|
|
|
|
|
|
|
||
Original Article |
nussen{at}rockvax.rockefeller.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and Igβ, a pair of membrane-bound Ig superfamily proteins, each of which contains a single cytoplasmic immunoreceptor tyrosine activation motif (ITAM). To determine the function of Igβ, we produced mice that carry a deletion of the cytoplasmic domain of Igβ (Igβ
C mice) and compared them to mice that carry a similar mutation in Ig (MB1C, herein referred to as IgC mice). IgβC mice differ from IgC mice in that they show little impairment in early B cell development and they produce immature B cells that respond normally to BCR cross-linking as determined by Ca2+ flux. However, IgβC B cells are arrested at the immature stage of B cell development in the bone marrow and die by apoptosis. We conclude that the cytoplasmic domain Igβ is required for B cell development beyond the immature B cell stage and that Ig and Igβ have distinct biologic activities in vivo.
Key Words: B cell receptor • immunoglobulin • immunoglobulin β • immunoreceptor tyrosine activation motif • apoptosis
The discovery that the BCR signal transducer is a heterodimer led to the proposal that the Ig
Three approaches have been used to determine the function of Ig
To compare the biologic function of Ig
Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Signals from the B cell receptor (BCR) regulate many of the essential physiologic activities in the B cell pathway. These include several different transitions in B cell development, allelic exclusion, central and peripheral tolerance, as well as B cell survival and response to antigen 1. All of these functions appear to be induced by signals emanating from the Ig-associated heterodimer of Ig and Igβ 234. Signals initiated by ligand binding to membrane (m)IgM are communicated to the Ig–Igβ transducer through a noncovalent interaction that involves polar residues in the plane of the cell membrane 567. Mutations that disrupt these polar residues interfere with signal transduction and early B cell development 5678. and Igβ subunits might have distinct biological functions. Biochemical studies showing that the cytoplasmic tails of Ig and Igβ bind to different sets of cellular kinases 9 and transfection experiments showing differences in the signaling activities of Ig and Igβ cytoplasmic domains support this idea 671011121314. However, experiments performed in mice have failed to show any differences in the biologic activities of Ig and Igβ. Similarly, there are no known qualitative differences in the activities of any of the immunoreceptor tyrosine activation motifs (ITAMs) in the CD3 chains of the TCR 15161718192021. and Igβ in vivo: transgenic expression of chimeric proteins 82223, Igβ gene deletion 24, and Ig cytoplasmic tail mutation 25. Transgenic experiments showed that the cytoplasmic domain of either Ig or Igβ was sufficient to activate allelic exclusion and pre-B cell development and led to the conclusion that Ig and Igβ are redundant in early B cell development 82223. Deletion of Igβ resulted in B cells that failed to assemble a BCR and were arrested at the pre-BI cell stage, suggesting that BCR assembly is essential for B cell development 24. Deletion of 40 of the 61 cytoplasmic amino acids of Ig, including both ITAM tyrosines (IgC 25), produced B cells that assembled a mutant BCR composed of mIgµ and an Ig–Igβ heterodimer with a truncated Ig tail. In agreement with the transgenic experiments, the single Igβ cytoplasmic domain in the IgC BCR was enough to induce pre-B cell development and allelic exclusion 825. However, the number of pre-B cells in IgC mice was reduced by 50%, immature B cells were reduced by 80%, and the number of mature B cells in spleen was only 1% of control. Thus, a BCR with only an Igβ cytoplasmic domain was unable to support later stages of B cell development. Furthermore, increased tyrosine phosphorylation in IgC B cells and increased calcium flux in response to receptor cross-linking suggested a unique negative regulatory role for the Ig cytoplasmic domain 2627. and Igβ directly, we produced mice that carry a targeted deletion of the cytoplasmic domain of Igβ.
Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Mice.
IgβC mice were created by gene targeting in 129/Sv embryonic stem cells 24. To shorten the cytoplasmic tail of Igβ by 45 amino acids and delete the ITAM, the stop codon TGA was introduced by PCR at amino acid 184 4. A unique HindIII site was placed into the targeting vector between the exons as indicated (see Fig. 1 A). A lox-P–flanked neomycin resistance gene was inserted between two XbaI sites, and sequence coding for diphtheria toxin (DTA 28) was added to the 3' end of the targeted locus at the XhoI site (see Fig. 1 A). Homologous recombination was confirmed by Southern blotting after digestion with HindIII (see Fig. 1 B). The rate of homologous recombination was 1:80. The genomic fragment used as a probe for Southern blotting was amplified by PCR using the specific primers GGATTCGAATGGTGAATGTTGG and AGGCTCTAGCTCAGTGAAGGGAG. PCR conditions were: 94°C for 5 min, and 30 cycles of 94°C for 30 s, 48°C for 45 s, and 72°C for 1 min, followed by extension at 72°C for 7 min. To delete the neomycin gene, mice carrying the targeted Igβ gene were bred to C57BL/6 Cre transgenic mice 29. Deletion of the neomycin gene was confirmed by PCR using neomycin-specific primers ATGATTGAACAAGATGGATTGCAC and TCGTCCAGATCATCCTGATCGAC. PCR conditions were: 94°C for 3 min, and 30 cycles of 94°C for 1 min, 58°C for 45 s, and 72°C for 1 min, followed by extension at 72°C for 7 min. Heterozygous IgβC mice were backcrossed to C57BL/6 mice for three generations before intercrossing to produce homozygous IgβC mice. All mice were bred and maintained under specific pathogen–free conditions.
|
C mice 25 were crossed with IgβC mice to create IgC/IgβC mixed heterozygous and homozygous mice 25. IgβC mice were also bred to C57BL/6 IgHEL Ig transgenic mice 30.
Flow Cytometry.
Single cell suspensions from bone marrow, spleen, and peritoneal cavity were stained with FITC, PE, allophycocyanin, and biotin-conjugated monoclonal antibodies visualized with streptavidin red 613 (GIBCO BRL). Monoclonal antibodies were anti-CD43, anti-IgM, anti-B220, anti-CD25, anti-IgD, anti-CD19, anti-IgMa, anti-IgMb (BD PharMingen), biotin anti-Igβ (a gift from H. Karasuyama, The Tokyo Metropolitan Institute of Medical Science, Tokyo, Japan), and anti-493 (a gift from A. Rolink, Basel Institute for Medical Science, Basel, Switzerland). For intracellular Igµ staining, cells were first surface stained with anti-B220–allophycocyanin, anti-CD25–PE, and/or anti-IgM–PE, and anti-CD43–biotin, permeabilized with Intraprep permeabilization kit (Immunotech), and incubated with Fab' fragments of FITC-goat anti–mouse IgM. Data were collected on a FACSCaliburTM and analyzed using CELLQuestTM software (Becton Dickinson).
Cell Cycle Analysis.
Bone marrow cells were incubated at 37°C for 40 min with Hoechst 33342 (Molecular Probes) diluted 1:1,000, then stained for cell surface markers with anti-B220, anti-IgM, anti-CD43, and anti-CD25. Data were collected on a FACS VantageTM and analyzed with CELLQuestTM software (Becton Dickinson).
Ca2+ Flux.
Bone marrow cells were adjusted to 5 x 106/ml in PBS plus 1% FCS plus 1 mM CaCl2 plus 1 mM MgCl2 (loading buffer), and incubated with 1.5 µM Indo-1-AM (Molecular Probes) for 30 min at 37°C. Cells were stained with PE–anti-B220 and Fab' FITC-goat anti–mouse IgM (Jackson ImmunoResearch Laboratories). Calcium flux was measured by fluorescence emission ratios of Indo-1-AM on a dual laser FACS VantageTM (Becton Dickinson) at 395/510 nm on B220lowIgM+ cells. Data were acquired for 60 s before BCR cross-linking with F(ab')2 goat anti–mouse IgM (Southern Biotechnology Associates, Inc.) at 10 or 20 µg/ml.
B Cell Cultures.
Bone marrow B cells from mutant or wild-type mice were enriched by positive selection using MACS mouse CD19 microbeads (Miltenyi Biotech) and stained with Fab' anti-IgM, and monoclonal anti-CD25, anti-CD43, and anti-B220. B cells were then sorted into B220+CD43–IgMlow immature B cells and cocultured at 106/ml with irradiated S17 stromal cells in RPMI 1640 supplemented with 10% FCS and 10 ng/ml IL-7 (BD PharMingen 31). B cell viability was assessed on days 0 and 1 by flow cytometry using PE–annexin V (BD PharMingen) and propidium iodide staining.
Immunization.
6–8-wk-old IgβC and C57BL/6 mice were immunized intraperitoneally with either 50 µg alum-precipitated 4-hydroxy-3-nitrophenylacetyl coupled to chicken gamma globulin (NP-CGG) or 50 µg NP-Ficoll in PBS. Blood was collected from the tail vein of each mouse before immunization and at days 7, 14, 21, and 28 after immunization. NP-specific IgM and IgG levels were measured by ELISA using plates coated with NP16BSA (5 µg/ml) and developed with anti-IgM coupled to horseradish peroxidase or anti-IgG coupled to horseradish peroxidase (Southern Biotechnology Associates, Inc. 32). Immunoabsorbance was read at 415 nm and titers were calculated relative to control sera from unimmunized mice. Four mice were used in each group.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
C Mice.
B cell development in IgβC mice was analyzed by multiparameter flow cytometry. When compared with wild-type controls, IgC and IgβC mice showed an increase in the number of IgM–B220+CD43+CD25– pro-B cells (25; Table and Fig. 1 C). Both strains also showed smaller numbers of IgM–B220+CD43–CD25+ pre-BII cells (fraction C'/D) than wild-type, although the 25% decrease found in IgβC mice was less substantial than the 50% decrease found in IgC mice (25; Table and Fig. 1 C).
|
cytoplasmic domain in the IgβC BCR is sufficient to trigger normal pre-BII cell division, we measured the DNA content of these cells. We found that the cell cycle distribution of large pre-BII cells in IgβC mice was similar to that of control mice (Fig. 1 C and Table ). Thus, the single cytoplasmic tail of Ig in the IgβC BCR is sufficient to trigger pre-BII cell (fraction C') proliferation.
After mIgµ triggered proliferative expansion, B cells rearrange Ig L chain genes, express surface IgM, lose CD25 expression, and then express IgD 37. Few B cells in IgC mice progress to the B220+CD43–IgM+IgD– "immature" B cell stage (fraction E) (25; Fig. 1 C, second row; B220+CD43– gated IgM histograms; IgM versus CD25, B220 versus IgM, and IgM versus IgD dot plots). In contrast, IgβC B cells proceed to this immature B cell stage in normal numbers, although the level of IgM expressed on the cell surface is lower than control (Fig. 1 C). Immature IgβC B cells fail to progress further to the CD25–IgM+IgD+ transitional B cell stage (Fig. 1 C; IgM versus CD25, B220 versus IgM, and IgM versus IgD). Failure to progress to the CD25–IgM+IgD+ transitional B cell stage is reflected in the near absence of recirculating B cells in the bone marrow and mature B cells in spleen (Fig. 1c and Fig. d). To determine whether this failure to mature is due to low levels of surface Ig–Igβ expression, we stained developing B cells with anti-Igβ monoclonal antibody 38. We found that for any given level of surface IgM expression, the level of cell surface Igβ on B220+IgM+ immature B cells was similar in IgβC B cells and controls (Fig. 1 C). Thus, IgC mice suffer a continuous loss of B cell precursors beginning at the pre-B cell stage, whereas B cell development is terminated abruptly at the immature B cell stage in IgβC mice (25; Fig. 1 C and Table ).
To determine whether arrest at the CD25+IgM+IgD– immature B cell stage is associated with increased cell death, we established in vitro bone marrow cultures 31. Immature B cells were purified by cell sorting using a Fab' anti-IgM to avoid receptor cross-linking. Cell death was measured by propidium iodide exclusion and annexin V staining (Fig. 2). Annexin V staining varies between different stages of B cell development and is therefore unreliable when comparing B cells in different stages 39. However, annexin is a reliable marker for apoptosis when comparing cells at similar stages in development 39. Freshly isolated immature IgβC and control B cells were equally viable as measured by exclusion of propidium iodide. In culture, the control immature B cells developed into CD25–IgMhiIgD+ transitional B cells, whereas the IgβC B cells did not progress beyond the CD25+IgMloIgD– immature B cell stage. Instead, IgβC B cells became increasingly annexin V and propidium iodide positive (Fig. 2). Thus, IgβC B cells that reach the CD25+IgM+IgD– immature B cell stage fail to progress and die by apoptosis.
|
cytoplasmic domain in IgβC mice is sufficient for allelic exclusion, we bred IgβC mice to IgHEL transgenic mice which carry an allotype marked Igµa H chain 30. IgHEL transgenic IgβC mice resemble nontransgenic IgβC mice in that their B cells fail to progress beyond the immature stage of B cell development, they express lower levels of surface IgM than controls, and there are few detectable B cells in the spleen and the peritoneal cavity (Fig. 3). Nevertheless, allelic exclusion is established normally in IgHEL transgenic IgβC B cells. 96% of the immature B cells in the bone marrow of both IgHEL transgenic IgβC mice and control mice expressed the IgHEL Igµa H chain, whereas only 3–4% coexpressed the endogenous Igµb H chains (Fig. 3). We conclude that the single Ig cytoplasmic domain in IgβC BCRs is sufficient to maintain H chain allelic exclusion and that transgenic antibody expression is not sufficient to induce further B cell differentiation in IgβC mice.
|
2% in IgβC mice in comparison with wild-type controls (0.64 ± 0.66 x 106 B cells, n = 5 versus 27.51 ± 5.86 x 106 B cells, n = 8). A similar block in the development and maintenance of mature B lymphocytes was present in IgC mice (splenic B cell numbers are reduced to 1% [0.21 ± 0.14 x 106, n = 5; reference 25). The maturation status of splenic B lymphocytes was examined in IgC and IgβC mice. More than 80% of B lymphocytes did not stain for the immature B cell marker 493 42 and displayed a mature phenotype (data not shown). We also examined splenic B cells for surface expression of CD23 and MHC class II and found no effect of the cytoplasmic truncations (data not shown). However, peripheral B lymphocytes in IgC and IgβC mice expressed higher levels of CD19 (Fig. 1 D). Splenic B cells in IgC mice expressed normal levels of cell surface IgM. In contrast, the splenic B cells found in IgβC mice resembled their bone marrow precursors and continued to express 10 times lower levels of surface IgM and 0.5 times lower levels of IgD than controls (Fig. 1 D).
The scarce peripheral B cells in IgC mice produce specific antibody responses to T cell–dependent but not to T cell–independent antigens 25. To determine whether IgβC B cells can respond to antigens, we immunized mice with T cell–dependent (NP-CGG) and T cell–independent (NP-Ficoll) antigens and measured specific antibody responses by ELISA. IgβC B cells mount a hapten specific immune response to NP-CGG with class switching to IgG, but do not appear to respond to NP-Ficoll. Consistent with the small number of peripheral B cells in the IgβC mice, anti-NP antibody titers were two orders of magnitude lower than controls (Fig. 4). We conclude that like IgC B cells, IgβC B cells respond to T cell–dependent but not T cell–independent antigens.
|
C mice 27. This increase in the Ca2+ response could be due to a unique negative regulatory role for Ig in developing B cells or, alternatively, to a difference in Ca2+ responses induced by IgHEL transgene expression in the IgC background 27. To determine whether altered responses to BCR cross-linking were IgC specific, we measured Ca2+ flux in response to BCR cross-linking in immature IgβC bone marrow cells. B cells expressing similar levels of surface IgM were compared by electronically gating on surface IgM expression after staining with an Fab' anti-IgM. We found no measurable differences in Ca2+ responses to anti-BCR cross-linking between immature IgβC B cells and control immature B cells (Fig. 5). In contrast, IgHEL transgenic IgβC B cells produced a higher magnitude Ca2+ response than either wild-type controls or IgHEL transgenic B cells despite lower surface IgM expression (Fig. 5). We conclude that cross-linking the BCR in immature IgβC B cells induces normal Ca2+ flux responses, whereas B cells in IgβC mice carrying the IgHEL transgene have hyperactive receptors.
|
and Igβ Tails. and Igβ is essential for pre-B cell development, we produced double mutant IgC/IgβC mice by crossing IgC and IgβC mice. IgC/IgβC mice resembled Igβ–/– mice in that B cell development was arrested at the B220+CD43+CD25– pre-BI stage (24; Fig. 6 A). We conclude that B cell development cannot proceed beyond the pre-BI stage in the absence of the cytoplasmic domains of both Ig and Igβ.
|
and Igβ are required for Ig H chain recombination and expression, we stained for intracellular Igµ. Developing B cells in IgC/IgβC, Igβ–/–, µMT, recombination activating gene (RAG)–/–, and wild-type mice were compared after cell surface staining with anti-B220, anti-CD43, anti-CD25, and anti-IgM to separate pre-BI and pre-BII cell subpopulations, and intracellular staining for Igµ to measure H chain expression. Consistent with previous reports, intracellular Igµ levels in B220+CD43+IgM– mixtures of pre-BI and pre-BII cells were decreased in Igβ–/– mice compared with wild-type controls (Fig. 6 B). IgC/IgβC and µMT mice resembled Igβ–/– mice in that their B220+CD43+ cells also showed lower levels of intracellular Igµ expression than controls. However, intracellular Igµ levels in pre-BI cells in IgC/IgβC mice were similar to Igβ–/–, µMT, and wild-type controls (B220+CD43+IgM–CD25– cells; Fig. 6 B). Therefore, the decreased Igµ expression in the developing B cells in these mutant strains is due to arrest at the pre-BI stage and lack of positive selection for B cells with an in-frame Ig H chain during pre-BII cell expansion. We conclude that the cytoplasmic domains of Ig and Igβ are essential for B cell development past the pre-BI stage, and that IgC/IgβC, Igβ–/–, and µMT are all arrested at a similar stage in development. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
or Igβ Signaling Is Essential for Pre-B Cell Development. or Igβ is essential for B cells to develop beyond the pre-BI (fraction B/C) stage. In the absence of BCR assembly, RAG–/– 4344, Igβ–/– 24, and µMT 33 B cells all fail to progress beyond the pre-BI stage. Although it has been assumed that this early block in development is due to failure to activate a BCR-dependent checkpoint, it might also be due to aberrant expression of BCR components. For example, expression of Igµ and Ig in the absence of Igβ in Igβ–/– mice produces an incomplete receptor that is not transported to the cell surface and might be toxic for developing pre-B cells. Similarly, only very low levels of Ig–Igβ are expressed on the cell surface in the absence of mIgµ in RAG–/– B cells 45. In contrast, the combination of IgC and IgβC mutations produces surface BCRs that are simply unable to signal. Therefore, the finding that IgC/IgβC B cells arrest at the pre-BI stage shows that the cytoplasmic domain of either IgC or IgβC is essential for early B cell development, and that BCR signaling as opposed to assembly is required for later stages of B cell development.
B Cell Development Differs in IgC and IgβC Mice.
Many aspects of B cell development are similar in IgC and IgβC mice. For example, pre-B cell development and allelic exclusion are activated in both strains, and there are few peripheral B cells in either. However, the two strains differ in that B cells are lost throughout development in IgC mice, whereas significant B cell loss is not apparent in IgβC mice until the late stages of B cell maturation. IgβC B cell development is arrested before high level surface IgM expression and acquisition of surface IgD. Low surface IgM expression is not characteristic of IgC mice and appears to be specific for IgβC, suggesting that the cytoplasmic domain of Igβ plays an important role in regulating surface BCR expression. Alternatively, the single Ig molecule may interfere with receptor assembly or enhance receptor degradation in IgβC mice. Failure to acquire high levels of surface IgM is not due to an intrinsic defect in BCR expression, as there is a broad spectrum of IgM expression in the selected B cells found in the spleen of IgβC mice including B cells that express high levels of surface IgM. Indeed, the heterogeneity of BCR surface expression suggests that antibody specificity contributes to setting the level of BCR expression in IgβC mice. We would like to speculate that decreased surface BCR expression is a consequence of altered BCR signaling in IgβC B cells.
The differences in B cell development between IgC and IgβC mice are reminiscent of the differences in signaling between Ig and Igβ chimeras in transfected cell lines. B and T cell lines transfected with Ig chimeras showed higher levels of signaling than those transfected with Igβ chimeras 671011121314. Furthermore, in some cell lines, chimeric receptors required both Ig and Igβ cytoplasmic domains to trigger cell death 13. However, the differences in the IgC and IgβC mice were unexpected because transgenic mice that carry Igµ–Ig or Igµ–Igβ chimeric receptors showed equivalent function in early 822 and late stages of development 23. Furthermore, in both Igµ–Ig or Igµ–Igβ transgenics, B cells developed fully and left the bone marrow whereas IgC and IgβC mice show few mature B cells in the spleen 23. Several differences between the chimeric antibody transgenics and IgC and IgβC mice could account for these apparent discrepancies. First, the transgenic mice carried artificial receptors in which the tails of Ig or Igβ were grafted onto heterologous transmembrane and external domains 82223. Second, the genes coding for the transgenic receptors were controlled by Ig regulatory elements in multicopy randomly integrated loci and therefore the regulation of expression was not that of endogenous Ig and Igβ. Finally, the transgenic receptors carried dimers of Ig or Igβ tails instead of the normal monomers and therefore had twice as many signaling ITAMs as the BCRs in IgC and IgβC mice.
Experiments performed on TCR CD3 proteins suggest that the ITAM-containing cytoplasmic domains of 
, 
, 
, and 
proteins are functionally equivalent and that multiple ITAMs merely amplify signal strength 15161718192021. However, the TCR is a complex with 4 signaling proteins containing 10 ITAMs, and the role of individual ITAMs in T cell function has not been fully explored. In contrast to the TCR, the BCR has only two transducers, each with a single ITAM, and therefore differences between IgC and IgβC mice cannot simply be due to a difference in the number of ITAMs 46.
These differences in signaling between Ig and Igβ may be attributed to the two additional non-ITAM tyrosines in the cytoplasmic domain of Ig (nos. 204 and 176; references 2 and 46). Neither of these tyrosine residues is known to be phosphorylated upon BCR cross-linking. Nevertheless, the sequence around tyrosine 204, YDQV, conforms to a consensus src homology 2 (SH2) docking site 47, and the acidic residues surrounding tyrosine 176 resemble those found in the cytoplasmic domain of erythrocyte band 3 protein, a target of ptk72 48. Therefore, tyrosine 204 and 176 in Ig may recruit a distinct set of SH2 domain–containing signaling proteins, or simply enhance signaling through Ig by increasing the number of SH2 docking sites on Ig. Other differences between Ig and Igβ that could account for the differences in signaling include higher levels of serine and threonine phosphorylation on Igβ 9 and nonconserved residues between the tyrosines in the ITAMs of Ig and Igβ that appear to modulate src kinase binding 49.
An additional distinction between IgC and IgβC mice is that the Ig tail truncation created by Torres et al. 25 shortened the cytoplasmic tail of Ig by 40 amino acids leaving 21 amino acids, including one non-ITAM tyrosine intact. Our strategy shortened the Igβ cytoplasmic tail by 45 amino acids, leaving a 3 amino acid anchor, DKD. The considerably longer remaining cytoplasmic sequence in the Ig tail truncation may have some signaling function beyond that attributable to the ITAM sequence. Thus, there may be an even greater difference between a complete Ig and Igβ tail truncation.
Hyperresponsive BCRs in IgβC IgHEL Transgenic B Cells.
The hyperresponsive phenotype found in IgβC IgHEL transgenic mice resembles the effects found in IgHEL transgenic Src homology 2 domain–containing phosphatase 1 (SHP1) and lyn-deficient mice 5051. In the absence of these negative regulators, B cells are hyperresponsive to BCR cross-linking. Therefore, one explanation for the hyperreactive phenotype in IgC and IgβC IgHEL transgenic B cells might be that their BCRs are unable to recruit negative regulators of signal transduction such as SHP1 and lyn.
In contrast to IgβC IgHEL transgenic B cells, nontransgenic IgβC B cells are indistinguishable from controls in Ca2+ flux experiments. Thus, the hyperactive phenotype appears to be Ig transgene specific. The discrepancy between IgβC IgHEL transgenic B cells and nontransgenic IgβC B cells could be due to partial compensation for abnormal B cell development in IgβC mice by the IgHEL transgene. Alternatively, the difference between transgenic and nontransgenic B cells could be due to artificially accelerated and altered B cell development in the transgenic mice.
A unique negative regulatory role for Ig was suggested by experiments with IgC mice 2627. However, IgβC IgHEL transgenic B cells resemble IgC IgHEL transgenic B cells in that they too were hyperresponsive compared with IgHEL controls in Ca2+ flux experiments. Thus, the absence of either Ig or Igβ produces a hyperreactive IgHEL transgenic B cell and this negative regulatory effect is not specific for Ig or Igβ.
Arrested B Cell Development in IgβC Mice.
Several mutations in signaling molecules and B cell coactivators have phenotypes similar to IgβC. In humans, Btk mutation interferes with B cell development at several stages, beginning at the pre-B cell stage resulting in a near absence of peripheral B cells (X-linked agammaglobulinemia 525354). In mice, Btk mutation results in a four- to fivefold decrease in the number of recent bone marrow emigrants. Although the number of mature B cells is near normal, T cell–independent responses are severely diminished in these mice 55565758. Phosphoinositide 3-kinase deficiency in mice resembles Btk mutation in that there are decreased numbers of mature peripheral B cells and decreased levels of serum Ig 5960. Mouse mutations in B cell coreceptors CD22 6162, CD19 6364, the lyn kinase 65, and the CD45 phosphatase 66 all interfere with B cell development at the immature to mature B cell transition, but these effects are more subtle and less specific than the block in B cell development seen in IgβC mice.
Immature B cells are highly susceptible to deletion induced by BCR cross-linking, a feature which is likely to contribute to B cell tolerance by removing cells with self-reactive receptors 6768. Our work shows that this checkpoint is regulated by Ig–Igβ and that Igβ plays a particularly important role in setting the threshold for B cell development beyond the immature B cell stage.
|
Acknowledgments |
|---|
A. Reichlin was supported by a National Institutes of Health KO8 training grant. This work was funded in part by a grant to K. Rajewsky from Deutsche Forschungsgemeinschaft through SFB 243, The Max Planck Research Award to K. Rajewsky, and grants from the National Institutes of Health to M.C. Nussenzweig. M.C. Nussenzweig is an Investigator in the Howard Hughes Medical Institute.
Submitted: 11 September 2000
Revised: 1 November 2000
Accepted: 3 November 2000
Abbreviations used in this paper: BCR, B cell receptor; CGG, chicken gamma globulin; ITAM, immunoreceptor tyrosine activation motif; RAG, recombination activating gene; SH2, src homology 2.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Rajewsky K.. Clonal selection and learning in the antibody system, Nature., 381, 1996, 751–758.[Medline]
Sakaguchi N., Kashiwamura S., Kimoto M., Thalmann P. & Melchers F.. B lymphocyte lineage-restricted expression of mb-1, a gene with CD3-like structural properties, EMBO (Eur. Mol. Biol. Organ.) J., 7, 1988, 3457–3464.[Medline]
Hombach J., Leclercq L., Radbruch A., Rajewsky K. & Reth M.. A novel 34-kd protein co-isolated with the IgM molecule in surface IgM-expressing cells, EMBO (Eur. Mol. Biol. Organ.) J., 7, 1988, 3451–3456.[Medline]
Hermanson G.G., Eisenberg D., Kincade P.W. & Wall R.. B29a member of the immunoglobulin gene superfamily exclusively expressed on B-lineage cells, Proc. Natl. Acad. Sci. USA., 85, 1988, 6890–6894.
Shaw A.C., Mitchell R.N., Weaver Y.K., Campos T.J., Abbas A.K. & Leder P.. Mutations of immunoglobulin transmembrane and cytoplasmic domainseffects on intracellular signaling and antigen presentation, Cell., 63, 1990, 381–392.[Medline]
Sanchez M., Misulovin Z., Burkhardt A.L., Mahajan S., Costa T., Franke R., Bolen J.B. & Nussenzweig M.. Signal transduction by immunoglobulin is mediated through Ig and Igβ, J. Exp. Med., 178, 1993, 1049–1056.
Williams G.T., Peaker C.J.G., Patel K.J. & Neuberger M.S.. The /β sheath and its cytoplasmic tyrosines are required for signaling by the B-cell antigen receptor but not for capping of for serine/threonine-kinase recruitment, Proc. Natl. Acad. Sci. USA., 91, 1994, 471–478.
Papavasiliou F., Misulovin Z., Suh H. & Nussenzweig M.C.. The role of Igβ in precursor B cell transition and allelic exclusion, Science., 268, 1995, 408–411.
Clark M.R., Campbell K.S., Kazlauska A., Johnson S.A., Hertz M., Potter T.A., Pleiman C. & Cambier J.C.. The B cell antigen receptor complexassociation of Ig-alpha and Ig-beta with distinct cytoplasmic effectors, Science., 258, 1992, 123–126.
Kim K.M., Alber G., Weiser P. & Reth M.. Differential signaling through the Ig-alpha and Ig-beta components of the B cell antigen receptor, Eur. J. Immunol., 23, 1993, 911–916.[Medline]
Taddie J., Hurley T.R., Hardwick B.S. & Sefton B.M.. Activation of B- and T-cells by the cytoplasmic domains of the B-cell antigen receptor proteins Ig- and Igβ, J. Biol. Chem., 269, 1994, 13529–13535.
Luisiri P., Lee Y.J., Eisfelder B.J. & Clark M.R.. Cooperativity and segregation of function within the Ig-alpha/beta heterodimer of the B cell antigen receptor complex, J. Biol. Chem., 271, 1996, 5158–5163.
Tseng J., Eisfelder B.J. & Clark M.R.. B-cell antigen receptor-induced apoptosis requires both Ig alpha and Ig beta, Blood, 89, 1997, 1513–1520.
Pao L., Famiglietti S.J. & Cambier J.C.. Asymmetrical phosphorylation and function of the immunoreceptor tyrosine-based activation motif tyrosines in B cell antigen receptor signal transduction, J. Immunol., 160, 1998, 3305–3314.
Romeo C., Amiot M. & Seed B.. Sequence requirements for the induction of cytolisis by the T cell antigen/Fc receptor chain, Cell., 68, 1992, 889–897.[Medline]
Shores E.W., Huang K., Tran T., Lee E., Grinberg A. & Love P.E.. Role of TCR zeta chain in T cell development and selection, Science., 266, 1994, 1047–1050.
Shinkai Y., Ma A., Cheng H.L. & Alt F.W.. CD3 epsilon and CD3 zeta cytoplasmic domains can independently generate signals for T cell development and function, Immunity., 2, 1995, 401–411.[Medline]
Malissen M., Gillet A., Ardouin L., Bouvier G., Trucy J., Ferrier P., Vivier E. & Malissen B.. Altered T cell development in mice with a targeted mutation of the CD3-epsilon gene, EMBO (Eur. Mol. Biol. Organ.) J., 14, 1995, 4641–4653.[Medline]
Dave V.P., Cao Z., Browne C., Alarcon B., Fernandez-Miguel G., Lafaille J., de la Hera A., Tonegawa S. & Kappes D.J.. CD3 delta deficiency arrests development of the alpha beta but not the gamma delta T cell lineage, EMBO (Eur. Mol. Biol. Organ.) J., 16, 1997, 1360–1370.[Medline]
Haks M.C., Krimpenfort P., Borst J. & Kruisbeek A.M.. The CD3gamma chain is essential for development of both the TCRalphabeta and TCRgammadelta lineages, EMBO (Eur. Mol. Biol. Organ.) J., 17, 1998, 1871–1882.[Medline]
Malissen B., Ardouin L., Lin S.Y., Gillet A. & Malissen M.. Function of the CD3 subunits of the pre-TCR and TCR complexes during T cell development, Adv. Immunol., 72, 1999, 103–148.[Medline]
Papavasiliou F., Jankovic M., Suh H. & Nussenzweig M.C.. The cytoplasmic domains of Ig and Igb can independently induce the pre-B cell transition and allelic exclusion, J. Exp. Med., 182, 1995, 1389–1394.
Teh Y. & Neuberger M.S.. The immunoglobulin Ig and Igβ cytoplasmic domains are independently sufficient to signal B cell maturation and activationin transgenic mice, J. Exp. Med., 185, 1997, 1753–1768.
Gong S. & Nussenzweig M.C.. Regulation of an early developmental checkpoint in the B cell pathway by Igβ, Science., 272, 1996, 411–414.[Abstract]
Torres R.M., Flaswinkel H., Reth M. & Rajewsky K.. Aberrant B cell development and immune response in mice with a compromised BCR complex, Science., 272, 1996, 1802–1804.[Abstract]
Torres R.M. & Hafen K.. A negative regulatory role for Ig-alpha during B cell development, Immunity., 11, 1999, 527–536.[Medline]
Kraus M., Saijo K., Torres R.M. & Rajewsky K.. Ig-alpha cytoplasmic truncation renders immature B cells more sensitive to antigen contact, Immunity., 11, 1999, 537–545.[Medline]
Yagi Y., Ikawa Y., Yoshida K., Shigetani Y., Takeda N., Mabuchi I., Yamamoto T. & Aizawa S.. Homologous recombination at c-fyn locus of mouse embryonic stem cells with use of diptheria toxin A-fragment gene in negative selection, Proc. Nat. Acad. Sci. USA., 87, 1990, 9918–9922.
Lakso M., Pichel J.G., Gorman J.R., Sauer B., Okamoto Y., Lee E., Alt F.W. & Westphal H.. Efficient in vivo manipulation of mouse genomic sequences at the zygote stage, Proc. Natl. Acad. Sci. USA., 93, 1996, 5860–5865.
Goodnow C.C., Crosbie J., Adelstein S., Lavoie T.B., Smith-Gill S.J., Brink R.A., Pritchard-Briscoe H., Wotherspoon J.S., Loblay R.H. & Raphael K.. Altered immunoglobulin expression and functional silencing of self-reactive B lymphocytes in transgenic mice, Nature., 334, 1988, 676–682.[Medline]
Cumano A., Dorshkind K., Gillis S. & Paige C.J.. The influence of S17 stromal cells and interleukin 7 on B cell development, Eur. J. Immunol., 20, 1990, 2183–2189.[Medline]
Qin X.F., Reichlin A., Luo Y., Roeder R.G. & Nussenzweig M.C.. OCA-B integrates B cell antigen receptor-, CD40L-, and IL4-mediated signals for the germinal center pathway of B cell development, EMBO (Eur. Mol. Biol. Organ.) J., 17, 1998, 5066–5075.[Medline]
Kitamura D., Roes J., Kuhn R. & Rajewsky K.. A B cell deficient mouse by targeted disruption of the membrane exons of the immunoglobulin µ chain gene, Nature., 350, 1991, 423–426.[Medline]
Hardy H., Carmack C.E., Shinton S.A., Kemp J.D. & Hayakawa K.. Resolution and characterization of pro-B and pre-pro B cell stages in normal mouse bone marrow, J. Exp. Med., 173, 1991, 1213–1225.
Rolink A., Grawunder U., Winkler T.H., Karasuyama H. & Melcher F.. IL-2 receptor alpha chain (CD25, TAC) expression defines a crucial stage in pre-B cell development, Int. Immunol., 6, 1994, 1257–1264.
Spanopoulou E., Roman C.A.J., Corcoran L.M., Schlissel M.S., Silver D.P., Nemazee D., Nussenzweig M.C., Shinton S.A., Hardy R.R. & Baltimore D.. Functional immunoglobulin transgenes guide ordered B-cell differentiation in Rag-1-deficient mice, Genes Dev., 8, 1994, 1030–1042.
Rolink A.G., ten Boekel E., Yamagami T., Ceredig R., Andersson J. & Melchers F.. B cell development in the mouse from early progenitors to mature B cells, Immunol. Lett., 68, 1999, 89–93.[Medline]
Koyama M., Ishihara K., Karasuyama H., Cordell J.L., Iwamoto A. & Nakamura T.. CD79 alpha/CD79 beta heterodimers are expressed on pro-B cell surfaces without associated mu heavy chain, Int. Immunol., 9, 1997, 1767–1772.
Dillon S., Mancini M., Rosen A. & Schlissel M.S.. Annexin V binds to viable B cells and colocalizes with a marker of lipid rafts upon B cell receptor activation, J. Immunol., 164, 2000, 1322–1332.
Nussenzweig M.C., Shaw A.C., Sinn E., Danner D.B., Holmes K.L., Morse H.C. III & Leder P.. Allelic exclusion in transgenic mice that express the membrane form of immunoglobulin µ, Science., 236, 1987, 816–819.
Kitamura D. & Rajewsky K.. Targeted disruption of µ chain membrane exon causes loss of heavy-chain allelic exclusion, Nature., 356, 1992, 154–156.[Medline]
Rolink A.G., Andersson J. & Melchers F.. Characterization of immature B cells by a novel monoclonal antibody, by turnover and by mitogen reactivity, Eur. J. Immunol., 28, 1998, 3738–3748.[Medline]
Mombaerts P., Iacomini J., Johnson R.S., Herrup K., Tonegawa S. & Papaioannou V.E.. RAG-1 deficient mice have no mature B and T lymphocytes, Cell., 68, 1992, 869–877.[Medline]
Shinkai Y., Rathbun G., Lam K.-P., Oltz E.M., Stewart V., Mendelsohn M., Charron J., Datta M., Young F., Stall A.M. & Alt F.W.. RAG-2 deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement, Cell., 68, 1992, 855–867.[Medline]
Nagata K., Nakamura T., Kitamura F., Kuramochi S., Taki S., Campbell K.S. & Karasuyama H.. The Ig alpha/Ig beta heterodimer on mu-negative proB cells is competent for transducing signals to induce early B cell differentiation, Immunity., 7, 1997, 559–570.[Medline]
Reth M.. Antigen receptor tail clue, Nature., 338, 1989, 383–384.[Medline]
Songyang Z., Shoelson S.E., Chaudhuri M., Gish G., Pawson T., Haser W.G., King F., Roberts T., Ratnofsky S. & Lechleider R.J.. SH2 domains recognize specific phosphopeptide sequences, Cell., 72, 1993, 767–778.[Medline]
Wang Q., Smith J.B., Harrison M.L. & Geahlen R.L.. Identification of tyrosine 67 in bovine brain myelin basic protein as a specific phophorylation site for thymus p56lck, Biochem. Biophys. Res. Commun., 178, 1991, 1393–1399.[Medline]
Clark M., Johnson S.A. & Cambier J.C.. Analysis of Iga-tyrosine kinase interaction reveals two levels of binding specificity and tyrosine phosphorylated Ig-stimulation of Fyn activity, EMBO (Eur. Mol. Biol. Organ.) J., 13, 1994, 1911–1919.[Medline]
Cyster J.G. & Goodnow C.C.. Protein tyrosine phosphatase 1C negatively regulates antigen receptor signaling in lymphocytes and determines thresholds for negative selection, Immunity., 2, 1995, 13–24.[Medline]
Cornall R., Cyster J.G., Hibbs M.L., Dunn A.R., Otipoby K.L., Clark E.A. & Goodnow C.C.. Polygenic autoimmune traitsLyn, CD22, and SHP-1, are limiting elements of a biochemical pathway regulating BCR signaling and selection, Immunity., 8, 1998, 497–508.[Medline]
Vetrie D., Vorechovsky I., Sideras P., Holland J., Davies A., Flinter F., Hammarstrom L., Kinnon C., Levinsky R. & Bobrow M.. The gene involved in X-linked agammaglobulinaemia is a member of the src family of protein-tyrosine kinases, Nature., 364, 1993, 226–233.[Medline]
Conley M., Parolini O., Rohrer J. & Campana D.. X-linked agammaglobulinemianew approaches to old questions based on the identification of the defective gene, Immunol. Rev., 138, 1994, 5–21.[Medline]
de Weers M., Brouns G.S., Hinshelwood S., Kinnon C., Schuurman R.K., Hendriks R.W. & Borst J.. B-cell antigen receptor stimulation activates the human Bruton's tyrosine kinase, which is deficient in X-linked agammaglobulinemia, J. Biol. Chem., 269, 1994, 23857–23860.
Hardy R.R., Hayakawa K., Parks D.R. & Hertzenberg L.A.. Demonstration of B cell maturation in X-linked immunodeficient mice by simultaneous three-color immunofluorescence, Nature., 306, 1983, 270–272.[Medline]
Khan V., Alt F.W., Gerstein R.M., Malynn B.A., Larsson I., Rathbun G., Davidson L., Muller S., Kantor A.B. & Hersenberg L.A.. Defective B cell development and function in Btk deficient mice, Immunity., 3, 1995, 283–299.[Medline]
Oka Y., Rolink A.G., Andersson J., Kananka M., Uchida Y., Yasui T., Kishimoto T., Kikutani H. & Melchers F.. Profound reduction of mature B cell numbers, reactivities and serum immunoglobulin levels in mice which simultaneously carry the XID and CD40-deficiency genes, Int. Immunol., 8, 1996, 1675–1685.
Rolink A., Brocker T., Bluethmann H., Kosco-Vilbois M.H., Andersson J. & Melchers F.. Mutations affecting either generation or survival of cells influence the pool size of mature B cells, Immunity., 10, 1999, 619–628.[Medline]
Fruman D., Snapper S.B., Yballe C.M., Davidson L., Yu J.Y., Alt F.W. & Cantley L.C.. Impaired B cell development and proliferation in absence of phosphoinositide 3-kinase p85a, Science., 283, 1999, 393–397.
Suzuki H., Terauchi Y., Fujiwara M., Aizawa S., Yazaki Y., Kadowaki T. & Koyasu S.. Xid-like immunodeficiency in mice with disruption of the p85alpha subunit of phosphoinositide 3-kinase, Science., 283, 1999, 390–392.
O'Keefe T., Williams G.T., Davies S.L. & Neuberger M.S.. Hyperresponsive B cells in CD22-deficient mice, Science., 274, 1996, 798–801.
Sato S., Miller A.S., Inaoki M., Bock C.B., Jansen P.J., Tang M.L.K. & Tedder T.F.. CD22 is both a positive and a negative regulator of B lymphocyte antigen receptor signal transductionaltered signaling in CD22-deficient mice, Immunity., 5, 1996, 551–562.[Medline]
Engel P., Zhou L.J., Ord D.C., Sato S., Koller B. & Tedder T.F.. Abnormal B lymphocyte development, activation, and differentiation in mice that lack or overexpress the CD19 signal transduction molecule, Immunity., 3, 1995, 39–50.[Medline]
Rickert R.C., Rajewsky K. & Roes J.. Impairment of T-cell-dependent B-cell responses and B-1 cell development in CD19-deficient mice, Nature., 376, 1995, 352–355.[Medline]
Hibbs M., Tarlinton D.M., Armes J., Grail D., Hodgson G., Maglitto R., Stacker S.A. & Dunn A.R.. Multiple defects in the immune system of Lyn-deficient mice, culminating in autoimmune disease, Cell., 83, 1995, 301–311.[Medline]
Kishihara K., Penninger J., Wallace V.A., Kundig T.M., Kawai K., Wakeham A., Timms E., Pfeffer K., Ohashi P.S. & Thomas M.L.. Normal B lymphocyte development but impaired T cell maturation in CD45-exon6 protein tyrosine phosphatase-deficient mice, Cell., 74, 1993, 143–156.[Medline]
Norvell A., Mandik L. & Monroe J.G.. Engagement of the antigen-receptor on immature murine B lymphocytes results in death by apoptosis, J. Immunol., 154, 1995, 4404–4413.[Abstract]
Sandel P.C. & Monroe J.G.. Negative selection of immature B cells by receptor editing or deletion is determined by site of antigen encounter, Immunity., 10, 1999, 289–299.[Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Facebook 
Reddit 
Technorati 
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|
