|
||
Original Article |
Action in Macrophages
Correspondence to: Herbert W. Virgin, IV, Dept. of Pathology and Immunology and Dept. of Molecular Microbiology, Washington University School of Medicine, Box 8118, 660 South Euclid Ave., St. Louis, MO 63110. Tel:314-362-9223 Fax:314-362-4096 E-mail:virgin{at}immunology.wustl.edu.
| Abstract |
|---|
|
|
|---|
Interferon (IFN)-
and macrophages (M
) play key roles in acute, persistent, and latent murine cytomegalovirus (MCMV) infection. IFN-
mechanisms were compared in embryonic fibroblasts (MEFs) and bone marrow M
(BMM
). IFN-
inhibited MCMV replication in a signal transducer and activator of transcription (STAT)-1
dependent manner much more effectively in BMM
(
100-fold) than MEF (510-fold). Although initial STAT-1
activation by IFN-
was equivalent in MEF and BMM
, microarray analysis demonstrated that IFN-
regulates different sets of genes in BMM
compared with MEFs. IFN-
inhibition of MCMV growth was independent of known mechanisms involving IFN-
/ß, tumor necrosis factor
, inducible nitric oxide synthase, protein kinase RNA activated (PKR), RNaseL, and Mx1, and did not involve IFN-
induced soluble mediators. To characterize this novel mechanism, we identified the viral targets of IFN-
action, which differed in MEF and BMM
. In BMM
, IFN-
reduced immediate early 1 (IE1) mRNA during the first 3 h of infection, and significantly reduced IE1 protein expression for 96 h. Effects of IFN-
on IE1 protein expression were independent of RNaseL and PKR. In contrast, IFN-
had no significant effects on IE1 protein or mRNA expression in MEFs, but did decrease late gene mRNA expression. These studies in primary cells define a novel mechanism of IFN-
action restricted to M
, a cell type key for MCMV pathogenesis and latency.
Key Words:
interferon
, cytomegalovirus, signal transducer and activator of transcription 1, microarray analysis, macrophage
| Introduction |
|---|
|
|
|---|
Murine CMV (MCMV)1 provides an excellent small animal model for the study of the immune control of ß-herpes virus infection. Although many studies show the importance of the IFN system, and specifically IFN-
, in controlling MCMV infection both in vivo (1) (2) (3) (4) (5) (6) (7) (8) (9) (10) and in vitro (7) (9) (11) (12) (13) (14) (15), the mechanisms by which IFN-
regulates CMV infection remain largely undefined. In addition to studies consistent with IFN-
inhibiting MCMV replication in vivo, we showed that IFN-
inhibits reactivation of MCMV from latently infected explants of spleen and lung (7), which is consistent with the finding that reactivation in vivo is enhanced by treating with Abs to IFN-
(10). Mice lacking the IFN-
receptor develop chronic MCMV-associated large vessel vasculitis, demonstrating the importance of IFN-
in regulating chronic CMV disease (7). Effects on reactivation from latency in tissue explants are due at least in part due to a blockade of growth from low levels of virus in primary cells (7), suggesting that defining mechanisms of IFN-
antiviral action in primary cells will be critical to understanding how IFN-
plays such a pivotal role in multiple stages of MCMV infection.
Identification of specific stages in viral replication blocked by IFNs has historically been critical to defining the molecular mechanisms of IFN action. Despite the importance of IFN-
in vivo, there is some conflict in the literature regarding the stage in the viral life cycle at which IFN-
blocks MCMV replication in fibroblasts, and other cell types have not been investigated. One study showed that IFN-
inhibits expression of MCMV immediate early transcripts (IE) in 3T3 cells (13), but another study in primary embryonic fibroblasts found that IFN-
blocked a late phase of MCMV infection (11). In addition to our lack of understanding of the specific targets of IFN-
action against MCMV in primary cells, it is not known how currently defined mechanisms involving protein kinase RNA activated (PKR), RNaseL, Mx1, the IFN-
/ß receptor, TNF-
receptors (TNFR1 or TNFR2), inducible nitric oxide synthase (iNOS), or Mx1 (for reviews, see references (16) (17) (18)) influence IFN-
action against MCMV.
To define the molecular mechanisms of IFN-
action, we studied its effects on two primary cell types, murine embryonic fibroblasts (MEFs) and bone marrowderived macrophages (BMM
). MEFs have traditionally been the cell type in which MCMV is propagated in vitro (19). Macrophages (M
) are an important cell in the pathogenesis of MCMV infection during both acute and latent infection, both stages at which IFN-
has an important role. M
play a key role during acute infection as mediators of spread of the virus (20) (21) (22) (23), as a predominant cell in inflammatory infiltrates occurring during MCMV infection (9) (24), and as a cell type that can determine the outcome of in vivo infection (25) (26). M
are critical to MCMV latency as a site of latent infection (27) (28) (29).
We found that IFN-
has an M
-restricted, IFN-
receptor and signal transducer and activator of transcription (STAT)-1
dependent, mechanism of action independent of PKR, RNaseL, Mx1, IFN-
/ß receptor, TNFR1, TNFR2, and iNOS. In BMM
, IFN-
targets the MCMV IE1 gene product, a key regulator of CMV gene expression (30) (31) (32).
| Materials and Methods |
|---|
|
|
|---|
Cells, Virus, and Viral Assays.
BMM
and MEFs were differentiated and maintained in low endotoxin medium containing 10% FCS, and used at passage one or two, respectively (24) (27). The differentiation state of these cells has been described previously ((33), (34), and references therein). Unless otherwise indicated, BMM
and MEFs were derived from BALB/c mice. MCMV Smith strain was obtained from the American Type Culture Collection (no. VR-194, Lot 10), grown in 3T12 cells, and quantitated by plaque assay (9). MEFs and BMM
were plated in 6-well tissue culturetreated plates (Falcon) at 2.5 x 105 cells/well with or without IFN-
(Genzyme). After 48 h, cells were infected at a multiplicity of infection (MOI) of 0.001 to 30 for 1 h at 37°C, washed twice with medium, and cultured in 1.5 ml of medium. At the times indicated, plates were frozen at -70°C and titered by plaque assay. For limiting dilution analysis, immunofluorescence, and Northern and Western analysis, cells were treated with or without 100 U/ml IFN-
for 48 h, washed with PBS-EDTA (Sigma-Aldrich), and scraped (BMM
) or detached with trypsin (MEF), counted, centrifuged, and resuspended in a minimal volume of medium (generally 1 ml/107 cells) before infection at an MOI of 1 for 2 h on ice.
Limiting Dilution Analysis.
Infected BMM
or MEFs were cultured for 2 h at 37°C to allow for internalization; washed 23 times with 10 ml media, harvested, and serially diluted twofold from 2 x 103 cells/well into 96-well plates (24 wells/dilution/experiment). MEFs were added (5 x 103 cells/well) as indicator cells for cytopathic effect (cpe). Cultures were scored for cpe at 2 and 3 wk after infection. This assay has a sensitivity of about 1 PFU/well (7) (35).
Immunofluorescence for IE1 Expression.
BMM
were plated onto 8-well Lab-Tek Glass Chamber slides (Nunc), cultured on the slides for 12 h, washed with PBS, and fixed with 1% paraformaldehyde in PBS for 20 min at room temperature. Cells were incubated overnight in blocking buffer containing 2% BSA (Sigma-Aldrich), and 10% each normal rabbit serum (Sigma-Aldrich) and goat serum (GIBCO BRL) in PBS. Immunofluorescence was performed using culture supernatant derived from the anti-IE1specific mAb line Croma (donated by M. Messerle, Ludwig-Maximilians-Universitat Munchen, Munich, Germany) or an isotype-matched IgG1 control mAb HI-gamma-1-109.3 specific for DNP (0.01 µg/ml; reference (36)) for 1 h at 4°C. Cells were then stained with FITC-conjugated goat antimouse IgG and IgM at 1:200 (Tago) in blocking buffer for 1 h at 4°C, and counterstained with bisbenzimide. Cells were coverslipped with PBS-glycerol and kept in the dark at 4°C until viewing. Slides were viewed on a ZEISS Axiophot Microscope and pictures taken with a Spot CCD camera using Northern Eclipse software (Empix Imaging). Blue bisbenzimide staining was converted to the red plane for ease of visualization of dual stained slides.
Northern Blot Analysis.
RNA was harvested at the indicated times as described (37) (38), size fractionated on a 1.5% denaturing gel, and transferred to nylon membranes (Hybond-N; Amersham Pharmacia Biotech). Probes for IE1, DNA polymerase (DNApol), or glycoprotein B (gB) were generated by PCR, using plasmid pAMB25 for IE1 (39) and the HindIII D fragment of the MCMV genome for DNApol and gB as template DNA (40). Primers for PCR were: IE1, GGGGAATGATAACAGCGACA/ATCCAGACTCTCTTTTCTGAGG; DNApol, GTGGCGTGTTGTATGATGGT/CTGGTCGTAGGTGTGGAAGC; gB (nested PCR), outer primers, CAGCCTGGAC-GAGATCAT/TCCTCGCAGCGTCTCCAATC, inner primers, CGTGTATCTCATCTTCACGAG/AGTGTCCATGTC-GGCCGTCA (23). Each PCR reaction contained: 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 2.5 mM MgCl2 (for IE1 and gB) or 1.5 mM MgCl2 (for DNApol), 0.2 mM nucleotides, 0.15 µM each primer, and 1 U Taq (Thermus aquaticus) DNA polymerase. PCR was performed on a Temp Tronic thermocycler (Barnstead/Thermolyne) for 35 cycles. Annealing temperatures were: 59.5°C for IE1 and 55°C for DNApol and gB. The probe for E1 was a 484-bp Pst1/Xho1 fragment from a 5.5-kb Pst1 fragment from the MCMV HindIII F region (40). The probe for cyclophilin was a 680-bp BamH1/HindIII fragment of pSP65 containing the rat cyclophilin gene (41). Probes were radiolabeled with [32P]dCTP (MegaPrime DNA labeling system; Amersham Pharmacia Biotech), and hybridization signals were quantified by PhosphorImager (ImageQuant; Molecular Dynamics) and normalized to cellular cyclophilin.
Western Blot Analysis.
Western analysis was performed as described (42). Generally, 23 x 106 cells were lysed directly in 0.5 ml of Laemmli sample buffer, frozen at -70°C, boiled for 5 min, and then 5 µl was run on a 12.5% polyacrylamide gel with a 5% stacking gel. Gels were transferred and then blotted using supernatant derived from the Croma cell line producing anti-IE1 mAB, or the anti-E1 mAb 20-234-28 (31), or antiß-actin mAb AC-74 (used at 1:1,000; Sigma-Aldrich). IE1 has two isoforms (pp89 and pp72; references (43) and (44)), both of which are detected by the Croma anti-IE1 mAB. A horseradish peroxidaseconjugated goat antimouse secondary was used (1:1,000; Tago), and membranes were developed using ECL Western Blotting Detection Reagents (Amersham Pharmacia Biotech). Protein quantitation was performed by comparing net intensity of predominant bands using Kodak ds1D software after photography on a DC120 camera (Eastman Kodak Co.).
Mice Used in These Studies.
All mice were housed in a Biosafety Level 2 facility at Washington University in accordance with all federal and university policies. BALB/c mice were from the National Cancer Institute, and C57BL/6 mice were from the The Jackson Laboratory. All other strains were bred at Washington University. STAT-1
deficient mice (STAT-1
-/-) and TNF double receptor knockout mice (TNFR1R2-/-) were obtained from Dr. R. Schreiber (Washington University School of Medicine, St. Louis, MO; reference (45) (46) (47)). 129 Sv/Ev mice and mice with null mutations in the IFN-
receptor (IFN-
R-/-) or IFN-
/ß receptor (IFN-
/ßR-/-) were obtained from Dr. M. Aguet (Swiss Institute for Experimental Cancer Research, Epalinges, Switzerland; reference (48)). Mice deficient in iNOS (iNOS-/-) were obtained from Dr. C. Nathan (Cornell University, New York, NY; reference (49)). Mice deficient in RNase L (RNaseL-/-) were obtained from Dr. R. Silverman (Cleveland Clinic Foundation, Cleveland, OH; reference (50)). Mice deficient in PKR (PKR-/-) were obtained from Dr. B. Williams (Cleveland Clinic Foundation, Cleveland, OH; reference (51)).
Electrophoretic Mobility Shift Assays for STAT-1
Activation.
1.52 x 106 cells per sample were treated with concentrations of IFN-
noted in text for 15 min at 37°C, and nuclear extracts were prepared as described (34). Samples were normalized according to cell number. 20% of each extract was assayed by electrophoretic mobility shift assay (EMSA) against a probe derived from the IFN-
activating sequence of the Fc
R1 promoter (52). After acrylamide gel electrophoresis (6%), gels were dried and quantified by PhosphorImager (ImageQuant). To combine data from four independent experiments, PhosphorImage values were normalized by setting the highest value to one and lowest value to zero (GraphPad Prism) and results were averaged.
Microarray Analysis.
BMM
and MEF from IFN-
/ßR-/- mice were mock infected for 1 h followed by treatment with or without 100 U/ml of IFN-
for 48 h. RNA was harvested as above. Poly A purification, generation of cDNA, fluorescent labeling, and hybridization to gene chip were performed by Genome Systems essentially as described (53). 8,717 mouse genes were analyzed on Mouse GEM 1 (Incyte Pharmaceuticals, Inc.) microarrays using the software GEMtool 2.4.1.
| Results |
|---|
|
|
|---|
IFN-
Pretreatment Inhibits Growth of MCMV in M
and MEFs.
Pretreatment for 48 h with IFN-
caused a dose-dependent inhibition of MCMV growth in both BMM
(Fig 1 A) and MEFs (Fig 1 B). Growth inhibition was more significant in BMM
than MEFs. BMM
showed a >100-fold decrease in viral titer by 72 h after infection (for example, at 100 U/ml of IFN-
), whereas MEFs showed a maximum decrease of 510-fold even at 1,000 U/ml of IFN-
. These results are consistent with other studies of IFN-
effects on the growth of MCMV in fibroblasts (11) (13) and demonstrate an antiviral effect of IFN-
in primary BMM
.
|
As lower final titers of virus were produced in untreated BMM
than untreated MEF at an MOI of 1 (Fig 1A and Fig B), we tested the hypothesis that the difference in effectiveness of IFN-
treatment between the two cell types was due to inefficient MCMV replication in M
by treating BMM
or MEFs with IFN-
, and then infecting at a variety of MOIs (0.00130; Fig 1 C and data not shown). As we increased the MOI in untreated BMM
, the yield of MCMV increased to levels equivalent to or higher than those seen in untreated MEFs, without a decrease in the effect of IFN-
(Fig 1 C). The efficacy of IFN-
in fibroblasts increased somewhat at an MOI of 0.1, a finding consistent with previous literature (7) (11) (13). However, we examined the relative efficacy of IFN-
in BMM
and MEFs at MOIs of 0.01 and 0.001 and found that IFN-
was consistently more effective at controlling MCMV growth in BMM
than MEFs (two- to fivefold in three independent experiments, not shown). We also considered the possibility that IFN-
might be more effective in BMM
via induction of cell death, but found no decrease in BMM
viability with or without IFN-
in the presence or absence of MCMV at 8 and 24 h after infection (data not shown, three independent experiments). These data showed cell type specificity of IFN-
action, with IFN-
being more effective at inhibiting MCMV growth in BMM
than in MEFs across a broad range of IFN doses, times after infection, MOIs, and regardless of the final yield of virus.
Mediators of IFN-
Inhibition of MCMV Replication in BMM
.
M
secrete molecules which may synergize with IFN-
or provide their own protective effects including: (a) IFN-
/ß, (b) TNF-
, and (c) nitric oxide (NO; references (11) and (54) (55) (56) (57) (58) (59) (60)). These molecules were not required for IFN-
action in BMM
, as IFN-
efficiently inhibited MCMV growth in BMM
derived from mice with null mutations in genes encoding the IFN-
/ß receptor (IFN-
/ßR-/-), both TNF-
receptors (TNFR1/R-/-), or iNOS (Fig 2).
|
To assess the possible role of novel IFN-
induced soluble mediators, we first demonstrated that IFN-
action requires expression of the IFN-
receptor (Fig 3 A), and then determined whether IFN-
treated wild-type BMM
secrete a mediator that inhibits growth of MCMV in IFN-
R-/- BMM
. Supernatant from IFN-
treated wild-type M
(derived from 129 or BALB/c mice) did not protect IFN-
R-/- BMM
, although wild-type M
were protected (Fig 3B and Fig C). Thus, IFN-
treatment did not induce a stable molecule that can inhibit MCMV replication in IFN-
R-/- cells. To rule out contributions of unstable mediators, we determined whether wild-type BMM
can protect IFN-
R-/- cells when the cells are cocultured. Wild-type BMM
were not able to protect IFN-
R-/- BMM
in these cultures (Fig 3 D). This experiment argues against a secretion of a IFN-
induced mediator responsible for the antiviral state of BMM
, but must be caveated with the possibility that such a mediator was induced, but also requires IFN-
induction of its receptor. Together with data in BMM
lacking known secretion-dependent antiviral mechanisms (Fig 2), these data argue that IFN-
acts in BMM
by inducing intracellular changes that result in decreased viral yield.
|
Three effector mechanisms for IFN action that involve changes in intracellular molecules have been identified: 2',5' oligoadenylate synthetase (OAS), PKR, and Mx1 (for reviews, see references (16) and (17)). BALB/c mice, the strain used for the majority of the experiments above, are deficient in Mx1 (61) (62), and therefore this pathway was not responsible for IFN-
effects in BMM
. To test the other pathways, we used BMM
deficient in RNaseL (50), the only known downstream effector of activated OAS, or in PKR (51). IFN-
effectively controlled MCMV replication in PKR-/- and RNaseL-/- BMM
(Fig 2G and Fig H).
STAT-1
Activation Is Essential for IFN-
Effects in BMM
, but STAT-1
Activation Is Similar in BMM
and MEFs.
The latent cytoplasmic transcription factor STAT-1
is a proximal signaling molecule essential for IFN-
antiviral effects against vesicular stomatitis virus (VSV) in cell lines and in vivo (45) (63). Using BMM
from mice with a null mutation in the STAT-1
gene (45), we found that the antiviral effect of IFN-
was completely dependent on STAT-1
(Fig 4 A). We therefore tested the hypothesis that lack of effective STAT-1
activation in MEF explains the lack of effective IFN-
action against MCMV in these cells (Fig 1) using EMSA (Fig 4B and Fig C). We used a probe derived from the IFN-
activated sequence of the Fc
RI promoter shown by supershift analysis to be STAT-1
specific in primary BMM
(34) (52). STAT-1
activation was similar between MEF and BMM
across a range of IFN-
doses, demonstrating that the proximal signaling cascade for IFN-
is intact in both cell types (Fig 4 B). Near maximal STAT-1
activation was seen with IFN-
doses of 10 U/ ml, and STAT-1
activation was maximal in both MEF and BMM
at a dose of 100 U/ml. Thus, the difference in effectiveness of IFN-
at inhibiting MCMV replication in MEFs and BMM
observed between 10 and 1,000 U/ml of IFN-
(Fig 1A and Fig B) cannot be explained by different proximal signaling events in these two cell types.
|
Cell Typespecific Regulation of Genes in MEFs Versus BMM
Defined by Microarray Analysis.
Although STAT-1
activation was similar in BMM
and MEF (Fig 4), the differences in IFN-
effectiveness at inhibiting MCMV growth suggested that IFN-
effects differ between MEFs and BMM
. We therefore performed microarray analysis to compare levels of 8,717 mouse genes 48 h (the time at which we infect with MCMV) after IFN-
treatment of MEFs and BMM
(Fig 5). IFN-
had less than twofold effects on the vast majority of genes in either MEFs or BMM
at the 48-h time point (Fig 5A and Fig B). However, 49 genes, many previously known to be induced by IFN-
, were changed more than fivefold in BMM
and/or MEF (Fig 5C and Fig D, and Table 1).
|
|
IFN-
induced changes in gene expression differed between MEFs and BMM
. These differences included genes whose expression was either increased or decreased in BMM
but not altered in MEFs (groups a and d, Fig 5C and Fig D, and Table 1), and genes whose expression was either increased or decreased in MEFs but not altered in BMM
(groups b and c, Fig 5C and Fig D, and Table 1). There was a group of genes whose expression was increased in both MEFs and BMM
, and these include several genes well known to be IFN inducible (group e, Fig 5C and Fig D, and Table 1). This data showed that despite similarities in STAT-1
activation, there are significant differences in IFN-
effects in MEFs versus BMM
, providing a rationale for the differences in IFN-
effectiveness at controlling MCMV growth in these two cell types.
IFN-
Decreases Viral Yield per Infected BMM
.
To determine why IFN-
is more effective at controlling MCMV growth in BMM
than MEFs, we analyzed the effect of IFN-
on sequential stages in the MCMV replication cycle in MEFs and BMM
. We first determined the frequency of cells productively infected with MCMV using limiting dilution analysis and a MEF indicator monolayer previously shown to detect 110 PFU of MCMV even in the presence of IFN-
(7) (35). IFN-
did not alter the frequency of productively infected MEFs (Fig 6 A). However, 100 U/ml of IFN-
decreased the frequency of productively infected BMM
two- to fourfold (Fig 6 A). In the absence of an IFN-
induced decrease in MCMV yield per infected cell, this difference would not explain the 100-fold decline in MCMV titer caused by the same dose of IFN-
in BMM
(Fig 1). We next quantitated IFN-
effects on the frequency of BMM
expressing the IE1 protein by immunofluorescence. IFN-
did not significantly change the frequency of BMM
expressing the IE1 protein (Fig 6). This ruled out significant effects of IFN-
on viral binding, internalization, and the frequency of cells expressing IE1 protein as an explanation for the antiviral effects of IFN-
in BMM
. However, we did notice that immunofluorescent staining for IE1 was qualitatively fainter in IFN-
treated than control BMM
(see below). Results from limiting dilution analysis and staining for IE1 protein demonstrated that IFN-
effects on MCMV titer were due to changes in the frequency of productively infected cells and viral yield per infected cell.
|
IFN-
Inhibits Expression of the MCMV IE1 mRNA during the First 3 h of Infection in BMM
but Not MEF.
We next examined whether steady-state levels of message from representative IE, early, or late genes were influenced by IFN-
treatment. IFN-
treatment of BMM
decreased expression of IE1 mRNA
10-fold at 12 h after infection (Fig 7 A). By 4 h and thereafter, levels of IE1 mRNA differed by at most twofold between BMM
treated with IFN-
or medium alone (Fig 7 A, quantitation shown in Fig 7 B). Early and late transcript levels were also decreased by IFN-
treatment in M
(Fig 7 A). DNA polymerase was decreased 313-fold (across five experiments) and glycoprotein B levels were decreased 510-fold (across five experiments). In contrast to results in BMM
, levels of IE1 mRNA were unchanged by IFN-
treatment in MEFs (Fig 7 A). In MEFs there was a slight effect of IFN-
on mRNA levels for one early gene, DNA polymerase, but not for another early gene, E1. Consistent with a previous report (11), the most dramatic effect in MEFs was seen on the level of late gene transcripts as assessed by glycoprotein B (Fig 7 A).
|
IFN-
Inhibits Expression of IE1 Protein for Prolonged Periods in BMM
but Not MEFs.
As IFN-
significantly inhibited early and late gene expression in BMM
, but had relatively subtle effects on IE1 mRNA expression after 4 h (Fig 6 B), we considered the possibility that IFN-
inhibited the expression of IE proteins (Fig 8 A), which are critical regulators of early and late gene expression (30) (31) (32).
|
IE1 (the pp89 isoform [ (43), (44)], see Materials and Methods, referred to as IE1 here) and E1 protein expression was not altered by IFN-
in MEFs. The decrease in IE1 expression seen at 8 and 12 h seen in both IFN-
treated and control MEFs samples has been described previously and is part of the normal viral replication cycle (44). There was no effect of IFN-
or virus infection on actin levels, demonstrating that the effect of IFN-
on IE1 protein expression was not due to a general degradation of protein in IFN-
treated cells.
Surprisingly, although there was no detectable effect of IFN-
on the protein level of IE1 or E1 in MEFs, there was a significant decrease (
624-fold in four experiments at all times from 324 h after infection) in IE1 and E1 protein levels in IFN-
treated BMM
(Fig 8 A, quantitation shown in Fig 8 B). There was also a decrease (about sixfold across six experiments) in the pp72 isoform of IE1 in BMM
and a smaller decrease of about two- to threefold in MEFs. The decrease in IE1 protein expression in BMM
persisted for 96 h after infection (data not shown). It was notable that the fold decrease in IE1 protein caused by IFN-
was significantly greater than the fold decrease in IE1 mRNA at multiple time points after 3 h (compare Fig 7 B and 8 B). Differences in IE1 expression between BMM
and MEFs were not MOI dependent. IE1 protein expression at 8 and 24 h after infection was not significantly inhibited in MEFs infected at MOIs ranging from 1 to 0.001 (data not shown, three independent experiments).
We considered the possibility that effects of IFN-
on IE1 protein or RNA expression were due to known mediators of IFN action RNaseL and PKR, despite the fact that these molecules were not required for IFN-
mediated inhibition of MCMV replication (Fig 2). It was possible that IFN-
mediated inhibition of IE1 protein expression was dependent on PKR, as PKR phosphorylates EIF2
, thereby inhibiting protein synthesis (64). It was also possible that activation of RNaseL might contribute to alterations in IE1 mRNA expression induced by IFN-
treatment. Therefore, we examined mechanisms of IFN-
action in more detail in PKR-/- and RNaseL-/- BMM
. By Northern and Western analysis performed on virally infected BMM
derived from PKR-/- or RNaseL-/- strains, we found that neither PKR nor RNaseL were required for IFN-
induced decreases in viral IE1 mRNA or protein levels (data not shown).
| Discussion |
|---|
|
|
|---|
In this paper we demonstrate the following important points: (a) IFN-
is much more effective at blocking MCMV replication in primary BMM
than MEFs, (b) IFN-
action in BMM
does not require known mediators of antiviral effects of IFN, (c) the mechanisms of action of IFN-
differ significantly in BMM
and MEFs, and (d) IFN-
acts by a novel mechanism, independent of RNaseL and PKR, to decrease IE1 protein expression in BMM
. Although IFN-
induced activation of STAT-1
is similar in BMM
and MEFs early after IFN-
treatment, microarray analysis showed that IFN-
regulated gene expression differently in BMM
and MEFs. Thus, IFN-
may act in different primary cells types by inducing or decreasing expression of different sets of genes. The fact that IFN-
action is cell type specific and utilizes a novel mechanism in BMM
, a cell type key for both acute and chronic MCMV infection, has important implications for understanding how IFNs regulate viral infection.
The Role of IFN-
in Cytomegalovirus Infection and the Importance of Defining Antiviral Mechanisms of IFN-
against CMV.
The role of IFN-
in cytomegalovirus infection is controversial, with published studies arguing for a role of IFN-
in either inhibiting or promoting infection. Some evidence has been presented for a role for IFN-
enhancing infection with rat CMV in vivo (65), and for a role of high dose exogenously administered IFN-
enhancing MCMV disease (3). However, multiple groups have convincingly demonstrated a protective effect of IFN-
at multiple stages of cytomegalovirus (both rat and mouse CMV) infection, including acute infection (1) (3) (6) (7) (65), prevention of chronic persistent infection (4) (5), induction of effective antigen presentation (5) (66), and inhibition of reactivation from latency (7) (10). We have additionally shown that IFN-
plays an important role in protection against vascular disease induced by either MCMV or the
-herpes virus
HV68 (7) (67).
Although these studies all argue for a protective role for IFN-
against MCMV infection, in humans IFN-
is involved in differentiation of peripheral blood mononuclear cells into M
that are permissive for human CMV replication (HCMV (68)). In these studies, IFN-
was added to freshly isolated adherent human PBMCs and 9 d later cultures were infected with HCMV. Under these conditions, IFN-
resulted in M
that replicated HCMV very efficiently. This is in striking contrast to the results we present here in which pretreatment of already differentiated cells with IFN-
inhibited replication 100-fold. We feel it likely that these differences reflect the fact that we add IFN-
before infection of already differentiated cells, whereas in the studies by Soderberg-Naucler et al. (68), IFN-
is added during the differentiation process. An argument was made by Soderberg-Naucler et al. that IFN-
does not have antiviral activity in differentiated human M
, as treatment of cultures with IFN-
after HCMV infection did not inhibit replication of the virus (68). However, this conclusion is unlikely, as IFN-
typically requires induction of gene expression to exert its effects, and thus pretreatment with IFNs is often required to observe maximal antiviral effects. Moreover, both HCMV and MCMV specifically inhibit IFN signaling (34) (69) (70) (71). Thus, one would not expect IFN-
to effectively inhibit CMV infection when added after viral infection. Notwithstanding this caveat, it is clear that under some conditions IFN-
can generate cells that efficiently replicate HCMV. In this regard, it is notable that MCMV replicates well in cells derived from IFN-
R-/- mice (Fig 3 A) and can reactivate from BMM
derived from latently infected IFN-
R-/- mice (7), demonstrating that IFN-
is not required for differentiation of permissive M
in vivo.
Although IFN-
can influence M
differentiation, resulting in HCMV permissive cells, other investigators have shown that IFN-
has antiviral effects against HCMV. Human CD4 T cells, which play an important role in controlling HCMV infection (72), secrete IFN-
(15). When the astrocytoma line, U373MG, (15) or human fibroblasts (73) are preincubated with IFN-
, significant inhibition of HCMV replication and expression of early and late gene products is observed, a result consistent with our findings as well as previous studies showing that pretreatment with IFN-
inhibits MCMV replication in fibroblasts (11) (13). Interestingly, and similar to studies presented here, evidence was presented in one study supporting an effect of IFN-
on expression of HCMV IE proteins (15).
Despite this, the mechanism of IFN-
action against MCMV has been controversial. Conclusions based on work in infected primary (11) or transformed fibroblasts (13) have been contradictory with the proposal that IFN-
targets either IE mRNA expression (13) or late mRNA expression (11). Experiments presented here help to clarify this conflict, as we found that the effects of IFN-
are cell type specific with actions on the IE stage of MCMV replication in BMM
compared with actions on the late stage of infection in MEFs. Effects of IFN on the IE stage of MCMV infection are strikingly similar to mechanisms of action against HSV-1 (74).
Potential Consequences of Cell Type Specificity.
We show here that IFN-
has cell typespecific effects against MCMV infection in vitro. This may be a generally applicable finding. IFN-
has cell typespecific effects in vivo against LCMV infection. IFN-
treatment clears hepatocyte infection, but not intrahepatic nonparenchymal cells or splenocytes (75). Fibroblasts and M
likely play distinct roles in the replication and pathogenesis of MCMV in vivo. M
have been shown to harbor latent virus (27) (28) (29). They have also been implicated in spread of the virus (20) (21) (22) (23), and play an important role in determining the outcome of MCMV disease (25) (26). Fibroblasts are more likely to play a role in the initial acute infection. Thus, the cell type specificity of IFN-
action in BMM
versus MEFs is likely to play a role in its function in vivo. Indeed, IFN-
has been shown to play a key role in terminating persistent viral infection of both MCMV and other viruses (4) (5) (7) (76) (77). As M
are a likely latent reservoir for MCMV, blockade to viral growth in these cells may explain why IFN-
plays a strong role in protecting the host against reactivation both in vitro (7) and in vivo (10). Its protective effect in M
is likely to aid in maintaining antigen presentation in light of multiple viral mechanisms which inhibit both the class I and class II pathways (34) (78) (79) (80). IFN-
has been shown to restore antigen presentation in the setting of viral infection (5) (66). Thus, the effectiveness of IFN-
against MCMV replication in M
may have important consequences for the course of pathogenesis and disease in infected mice.
Potential Mediators of IFN-
Effects on MCMV Growth and IE1 Protein Expression.
We found that the well-characterized potential effector mechanisms for IFN-
including IFN-
/ß receptors, PKR, iNOS, TNF-
receptors, Mx1, and RNaseL are not required for IFN-
mediated inhibition of MCMV growth in BMM
. However, IFN-
action in BMM
does require the IFN-
receptor and STAT-1, acts in cis in the infected cell rather than by inducing expression of additional soluble mediators, and targets a specific stage in MCMV replication. The existence of as yet undiscovered antiviral mechanisms of IFN is also suggested by residual IFN-
/ß effects against encephalomyocarditis virus in mice triply deficient for Mx1, PKR, and RNaseL (81). These alternative mechanisms may be required by the host because viruses have evolved strategies for inhibiting certain pathways of IFN action. By using multiple antiviral mechanisms specifically targeted to vulnerable stages in the replication cycle of specific viruses, the host may be able to overcome immune evasion by viruses. Many viruses, particularly those which persist in the host, have developed mechanisms to block the effectiveness of interferons, including inhibition of PKR (82) (83) and disruption of the Janus kinase (JAK)/STAT pathway (69) (70) (84). Considering the lack of a requirement for PKR or RNaseL in the antiviral effects of IFN-
against MCMV, it is tempting to postulate that MCMV may also inhibit these pathways. It has already been reported that one downstream function of IFN-
, induction of MHC class II, is inhibited by CMV infection (34) (71).
Although we have identified one target of IFN-
action against MCMV in BMM
(expression of the IE1 protein), the molecular pathways involved are not defined. The different transcriptional responses to IFN-
in BMM
versus MEFs could provide a starting point for identification of molecules responsible for the effects of IFN-
. If the stages of MCMV infection are the same in BMM
and MEFs, it seems unlikely that genes which are similarly regulated in BMM
and MEFs will explain cell typespecific effects of IFN-
. However, it is possible that a difference in the stages of MCMV infection in BMM
as opposed to MEFs could provide a target for an IFN-
induced gene in one cell type and not the other.
There are several possibilities for the mechanism of IFN-
action worth noting. It has been reported that IFN-
inhibits IE gene transcription by downregulating nuclear factor (NF)
B activity (85). The interferon inducible protein, p202, can modulate transcription by binding NF
B sites (86), and may therefore be involved in this mechanism. In support of this hypothesis, a family member of p202, the human IFN-inducible protein IFI16, has been shown to repress transcription of the HCMV UL54 promoter (87). Although we only observed decreased IE1 mRNA during the first few hours of infection, it will be interesting to evaluate whether this mechanism may be playing a role in the effect of IFN-
seen in M
infection. A second alternative mechanism involves the indoleamine 2,3 dioxygenase (IDO) pathway. In retinal pigment epithelial cells, IFN-
inhibits HCMV replication, and the effects of IFN-
are reversed by addition of L-tryptophan, an inhibitor of IDO (88). However, preliminary studies in our lab suggest that the IDO pathway is not involved in BMM
-specific IFN-
mediated protection, as neither the addition of L-tryptophan nor a specific inhibitor of IDO, 1-methyl tryptophan, reversed IFN-
mediated inhibition of MCMV growth. A third potential mediator of IFN-
effects in BMM
is IFN-
regulation of cell cycle. Cell cycle regulation by herpes viruses is a critical part of the viral life cycle (for reviews, see references (89) and (90) (91) (92) (93) (94) (95) (96)). IFN-
treatment of BMM
with IFN-
results in expression of p21waf-1, leading to arrest at the G1/S boundary (97). As the outcome of MCMV infection is dependent on cell cycle phase (94), IFN-
's effects on the cell cycle may influence CMV infection. It is possible that differences in the effectiveness of IFN-
in BMM
and MEFs reflect differences in proliferative capacity or cell cycle regulation between these two primary cell types. An interesting additional potential mechanism of IFN-
action has been recently identified in hepatitis B virus (HBV) transgenic mice. HBV gene expression in these mice is down regulated by a posttranscriptional mechanism induced by IFN-
and TNF-
(98). Recent data suggests that this is mediated by the La protein, an RNA binding protein which is associated with clearance of HBV viral RNA (99) (100). These mechanisms will need to be evaluated in the MCMV system and compared between primary MEF and BMM
. Further analysis of the specific molecules involved in the novel M
-specific mechanism of IFN-
action demonstrated here may well lead to definition of novel pathways of IFN action.
| Footnotes |
|---|
1 Abbreviations used in this paper: BM, bone marrow; EMSA, electrophoretic mobility shift assay; HBV, hepatitis B virus; HCMV, human CMV; IE, immediate early; iNOS, inducible nitric oxide synthase; MCMV, murine CMV; MEF, murine embryonic fibroblast; M
, macrophage; MOI, multiplicity of infection; PKR, protein kinase RNA activated; STAT, signal transducer and activator of transcription. ![]()
| Acknowledgements |
|---|
|
|
|---|
We thank Martin Messerle and Ulrich Koszinowski for kindly providing mAbs specific for MCMV IE1 and E1, and Carl Nathan, Bryan Williams, and Robert Silverman for kindly providing iNOS, PKR, and RNaseL-deficient mice. We thank Sam Speck, David Leib, Margaret MacDonald, Lynda Morrison, as well as members of their laboratories, for helpful comments. We thank Robert Schreiber for comments during the development of this project and for assistance with analysis of STAT-1
activation.
H.W. Virgin was supported by grant AI39616 from the National Institute of Allergy and Infectious Diseases and the Monsanto-Searle Biomedical Agreement. R.M. Presti and D.L. Popkin were supported by National Institutes of Health grant GM07200. M. Connick was supported by a Fellowship from the Pediatric Infectious Disease Society.
Submitted: 27 January 2000
Revised: 13 December 2000
Accepted: 20 December 2000
| References |
|---|
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|