|
|
|
|
|
|
|
||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Original Article |
hansjoerg.schild{at}uni-tuebingen.de
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
–inducible subunits low molecular weight protein (LMP)-2, LMP-7, and multicatalytic endopeptidase complex–like (MECL)-1 leads to the formation of immunoproteasomes which have been associated with more efficient class I antigen processing. Although differences in cleavage specificities of constitutive and immunoproteasomes have been observed frequently, cleavage motifs have not been described previously. We now report that cells expressing immunoproteasomes display a different peptide repertoire changing the overall cytotoxic T cell–specificity as indicated by the observation that LMP-7–/– mice react against cells of LMP-7 wild-type mice. Moreover, using the 436 amino acid protein enolase-1 as an unmodified model substrate in combination with a quantitative approach, we analyzed a large collection of peptides generated by either set of proteasomes. Inspection of the amino acids flanking proteasomal cleavage sites allowed the description of two different cleavage motifs. These motifs finally explain recent findings describing differential processing of epitopes by constitutive and immunoproteasomes and are important to the understanding of peripheral T cell tolerization/activation as well as for effective vaccine development.
Key Words: constitutive proteasomes • immunoproteasomes • CTL epitope • peptide repertoire • tolerance
Peptides that meet the restrictive binding characteristics of MHC class I molecules for presentation to CTLs are generated after intracellular protein degradation by cytosolic proteases. The central enzyme responsible for protein degradation is the proteasome 2. Because of their intimate involvement in antigen processing and presentation 3, detailed knowledge on the cleavage preferences of proteasomes will be crucial for understanding CTL epitope generation and thus, for the regulation of specific immune responses.
The 20S proteasome represents the proteolytic core of the larger 26S proteasome complex that encompasses either one or two regulatory particles of at least 18 subunits 4. The eukaryotic 20S particle is composed of 14 different but related subunits organized in a barrel-shaped complex with the stoichiometry
Upon IFN-
Proteasomes harboring these IFN-
To better understand the reasons why certain MHC class I ligands are generated with greater efficiency and others with lower efficiency in cells expressing different sets of proteasomes, we have performed an in-depth analysis of peptide fragments generated after proteasomal cleavage.
We have employed a strictly quantitative method to analyze a large collection of peptide fragments produced by either set of proteasome. Our observations allowed the identification of certain amino acids (or their characteristics) in positions distant, or directly flanking the cleavage sites selected by either set of proteasomes. The (quantified) mapping of cleavage sites using a large protein substrate provides the basis for a better understanding of proteasomal cleavage specificity, allowing a refined proteasomal cleavage prediction, which will be helpful for the identification of new CTL epitopes, the design of new (recombinant) vaccines, and for better insight into immunity against infection.
Immunoblotting.
In Vitro Degradation of Enolase-1.
Separation and Analysis of Cleavage Products.
Peak fractions were dried and dissolved in 25 µl of 40% methanol, 1% formic acid, and subsequently analyzed by matrix-associated laser desorption ionization (MALDI) time of flight mass spectrometry (MS) (G2025A; Hewlett Packard) and NH2-terminal sequencing (Edman degradation) (pulsed liquid protein sequencer procise 494A; Applied Biosystems). Alternatively, peptides were analyzed on a hybrid quadruple orthogonal acceleration tandem mass spectrometer (Micromass). All these techniques were applied as described previously 21. Pmol amounts for each peptide detected in the HPLC fraction were determined by Edman sequencing and used for the quantitative analysis of the data.
Statistical Analysis - Frequencies of Amino Acids.
Statistical Analysis - Comparison of Amino Acid Characteristics.
Mice, CTL Assays, and Skin Grafting.
The LMP-7 gene was cloned from a 129/Ola cDNA using oligonucleotides 5' AGGATCCACCATGGCGTTACTGGATCTGTGCGG (with BamH1 site at the 5' end) and 3' TGAATTCTCACAGAGCGGCCTCTC (with EcoR1 site at the 3' end). The DNA fragment was then digested with EcoR1 and BamH1 endonucleases and cloned into similarly digested LZRSpBMN-linker-IRES-green fluorescent protein plasmid (unpublished data). Mutagenesis of LMP-7 to replace T by A at position 1 (in the processed subunit) was done using oligonucleotides 5' GGCCCACGGCGCAACCACACTCGCC and 3' GGCGAGTGTGGTTGCGCCGTGGGCC. LMP-7 wild-type and LMP-7 T1A expressing retroviral vectors were transfected into packaging cell lines and supernatants were used to infect the LMP-7–/– cell line BII-103. After appropriate selection, comparable LMP-7 wild-type and LMP-7 T1A transcription was detected by Northern blot analysis and comparable green fluorescent protein expression by FACS® analysis (FACSCaliburTM; Becton Dickinson).
Skin grafts were performed on the back of the mice. Pieces of skin (
As expected, only proteasomes isolated from LCL-721 cells expressed immuno subunits, as exemplified by the presence of LMP-7 (Fig. 1, a and b). Moreover, these proteasomes showed a reduced ability to release fluorogenic groups linked to acidic amino acids compared with proteasomes isolated from LCL-721.174 cells (data not shown). Together, these data indicate that proteasomes purified from LCL-721, although containing some constitutive proteasomes, behave like immunoproteasomes with very little PGPH activity, whereas LCL-721.174–derived proteasomes can be classified as constitutive proteasomes with high PGPH activity.
Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
CTLs are crucial for the defense against many invading organisms and certain tumors. Presentation of antigenic peptides bound to MHC class I molecules is a prerequisite for stimulation of a CTL response, and therefore plays a pivotal role in providing CTLs with the capacity to respond to foreign antigens 1. 
7β7β77. Three subunits of the two inner β-rings (β1, β2, and β5) participate directly in peptide bond cleavage. They represent three distinct proteolytic activities, designated as the chymotrypsin (ChT)-like, trypsin-like, and peptidyl-glutamylpeptide–hydrolyzing (PGPH) activities 56. As the NH2-terminal threonine residues responsible for peptide bond cleavage do not prefer certain peptide bonds over others, the basis for the three distinct proteolytic activities most likely resides in the characteristics of the amino acids in the vicinity (pockets) of each active NH2-terminal threonine 7. exposure of cells, the three active β-subunits that are constitutively expressed in 20S proteasomes can be replaced by three IFN-–inducible homologues, low molecular weight protein (LMP)-2 (=β1i) (for Y [β1]), multicatalytic endopeptidase complex–like (MECL)-1 (β2i) (for Z [β2]), and LMP-7 (β5i) (for X [β5]). Although there is extensive sequence homology, these replacements alter the nature of peptides that are generated by proteasomes 89101112. –inducible subunits are also called immunoproteasomes, as opposed to the constitutively expressed "constitutive" proteasomes, because immunoproteasomes were found to process a number of viral epitopes with greater efficacy in vitro 13141516. Using several artificial fluorogenic substrates in vitro, it was found that immunoproteasomes display a better capacity to cleave after hydrophobic and basic residues but are less well equipped for cleavage after acidic amino acids 17. The finding that proteasomes are responsible for the generation of the correct COOH terminus of several CTL epitopes 1819 and the notion that hydrophobic or positively charged amino acids serve in most cases as COOH-terminal anchor residues of MHC class I ligands led to the concept that immunoproteasomes contribute to more efficient MHC class I antigen processing. While this holds true for most viral antigens, recent studies have shown that some antigenic peptides are efficiently produced by constitutive proteasomes but cannot be generated by immunoproteasomes 20. This demonstrates that immunoproteasomes are not necessarily better suited for the processing of all MHC class I ligands.
Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Purification of 20S Proteasomes.
20S proteasomes were isolated as described previously 9. Frozen pellets of LCL-721 cells or LCL-721.174 cells were lysed in a buffer containing 0.1% Triton X-100 on ice and homogenized in a Dounce homogenizer. The 40,000x g supernatant of the lysate was bound to DEAE Sephacel. After elution, the protein fraction was concentrated and loaded onto a 10–40% sucrose gradient. After centrifugation, gradient fractions were tested for protease activity using the fluorogenic substrates succinyl-leucyl-leucyl-valyl-tyrosyl-7-amino-4-methylcoumarin (Suc-LLVY-AMC) and succinyl-tyrosyl-valyl-alanyl-aspartyl-7-amino-4-methylcoumarin (Suc-YVAD-AMC). Active fractions were pooled and further purified by anion exchange chromatography on a MonoQ HR5/5 FPLC column (Amersham Pharmacia Biotech). The purity of the proteasome preparates, checked by SDS-PAGE, was >95%. Quantification of native proteasome protein was determined by a variation of the Lowry Method (protein assay; Bio-Rad Laboratories) and BSA as a standard.
5 µg of purified proteasome polypeptides were separated by 12% SDS-PAGE and transferred to polyvinyldifluoride (DuPont) with a semidry transfer system. Human LMP-7 was detected using a rabbit polyclonal antiserum in conjunction with chemiluminescence (PW8200; Affiniti Research Products, Ltd.).
150 µg of yeast enolase-1 were incubated in digestion buffer (20 mM Hepes/KOH, pH 7.6, 2 mM MgAc2, and 0.01% SDS) with proteasomes at a molar ratio of 150:1. Digestions were stopped by freezing the samples at –80°C when 
50% of the substrate was digested (usually after 48 h).
For the separation of degradation products, unfractionated enolase digests were subjected to µRP SC 2.1/10 columns (Amersham Pharmacia Biotech) on a Microbore HPLC system (SMART; Amersham Pharmacia Biotech). Buffer A contained 0.1% trifluoroacetic acid; buffer B contained 0.081% trifluoroacetic acid and 80% acetonitrile. Gradients were 0% for 5 min, in 40 min to 40% in buffer B, in 8 min to 75% in buffer B, and up to 85% in another 7 min at a flow rate of 150 µl/min. Fractions were collected by peak fractionation with a maximal volume of 500 µl/peak.
To detect statistically significant features in the amino acid distribution flanking the cleavage sites, we compared percent values using a classic chi-squared test for four tables (variance assumed due to counting). This method was used to compare constitutive and immunoproteasomes fragments with each other and with enolase. For a more thorough comparison of the absolute pmol amounts of constitutive and immunoproteasomes, we accounted for the experimental variability and, according to the quasilikelihood approach of Wedderburn et al. 22, assumed a mean variance structure. We assumed the variance to be proportional to the mean and fitted the proportionality constant from all the data. Then, the usual chi-squared test variable was scaled by 1/, which led asymptotically to a test variable that is chi-squared distributed with one degree of freedom. The results of the latter was a more thorough approach correlated to the approach neglecting experimental variability and using percent values. Only chi-squared values >3.841 are considered to be significant.
To compare the characteristics of amino acids, the observed frequencies of amino acids at P6 to P6' around cleavage sites in both proteasomes were compared with each other using the chi-squared test. Hydrophobicity, bulkiness, and flexibility characteristics 21 of both proteasomes and enolase were compared by translating the percentage of amino acids found to the corresponding hydrophobicity, bulkiness, and flexibility scales. This resulted in spectra per cleavage site, and these were compared by means of regression analysis.
LMP-7–/– mice were generated as described previously 23 and maintained at the animal facilities of the Basel Institute for Immunology or the Institute for Cell Biology. C57BL/6 mice were obtained from Charles River Laboratories. RMA and RMA-S cells were cultured in RPMI 1640 containing 10% FCS, 2-Me, L-glutamine, and antibiotics. CTLs were generated by intraperitoneal immunization of mice with 107 irradiated spleen cells (33Gy) in 300 µl PBS. 10 d later spleens were removed and the splenocytes were stimulated with irradiated spleen cells (33Gy). CTL lines were generated by weekly restimulations with irradiated spleen cells as described previously 24. CTL assays were performed as described previously 24 using RMA, RMA-S, and concanavalin A blasts of spleen cells as target cells. In addition, CTL lines were tested on the LMP-7–/– cell line BII-103 (unpublished data) and BII-103 transfected with LMP-7 wild-type and LMP-7 T1A DNA. 7 mm of diameter) were obtained with a punch from the back of shaved donors and grafted onto anesthesized recipients where holes had also been made with a punch. Each animal had two separated grafts, foreign and autologous, as an experimental control. The skin was discreetly glued (histoacryl; B. Braun Surgical AG) and bandaged. After a week, the bandage was removed to allow the observation of the putative graft rejection.
Results
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Isolation of Proteasomes.
Proteasomes were isolated from EBV-transformed B cells. Constitutive proteasomes were purified from cells (LCL-721.174) lacking LMP-2 and LMP-7 due to a chromosomal deletion in the MHC locus 2025. The lack of LMP-2 excludes the incorporation of MECL-1 in 20S proteasomes. Therefore, this cell line contains only proteasomes carrying active constitutive subunits 26. The immunoproteasome preparation was isolated from the parental line (LCL-721) that served for the generation of LCL-721.174.
|
50% of the substrate was degraded to ensure comparable substrate turnover. This degree of degradation was obtained after 48 h, indicating similar rates of digestion for both constitutive and immunoproteasomes. Subsequently, enolase fragments were separated by reverse-phase HPLC. Comparison of two independent digests obtained after incubation with two independent constitutive proteasome batches revealed that highly comparable degradation profiles were obtained. The generation of similar degradation products was confirmed by MALDI-MS analyses of several fractions that eluted at the same time (data not shown).
After having established the reproducibility of the digestion profiles, the peptide fragments in all fractions were analyzed by MALDI-MS, in combination with Edman degradation, and compiled in a digestion map (Fig. 2). Approximately 50% of cleavages generated by constitutive proteasomes were not produced by immunoproteasomes. Indeed, when the identity of fragments produced by either set of proteasome was compared on a qualitative basis only 25% of peptides produced by immunoproteasomes were also found in constitutive proteasome digests. Therefore, the pool of peptides generated by cells expressing immunoproteasomes is very different from the peptide pool generated by cells harboring constitutive proteasomes only.
|
|
|
Analysis of Cleavage Site Usage.
As outlined above, some cleavage sites are used often, whereas others are used less frequently or not at all by one or both proteasome species. Until now, most studies addressing the specificity of proteasomal peptide/protein degradation did not take the frequency of cleavages into account. To study more accurately the influence of all 20 amino acids flanking proteasomal cleavage sites, we determined the frequency of amino acids around cleavage sites (P6 to P1 NH2-terminal of cleavage site; P1' to P6' COOH-terminal of cleavage site) using the quantified data set described above (Table and Table , and Fig. 3). No statistically significant differences in cleavage site selection were observed between two independent digests performed by two independent immunoproteasome batches, indicating that the fragment pattern obtained after proteasomal degradation was highly reproducible (data not shown).
|
An analogous examination for the cleavages selected by constitutive proteasomes revealed that the frequency of S as P3 and the positively charged amino acid K as P1 and P2' residue is reduced (all chi-squared = 3.9), indicating that these amino acids are disfavored by constitutive proteasomes at these positions. Constitutive proteasomes show a weak enrichment of P at P4 (chi-squared = 3.8) and, like immunoproteasomes, prefer A at P1' and L as P1 residue (albeit to a lesser extent; chi-squared = 4.2). Similarly, an enrichment for D at P2' was noted (chi-squared = 8.5), indicating that both proteasome species have a preference for negatively charged amino acids at the P2' position. When comparing characteristics of amino acids at these positions, a preference for hydrophobic, bulky amino acids in P1 and P2' (P < 0.0002) was observed. There is a negative correlation between cleavage site selection and the presence of hydrophobic, bulky amino acids in P1' (P < 0.0002).
Effect of Immunosubunit Incorporation on Cleavage Site Selection.
The data described above reveal that both proteasome species exhibit a different, but partially overlapping (L in P1, A in P1', and D in P2') cleavage preference. However, they do not address directly the influence of immunosubunit incorporation on cleavage site selection. Therefore, we compared relative amino acid frequencies around cleavage sites used by immunoproteasomes to those used by constitutive proteasomes. As a control, we evaluated cleavage site selection of two independent immunoproteasome batches yielding no statistically significant differences (data not shown). For comparison between constitutive and immunoproteasomes for positions P6-P6', significant differences were found at position P1 (P < 0.004) and, to a lesser extent, also at P1'. When testing for amino acid characteristics, we found that immunoproteasomes prefer bulky, hydrophobic amino acids at P1 (P < 0.003) but dislike flexible amino acids at this position (P < 0.001). At position P1' we found that hydrophobic, bulky amino acids were favored more by constitutive proteasomes (P < 0.04). Thus, comparison of peptide bonds used as cleavage sites by immunoproteasomes to the ones used by constitutive proteasomes revealed a pronounced ChT-like activity of immunoproteasomes, as is reflected by a strong enrichment of hydrophobic amino acids in P1. When comparing the two proteasome species for individual amino acid usage, a strong enrichment of L (chi-squared = 7.1 and, to a lesser extent F, chi-squared = 3.8) was detected at P1 in peptides generated by immunoproteasomes. The strong enrichment of L became most prominent when we analyzed in detail those cleavages exclusively generated by immunoproteasomes, as 43% of these cleavages were performed after L (data not shown). Acidic amino acids D and E in P1 exert a negative influence on cleavage site selection by immunoproteasomes (chi-squared = 4.5 and 8.1, respectively). G in P1' is enriched in peptides generated by immunoproteasomes (chi-squared = 7.8), pointing to a preference of immunoproteasomes for this small amino acid in P1'. Analysis of amino acid frequencies at positions P2 to P6 and P2' to P6' showed that L at P2' is disfavored by immunoproteasomes (chi-squared = 4.3).
Effect of Immunosubunit Incorporation on CTL Induction.
The observed major differences in the peptide repertoire produced by constitutive and immunoproteasomes could have important biological implications that go beyond differential proteasomal processing of certain CTL epitopes 81314151620. To study the biological consequences of immunosubunit incorporation in vivo, we tested the immune response of LMP-7–/– mice lacking functional immunoproteasomes 28 against wild-type cells. If immunoproteasome incorporation affects the nature of the CTL epitopes presented, it is expected that wild-type cells expressing both constitutive and immunoproteasomes will induce a CTL response in mice expressing constitutive proteasomes only. The opposite direction should not lead to a CTL response, as no unique ("immuno") peptides are presented in this setting. Indeed, skin grafting experiments showed that wild-type mice were not able to reject skin from LMP-7–/– animals 23, which are not able to express functional immunoproteasomes because in the absence of the LMP-7 subunit, LMP-2 and MECL-1 subunits are only incorporated in 20S proteasomes as inactive precursors 28. However, LMP-7–/– mice rejected skin transplants from wild-type mice with even greater efficiency than observed for the rejection of male skin by female recipients (Fig. 4 a). The fact that the latter rejection is mediated over several antigenic differences 29 supports the argument that LMP-7–/– mice react against multiple antigenic differences present on LMP-7 wild-type skin.
|
Together, our findings indicate that the incorporation of immunosubunits strongly influences the repertoire of peptides presented to CTLs and thereby the overall specificity of the CTL response.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
–inducible subunits, as indicated by experiments using small fluorogenic substrates or short synthetic peptides. Therefore, detailed knowledge on the specificity of protein degradation by either constitutive or immunoproteasomes is crucial to the understanding and prediction of CTL epitope generation. To analyze alterations of cleavage preference upon immunosubunit incorporation we used an entire protein as a substrate without modification of amino acids or bias to known CTL epitopes. The quantitative identification of >120 peptide fragments generated by either constitutive or immunoproteasomes allowed a detailed analysis of the cleavage specificities. Our data reveal that especially the amino acids in P3 to P3' have a strong influence on cleavage site selection as the observed frequencies of amino acids in these locations showed the largest discrepancy to their background frequencies in enolase. Nonetheless, amino acids further away most likely influence cleavage site selection as well, as was reported earlier for the effect of P at P4 on peptide bond cleavage by yeast and constitutive human proteasomes 21313233. The average length of fragments produced by either set of proteasome is the same, showing that spacing at which specific cleavage sites of the substrate are recognized is not changed by immunosubunit incorporation.
By comparing flanking residues around cleavage sites, we found that both proteasomes display a partially overlapping but different cleavage specificity (Fig. 3 and Fig. 5). They both prefer L as P1 residue and K in P3; A in P1' and D in P2' were also favored. Nonetheless, immunoproteasomes have a much stronger preference for L at P1, as well as other hydrophobic amino acids in this position. These findings point to a pronounced ChT-like activity after immunosubunit incorporation. In contrast, the acidic amino acids D and E were clearly disfavored by immunoproteasomes, whereas these amino acids were enriched at P1 in peptides generated by constitutive proteasomes. Some of the different characteristics regarding amino acid preferences at the P1 position were also observed previously in a small number of fragments generated from covalently modified lysozyme using proteasomes from bovine spleen and pituitaries 12.
|
The enhanced preference for hydrophobic amino acids at P1 of immunoproteasomes does not probably result from exchange of β5, which mediates the ChT-like activity, for β5i (LMP-7), as replacement of β5 for β5i does not alter the pocket surrounding the active site threonine. Moreover, functional data indicate that β5i influences the structural features of 20S proteasomes, thereby enhancing the activity of β1i (LMP-2; references 14 and 30). The stronger preference of immunoproteasomes for hydrophobic amino acids at P1, however, correlates with the characteristics at the inner surface of the proteasome when β1 (Y) is replaced for β1i. Replacement of β1 for β1i is predicted to cause the formation of a more apolar pocket around the active site threonine. This most likely results in the accommodation of hydrophobic amino acids at P1, leading to an enrichment of peptides with hydrophobic COOH termini and a reduction of fragments with charged COOH termini 7. Thus, it is conceivable that the exchange of β1 for β1i causes a reduction of peptides with charged COOH termini (amino acids like D and E) and enhanced liberation of peptides with hydrophobic COOH termini.
Structural analyses of proteasomes also predict that the active S-1 pocket of β5i is more constricted than the pocket of β5 7. As most hydrophobic amino acids are rather bulky, it is possible that small and flexible amino acids, like G, in close vicinity to hydrophobic amino acids, support accommodation of these amino acids in the S1 pocket of β5i most efficiently. Therefore, we anticipate that the strong enrichment of G and the decrease of hydrophobic amino acids in P1' of cleavage sites selected by immunoproteasomes are a direct consequence of these altered characteristics of the β5 immunosubunit.
The observation that the P1 preference of immunoproteasomes closely resembles the preferences of the F pocket of most MHC class I molecules is thought to explain why immunoproteasomes are associated with more efficient processing of MHC class I ligands, either by generating CTL epitopes directly or by producing more CTL epitope precursors that are converted into CTL epitopes by the action of aminopeptidases. As some CTL epitopes are preferentially generated by immunoproteasomes 34, it is postulated that immunoproteasome expression is generally associated with more efficient CTL epitope generation. However, the correlation between epitope production and expression of immunoproteasomes is more subtle. Some MHC class I alleles harbor F pockets that allow the binding of amino acids with charged polar side chains (e.g., K and R). These MHC alleles are unlikely to profit from immunoproteasome expression, as the trypsin-like activity is not enhanced by immunosubunit incorporation.
In view of our results, increased CTL epitope generation can now be explained and also predicted by several different mechanisms. Examples of quantified fragment generation from synthetic peptides by constitutive and immunoproteasomes are listed in Table . They include (a) enhanced liberation of the proper NH2 and/or COOH terminus by i20S proteasomes resulting from the combination hydrophobic amino acid, small (and polar) amino acid at P1 and P1', respectively (hepatitis B core antigen 141–151, lymphocytic choriomeningitis virus [LCMV] pp89, and adeno virus E1B), (b) enhanced generation of TAP-compatible CTL epitope precursors due to increased i20S proteasome activity for the combination hydrophobic amino acid, small (and polar) amino acid at P1 and P1', respectively (LCMV pp89, LCMV nucleoprotein [NP]), or (c) reduced PGPH activity of i20S proteasomes not destroying the CTL epitope (influenza A NP). However the combination hydrophobic amino acid, small (and polar) amino acid at P1 and P1' within a CTL epitope can also favor its destruction by i20S proteasomes as shown for a CTL epitope derived from the ubiquitous self-protein RU1.
|
These considerations might also be relevant for induction of CTL immunity against ubiquitously expressed self-proteins. If tolerance to self-proteins was restricted to peptides generated by immunoproteasomes, nonlymphoid cells expressing constitutive proteasomes would display peptides for which no CTL tolerance has been induced. In this respect, it is noteworthy that all CTL epitopes derived from ubiquitous self-proteins (like RU1, Mage-1, gp100, and Melan-A; reference 20) identified thus far are generated less efficiently by immunoproteasomes, whereas presentation of viral epitopes is, in general, enhanced after immunoproteasome expression 813141516.
The combination of MHC class I ligand motifs and constitutive/immunoproteasomal cleavage motifs for T cell epitope prediction will enhance progress in precise manipulation of specific immune responses. For example, it should now be possible to identify new CTL epitopes preferentially generated by constitutive proteasomes (like the RUI epitope). Such peptides are attractive candidates to be used as cancer vaccines, especially if they are derived from antigens that are, for example, overexpressed in tumors.
|
Acknowledgments |
|---|
Submitted: 29 March 2001
Revised: 10 May 2001
Accepted: 11 May 2001
R.E.M. Toes and A.K. Nussbaum contributed equally to this work.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Rammensee H.-G., Falk K. & Rötzschke O.. Peptides naturally presented by MHC class I molecules, Annu. Rev. Immunol., 11, 1993, 213–244.[Medline]
Rock K.L. & Goldberg A.L.. Degradation of cell proteins and the generation of MHC class I-presented peptides, Annu. Rev. Immunol, 17, 1999, 739–779.[Medline]
Pamer E. & Cresswell P.. Mechanisms of MHC class I–restricted antigen processing, Annu. Rev. Immunol., 16, 1998, 323–358.[Medline]
Coux O., Tanaka K. & Goldberg A.L.. Structure and functions of the 20S and 26S proteasomes, Annu. Rev. Immunol., 65, 1996, 801–847.
Heinemeyer W., Fischer M., Krimmer T., Stachon U. & Wolf D.H.. The active sites of the eukaryotic 20 S proteasome and their involvement in subunit precursor processing, J. Biol. Chem., 272, 1997, 25200–25209.
Dick T.P., Nussbaum A.K., Deeg M., Heinemeyer W., Groll M., Schirle M., Keilholz W., Stevanovic S., Wolf D.H. & Huber R.. Contribution of proteasomal β-subunits to the cleavage of peptide substrates analyzed with yeast mutants, J. Biol. Chem., 273, 1998, 25637–25646.
Groll M., Ditzel L., Löwe J., Stock D., Bochtler M., Bartunik H.D. & Huber R.. Structure of 20S proteasome from yeast at 2.4 Angstrom resolution, Nature., 386, 1997, 463–471.[Medline]
Boes B., Hengel H., Ruppert T., Multhaup G., Koszinowski U.H. & Kloetzel P.M.. Interferon stimulation modulates the proteolytic activity and cleavage site preference of 20S mouse proteasomes, J. Exp. Med., 179, 1994, 901–909.
Groettrup M., Ruppert T., Kuehn L., Seeger M., Standera S., Koszinowski U. & Kloetzel P.M.. The interferon--inducible 11 S regulator (PA28) and the LMP2/LMP7 subunits govern the peptide production by the 20 S proteasome in vitro, J. Biol. Chem., 270, 1995, 23808–23815.
Gaczynska M., Rock K.L. & Goldberg A.L.. -interferon and expression of MHC genes regulate peptide hydrolysis by proteasomes, Nature., 365, 1993, 264–267.[Medline]
Eleuteri A.M., Kohanski R.A., Cardozo C. & Orlowski M.. Bovine spleen multicatalytic proteinase complex (proteasome). Replacement of X, Y, and Z subunits by LMP7, LMP2, and MECL1 and changes in properties and specificity, J. Biol. Chem., 272, 1997, 11824–11831.
Cardozo C. & Kohanski R.A.. Altered properties of the branched chain amino acid-preferring activity contribute to increased cleavages after branched chain residues by the "immunoproteasome", J. Biol. Chem., 273, 1998, 16764–16770.
Sijts A.J., Standera S., Toes R.E.M., Ruppert T., Beekman N.J., van Veelen P.A., Ossendorp F.A., Melief C.J. & Kloetzel P.M.. MHC class I antigen processing of an adenovirus CTL epitope is linked to the levels of immunoproteasomes in infected cells, J. Immunol., 164, 2000, 4500–4506.
Sijts A.J., Ruppert T., Rehermann B., Schmidt M., Koszinowski U. & Kloetzel P.M.. Efficient generation of a hepatitis B virus cytotoxic T lymphocyte epitope requires the structural features of immunoproteasomes, J. Exp. Med., 191, 2000, 503–514.
van Hall T., Sijts A., Camps M., Offringa R., Melief C., Kloetzel P.M. & Ossendorp F.. Differential influence on cytotoxic t lymphocyte epitope presentation by controlled expression of either proteasome immunosubunits or PA28, J. Exp. Med., 192, 2000, 483–494.
Schwarz K., van Den B.M., Kostka S., Kraft R., Soza A., Schmidtke G., Kloetzel P.M. & Groettrup M.. Overexpression of the proteasome subunits LMP2, LMP7, and MECL-1, but not PA28 /β, enhances the presentation of an immunodominant lymphocytic choriomeningitis virus T cell epitope, J. Immunol., 165, 2000, 768–778.
Gaczynska M., Rock K.L., Spies T. & Goldberg A.L.. Peptidase activities of proteasomes are differentially regulated by the major histocompatibility complex-encoded genes for LMP2 and LMP7, Proc. Natl. Acad. Sci. USA., 91, 1994, 9213–9217.
Craiu A., Akopian T., Goldberg A. & Rock K.L.. Two distinct proteolytic processes in the generation of a major histocompatibility complex class I-presented peptide, Proc. Natl. Acad. Sci. USA., 94, 1997, 10850–10855.
Stoltze L., Dick T.P., Deeg M., Pommerl B., Rammensee H.G. & Schild H.. Generation of the vesicular stomatitis virus nucleoprotein cytotoxic T lymphocyte epitope requires proteasome-dependent and -independent proteolytic activities, Eur. J. Immunol., 28, 1998, 4029–4036.[Medline]
Morel S., Levy F., Burlet-Schiltz O., Brasseur F., Probst-Kepper M., Peitrequin A.L., Monsarrat B., Van Velthoven R., Cerottini J.C. & Boon T.. Processing of some antigens by the standard proteasome but not by the immunoproteasome results in poor presentation by dendritic cells, Immunity., 12, 2000, 107–117.[Medline]
Nussbaum A.K., Dick T.P., Keilholz W., Schirle M., Stevanovic S., Dietz K., Heinemeyer W., Groll M., Wolf D.H. & Huber R.. Cleavage motifs of the yeast 20S proteasome β subunits deduced from digests of enolase 1, Proc. Natl. Acad. Sci. USA., 95, 1998, 12504–12509.
Wedderburn R.W.M.. Quasi-likelihood functions, generalized linear models, and the Gauss-Newton method, Biometrika, 61, 1974, 439–447.
Fehling H.J., Swat W., Laplace C., Kuhn R., Rajewsky K., Muller U. & von Boehmer H.. MHC class I expression in mice lacking the proteasome subunit LMP-7, Science., 265, 1994, 1234–1237.
Arnold D., Wahl C., Faath S., Rammensee H.G. & Schild H.. Influences of transporter associated with antigen processing (TAP) on the repertoire of peptides associated with the endoplasmic reticulum–resident stress protein gp96, J. Exp. Med., 186, 1997, 461–466.
Spies T., Bresnahan M., Bahram S., Arnold D., Blanck G., Mellins E., Pious D. & DeMars R.. A gene in the human major histocompatibility complex class II region controlling the class I antigen presentation pathway, Nature., 348, 1990, 744–747.[Medline]
DeMars R., Rudersdorf R., Chang C., Petersen J., Strandtmann J., Korn N., Sidwell B. & Orr H.T.. Mutations that impair a posttranscriptional step in expression of HLA-A and -B antigens, Proc. Natl. Acad. Sci. USA., 82, 1985, 8183–8187.
Brendel V., Bucher P., Nourbakhsh I.R., Blaisdell B.E. & Karlin S.. Methods and algorithms for statistical analysis of protein sequences, Proc. Natl. Acad. Sci. USA, 89, 1992, 2002–2006.
Griffin T.A., Nandi D., Cruz M., Fehling H.J., Kaer L.V., Monaco J.J. & Colbert R.A.. Immunoproteasome assemblycooperative incorporation of interferon –inducible subunits, J. Exp. Med., 187, 1998, 97–104.
Simpson E. & Roopenian D.. Minor histocompatibility antigens, Curr. Opin. Immunol., 9, 1997, 655–661.[Medline]
Gileadi U., Moins-Teisserenc H.T., Correa I., Booth B.L. Jr., Dunbar P.R., Sewell A.K., Trowsdale J., Phillips R.E. & Cerundolo V.. Generation of an immunodominant CTL epitope is affected by proteasome subunit composition and stability of the antigenic protein, J. Immunol., 163, 1999, 6045–6052.
Shimbara N., Ogawa K., Hidaka Y., Nakajima H., Yamasaki N., Niwa S., Tanahashi N. & Tanaka K.. Contribution of proline residue for efficient production of MHC class I ligands by proteasomes, J. Biol. Chem., 273, 1998, 23062–23071.
Kuttler C., Nussbaum A.K., Dick T.P., Rammensee H.G., Schild H. & Hadeler K.P.. An algorithm for the prediction of proteasomal cleavages, J. Mol. Biol., 298, 2000, 417–429.[Medline]
Miconnet I., Servis C., Cerottini J.C., Romero P. & Levy F.. Amino acid identity and/or position determines the proteasomal cleavage of the HLA-A*0201-restricted peptide tumor antigen MAGE-3271-279, J. Biol. Chem., 275, 2000, 26892–26897.
Stoltze L., Nussbaum A.K., Sijts A., Emmerich N.P.N., Kloetzel P.M. & Schild H.. The function of the proteasome system in MHC class I antigen processing, Immunol. Today., 21, 2000, 317–319.[Medline]
Sauter B., Albert M.L., Francisco L., Larsson M., Somersan S. & Bhardwaj N.. Consequences of cell deathexposure to necrotic tumor cells, but not primary tissue cells or apoptotic cells, induces the maturation of immunostimulatory dendritic cells, J. Exp. Med., 191, 2000, 423–434.
Huang F.P., Platt N., Wykes M., Major J.R., Powell T.J., Jenkins C.D. & MacPherson G.G.. A discrete subpopulation of dendritic cells transports apoptotic intestinal epithelial cells to T cell areas of mesenteric lymph nodes, J. Exp. Med., 191, 2000, 435–444.
Steinman R.M., Turley S., Mellman I. & Inaba K.. The induction of tolerance by dendritic cells that have captured apoptotic cells, J. Exp. Med., 191, 2000, 411–416.
Kurts C., Kosaka H., Carbone F.R., Miller J.F. & Heath W.R.. Class I-restricted cross-presentation of exogenous self-antigens leads to deletion of autoreactive CD8+ T cells, J. Exp. Med., 186, 1997, 239–245.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Facebook 
Reddit 
Technorati 
Twitter What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|
