA-4, Immunity., 3, 1995, 541–547.[Medline]
Chambers C.A., Cado D., Truong T. & Allison J.P.. Thymocyte development is normal in CTLA-4-deficient mice, Proc. Natl. Acad. Sci. USA., 94, 1997, 9296–9301.
Krummel M.F. & Allison J.P.. CTLA-4 engagement inhibits IL-2 accumulation and cell cycle progression upon activation of resting T cells, J. Exp. Med., 183, 1996, 2533–2540.
Walunas T.L., Bakker C.Y. & Bluestone J.A.. CTLA-4 ligation blocks CD28-dependent T cell activation, J. Exp. Med., 183, 1996, 2541–2550.
Brunner M.C., Chambers C.A., Chan F.K., Hanke J., Winoto A. & Allison J.P.. CTLA-4-Mediated inhibition of early events of T cell proliferation, J. Immunol., 162, 1999, 5813–5820.
Kearney E.R., Walunas T.L., Karr R.W., Morton P.A., Loh D.Y., Bluestone J.A. & Jenkins M.K.. Antigen-dependent clonal expansion of a trace population of antigen-specific CD4+ T cells in vivo is dependent on CD28 costimulation and inhibited by CTLA-4, J. Immunol., 155, 1995, 1032–1036.[Abstract]
Perez V.L., Van Parijs L., Biuckians A., Zheng X.X., Strom T.B. & Abbas A.K.. Induction of peripheral T cell tolerance in vivo requires CTLA-4 engagement, Immunity., 6, 1997, 411–417.[Medline]
Greenwald R.J., Boussiotis V.A., Lorsbach R.B., Abbas A.K. & Sharpe A.H.. CTLA-4 regulates induction of anergy in vivo, Immunity., 14, 2001, 145–155.[Medline]
Salomon B. & Bluestone J.A.. Complexities of CD28/B7CTLA-4 costimulatory pathways in autoimmunity and transplantation, Annu. Rev. Immunol., 19, 2001, 225–252.[Medline]
Oosterwegel M.A., Mandelbrot D.A., Boyd S.D., Lorsbach R.B., Jarrett D.Y., Abbas A.K. & Sharpe A.H.. The role of CTLA-4 in regulating Th2 differentiation, J. Immunol., 163, 1999, 2634–2639.
Khattri R., Auger J.A., Griffin M.D., Sharpe A.H. & Bluestone J.A.. Lymphoproliferative disorder in CTLA-4 knockout mice is characterized by CD28-regulated activation of Th2 responses, J. Immunol., 162, 1999, 5784–5791.
Masteller E.L., Chuang E., Mullen A.C., Reiner S.L. & Thompson C.B.. Structural analysis of CTLA-4 function in vivo, J. Immunol., 164, 2000, 5319–5327.
Chambers C.A., Kuhns M.S., Egen J.G. & Allison J.P.. CTLA-4-mediated inhibition in regulation of T cell responsesmechanisms and manipulation in tumor immunotherapy, Annu. Rev. Immunol., 19, 2001, 565–594.[Medline]
McCoy K., Camberis M. & Gros G.L.. Protective immunity to nematode infection is induced by CTLA-4 blockade, J. Exp. Med., 186, 1997, 183–187.
Murphy M.L., Cotterell S.E., Gorak P.M., Engwerda C.R. & Kaye P.M.. Blockade of CTLA-4 enhances host resistance to the intracellular pathogen, Leishmania donovani, J. Immunol., 161, 1998, 4153–4160.
Heinzel F.P. & Maier R.A.. Interleukin-4-independent acceleration of cutaneous leishmaniasis in susceptible BALB/c mice following treatment with anti-CTLA4 antibody, Infect. Immun., 67, 1999, 6454–6460.
Bird J.J., Brown D.R., Mullen A.C., Moskowitz N.H., Mahowald M.A., Sider J.R., Gajewski T.F., Wang C.R. & Reiner S.L.. Helper T cell differentiation is controlled by the cell cycle, Immunity., 9, 1998, 229–237.[Medline]
Gett A.V. & Hodgkin P.D.. Cell division regulates the T cell cytokine repertoire, revealing a mechanism underlying immune class regulation, Proc. Natl. Acad. Sci. USA., 95, 1998, 9488–9493.
Richter A., Lohning M. & Radbruch A.. Instruction for cytokine expression in T helper lymphocytes in relation to proliferation and cell cycle progression, J. Exp. Med., 190, 1999, 1439–1450.
Sallusto F., Lenig D., Forster R., Lipp M. & Lanzavecchia A.. Two subsets of memory T lymphocytes with distinct homing potentials and effector functions, Nature., 401, 1999, 708–712.[Medline]
Langenkamp A., Messi M., Lanzavecchia A. & Sallusto F.. Kinetics of dendritic cell activationimpact on priming of TH1, TH2 and nonpolarized T cells, Nat. Immunol., 1, 2000, 311–316.[Medline]
Lyons A.B. & Parish C.R.. Determination of lymphocyte division by flow cytometry, J. Immunol. Methods., 171, 1994, 131–137.[Medline]
Shahinian A., Pfeffer K., Lee K.P., Kundig T.M., Kishihara K., Wakeham A., Kawai K., Ohashi P.S., Thompson C.B. & Mak T.W.. Differential T cell costimulatory requirements in CD28-deficient mice, Science., 261, 1993, 609–612.
Grillot D.A., Merino R. & Nunez G.. Bcl-XL displays restricted distribution during T cell development and inhibits multiple forms of apoptosis but not clonal deletion in transgenic mice, J. Exp. Med., 182, 1995, 1973–1983.
Murphy K.M., Heimberger A.B. & Loh D.Y.. Induction by antigen of intrathymic apoptosis of CD4+CD8+TCRlo thymocytes in vivo, Science., 250, 1990, 1720–1723.
Chambers C.A., Kuhns M.S. & Allison J.P.. Cytotoxic T lymphocyte antigen-4 (CTLA-4) regulates primary and secondary peptide-specific CD4(+) T cell responses, Proc. Natl. Acad. Sci. USA., 96, 1999, 8603–8608.
Reiner S.L., Zheng S., Corry D.B. & Locksley R.M.. Constructing polycompetitor cDNAs for quantitative PCR, J. Immunol. Methods., 165, 1993, 37–46.[Medline]
Dahl A.M., Klein C., Andres P.G., London C.A., Lodge M.P., Mulligan R.C. & Abbas A.K.. Expression of bcl-X(L) restores cell survival, but not proliferation off effector differentiation, in CD28-deficient T lymphocytes, J. Exp. Med., 191, 2000, 2031–2038.
Walunas T.L., Lenschow D.J., Bakker C.Y., Linsley P.S., Freeman G.J., Green J.M., Thompson C.B. & Bluestone J.A.. CTLA-4 can function as a negative regulator of T cell activation, Immunity., 1, 1994, 405–413.[Medline]
Alegre M.L., Noel P.J., Eisfelder B.J., Chuang E., Clark M.R., Reiner S.L. & Thompson C.B.. Regulation of surface and intracellular expression of CTLA4 on mouse T cells, J Immunol., 157, 1996, 4762–4770.[Abstract]
Lalande M.. A reversible arrest point in the late G1 phase of the mammalian cell cycle, Exp. Cell Res., 186, 1990, 332–339.[Medline]
Linsley P.S., Bradshaw J., Greene J., Peach R., Bennett K.L. & Mittler R.S.. Intracellular trafficking of CTLA-4 and focal localization towards sites of TCR engagement, Immunity., 4, 1996, 535–543.[Medline]
Alegre M.L., Shiels H., Thompson C.B. & Gajewski T.F.. Expression and function of CTLA-4 in Th1 and Th2 cells, J. Immunol., 161, 1998, 3347–3356.
Kruh J.. Effects of sodium butyrate, a new pharmacological agent, on cells in culture, Mol. Cell. Biochem., 42, 1982, 65–82.[Medline]
Smith G.F., Ridler M.A. & Faunch J.A.. Action of cytochalasin B on cultured human lymphocytes, Nature., 216, 1967, 1134–1135.[Medline]
Rathmell J.C., Vander Heiden M.G., Harris M.H., Frauwirth K.A. & Thompson C.B.. In the absence of extrinsic signals, nutrient utilization by lymphocytes is insufficient to maintain either cell size or viability, Mol. Cell., 6, 2000, 683–692.[Medline]
Kennedy M.K., Picha K.S., Shanebeck K.D., Anderson D.M. & Grabstein K.H.. Interleukin-12 regulates the proliferation of Th1, but not Th2 or Th0, clones, Eur. J. Immunol., 24, 1994, 2271–2278.[Medline]
Murphy E.E., Terres G., Macatonia S.E., Hsieh C.S., Mattson J., Lanier L., Wysocka M., Trinchieri G., Murphy K. & O'Garra A.. B7 and interleukin 12 cooperate for proliferation and interferon gamma production by mouse T helper clones that are unresponsive to B7 costimulation, J. Exp. Med., 180, 1994, 223–231.
Kurt-Jones E.A., Hamberg S., Ohara J., Paul W.E. & Abbas A.K.. Heterogeneity of helper/inducer T lymphocytes. I. Lymphokine production and lymphokine responsiveness, J. Exp. Med., 166, 1987, 1774–1787.
Fernandez-Botran R., Sanders V.M., Mosmann T.R. & Vitetta E.S.. Lymphokine-mediated regulation of the proliferative response of clones of T helper 1 and T helper 2 cells, J. Exp. Med., 168, 1988, 543–558.
Mandelbrot D.A., McAdam A.J. & Sharpe A.H.. B7-1 or B7-2 is required to produce the lymphoproliferative phenotype in mice lacking cytotoxic T lymphocyte–associated antigen 4 (CTLA-4), J. Exp. Med., 189, 1999, 435–440.
Allison J.P. & Krummel M.F.. The Yin and Yang of T cell costimulation, Science., 270, 1995, 932–933.
Linsley P.S., Greene J.L., Brady W., Bajorath J., Ledbetter J.A. & Peach R.. Human B7-1 (CD80) and B7-2 (CD86) bind with similar avidities but distinct kinetics to CD28 and CTLA-4 receptors, Immunity., 1, 1994, 793–801.[Medline]
Mullen A.C., High F.A., Hutchins A.S., Lee H.W., Villarino A.V., Livingston D.M., Kung A.L., Cereb N., Yao T.-P., Yang S.Y. & Reiner S.L.. Role of T-bet in commitment of TH1 cells before IL-12-dependent selection, Science., 292, 2001, 1907–1910.
Szabo S.J., Jacobson N.G., Dighe A.S., Gubler U. & Murphy K.M.. Developmental commitment to the Th2 lineage by extinction of IL-12 signaling, Immunity., 2, 1995, 665–675.[Medline]
Ouyang W., Ranganath S.H., Weindel K., Bhattacharya D., Murphy T.L., Sha W.C. & Murphy K.M.. Inhibition of Th1 development mediated by GATA-3 through an IL-4-independent mechanism, Immunity., 9, 1998, 745–755.[Medline]
Huang H. & Paul W.E.. Impaired interleukin 4 signaling in T helper type 1 cells, J. Exp. Med., 187, 1998, 1305–1313.
Kurata H., Lee H.J., O'Garra A. & Arai N.. Ectopic expression of activated Stat6 induces the expression of Th2-specific cytokines and transcription factors in developing Th1 cells, Immunity., 11, 1999, 677–688.[Medline]
Reinhardt R.L., Khoruts A., Merica R., Zell T. & Jenkins M.K.. Visualizing the generation of memory CD4 T cells in the whole body, Nature., 410, 2001, 101–105.[Medline]
Iezzi G., Scheidegger D. & Lanzavecchia A.. Migration and function of antigen-primed nonpolarized T lymphocytes in vivo, J. Exp. Med., 193, 2001, 987–993.
Gong Q., Cheng A.M., Akk A.M., Alberola-Ila J., Gong G., Pawson T. & Chan A.C.. Disruption of T cell signaling networks and development by Grb2 haploid insufficiency, Nat. Immunol., 2, 2001, 29–36.[Medline]
Takeda S., Rodewald H.R., Arakawa H., Bluethmann H. & Shimizu T.. MHC class II molecules are not required for survival of newly generated CD4+ T cells, but affect their long-term life span, Immunity., 5, 1996, 217–228.[Medline]
Kirberg J., Berns A. & von Boehmer H.. Peripheral T cell survival requires continual ligation of the T cell receptor to major histocompatibility complex–encoded molecules, J. Exp. Med., 186, 1997, 1269–1275.
Rooke R., Waltzinger C., Benoist C. & Mathis D.. Targeted complementation of MHC class II deficiency by intrathymic delivery of recombinant adenoviruses, Immunity., 7, 1997, 123–134.[Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Facebook 
Reddit 
Technorati 
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|
