Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article Abstract Full Text (PDF, 421K) PPT slides of all figures Alert me when this article is cited Citation Map Services Email this article Similar articles in this journal Similar articles in PubMed Alert me to new content in the JEM Download to citation manager Citing Articles Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Terrence, K. Articles by Fowlkes, B.J. Search for Related Content PubMed PubMed Citation Articles by Terrence, K. Articles by Fowlkes, B.J. Social Bookmarking                            What's this?

Original Article

Premature Expression of T Cell Receptor (Tcr)β Suppresses Tcr Gene Rearrangement but Permits Development of Lineage T Cells

^a Laboratory of Cellular and Molecular Immunology, National Institutes of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland 20892-0420
Bldg. 4, Rm. 111, Laboratory of Cellular and Molecular Immunology, National Institutes of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892-0420.301-402-4891301-496-5530

bfowlkes{at}nih.gov

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
The T cell receptor (TCR) and the pre-TCR promote survival and maturation of early thymocyte precursors. Whether these receptors also influence versus β lineage determination is less clear. We show here that TCR gene rearrangements are suppressed in TCRβ transgenic mice when the TCRβ is expressed early in T cell development. This situation offers the opportunity to examine the outcome of versus β T lineage commitment when only the TCRβ is expressed. We find that precursor thymocytes expressing TCRβ not only mature in the β pathway as expected, but also as CD4^–CD8^– T cells with properties of lineage cells. In TCRβ transgenic mice, in which the transgenic receptor is expressed relatively late, TCR rearrangements occur normally such that TCRβ⁺CD4^–CD8^– cells co-express TCR. The results support the notion that TCRβ can substitute for TCR to permit a lineage choice and maturation in the lineage. The findings could fit a model in which lineage commitment is determined before or independent of TCR gene rearrangement. However, these results could be compatible with a model in which distinct signals bias lineage choice and these signaling differences are not absolute or intrinsic to the specific TCR structure.

Key Words: lineage commitment • TCR transgenic mice • thymus • differentiation • positive selection

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
The thymus is able to generate distinct types of mature T cells that are differentiated for specific TCR recognition and effector functions. Early in development, precursor thymocytes rearrange and express the genes encoding TCRs and mature as either β or lineage T cells (for reviews, see references 1, 2). The first T cells are lineages that arise only in the fetal thymus. Each of these bears a unique, canonical TCR and colonizes distinct epithelial tissues of the periphery. The T cells that populate the lymphoid organs have more diverse receptors and develop in both the fetal and adult thymus. Lymphoid T cells and precursors to the β T cell lineage (bearing the pre-TCR) appear roughly around the same time in the adult thymus and are thought to derive from a common CD4^–CD8^– precursor. The productive rearrangement and expression of the TCR or of the pre-TCR (a heterodimer of TCRβ with invariant pT) is critical for survival and further differentiation of these early thymocytes 3. Of major interest is whether these receptors play a role in β versus lineage determination or only in the progression of already committed precursors 45.

The pathways of β and T cell development are quite distinct. Although discrete stages of development have not been identified, most lineage T cells never express the CD4 or CD8β coreceptors and have no requirement for MHC for maturation 67. In contrast, precursor CD4^–CD8^– thymocytes expressing the pre-TCR proliferate, upregulate TCR rearrangement, and progress to a CD4⁺CD8⁺ intermediate stage 3. If rearrangement of TCR is productive, TCR replaces pT to form the mature TCRβ. Recognition of MHC by TCRβ is required for the development of mature β lineage T cells, expressing either CD4 or CD8. The development of an additional subset of β T cells, the so-called NK T cells, is β₂-microglobulin (β₂m) dependent 89. This minor population of T cells expresses either CD4 or no coreceptor, a restricted TCR repertoire, and is not detected until after birth. Although the lineage relationship of NK T cells to conventional β T cells is somewhat controversial, NK T cells have characteristic phenotypic and functional properties that clearly distinguish them from other T cell subsets 9.

With the advent of TCRβ transgenic mice, a novel population of TCRβ⁺CD4^–CD8^– (TCRβDN) T cells was observed 10111213. These cells appear early in the fetal thymus, colonize both epithelial and lymphoid tissues, and are especially prominent in TCRβ transgenic mice undergoing strong negative selection. Naturally, questions arose as to their origin and lineage relationship to other T cells. There was speculation that these cells could be related to the TCRβ¹CD4^–CD8^– cells of wild-type mice (NK T cells) or to the abnormal TCRβ¹CD4^–CD8^– cells observed in lpr mutant mice 14. Others suggested that they derive from conventional β T cells after the downregulation of CD4 or CD8 1415 or that they mature in the β lineage without ever expressing the CD4/CD8 coreceptors 16.

Evidence that the TCRβDN T cells mature in a lineage separate from conventional β T cells came from studies of transgenic HY TCR mice. In contrast to the CD8 T cells of these mice, the TCRβDN cells do not express endogenous TCR genes, their TCR gene segments are not deleted 17, and they do not develop in mice deficient for the common cytokine receptor chain 18. TCRβDN cells mature in the absence of the selecting MHC and, most noteworthy, in HY TCR mice with a pT null mutation (pT^–/^–), a few TCRβDN cells coexpress endogenous TCR and the transgenic TCRβ 17. Given these characteristics, it was proposed that TCRβDN cells of TCRβ transgenic mice belong to the lineage. In this model, the transgenic TCRβ replaces TCR while still allowing lineage development. This model was contested, however, in an additional report using DO11.10 TCR transgenic mice 16. Since TCRβDN cells required specific MHC for development, the authors hypothesized that these cells were β lineage T cells that mature without passing through the CD4⁺CD8⁺ intermediate stage of development.

In previous studies, there was only limited characterization of TCRβDN cells of TCRβ transgenic mice, making it difficult to determine their relationship to conventional T cell subsets. As no single marker can distinguish lineage T cells (with the exception of the TCR itself), we examined TCRβDN cells using a number of criteria (phenotype, function, development, and localization). An analysis of several strains of TCRβ transgenic mice reveals that TCRβDN cells clearly exhibit characteristics of lineage T cells. The MHC requirements for maturation and the regulation of TCR gene rearrangement are distinctly different in TCRβDN cells than in conventional β lineage T cells. The results indicate that the premature expression of TCRβ allows thymocyte precursors to mature in the lineage. These findings have implications for models of /β lineage determination.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Mice.
C57BL/6 (B6), C57BL/10 (B10), B10.A, B10.Q, and B10.D2 mice were obtained from a National Institutes of Allergy and Infectious Diseases contract to Taconic Farms, Inc., and B10.BR and BALB/c, from The Jackson Laboratory. TCRβ transgenic mice were backcrossed, intercrossed, and selected as described previously 19 to obtain H-2^b, H-2^k, H-2^d, H-2^q, H-2^b recombination activating gene (RAG)-2^–/–, H-2^q RAG-2^–/–, or H-2^b MHC class II^+/–CD4^+/– AND TCR mice 20212223; H-2^d and H-2^b class II^–/– DO11.10 TCR mice 24; and H-2^d HA TCR mice 25. H-2^b and H-2^d HY TCR mice 26 were obtained by backcrossing 12 times to B10 and then to B10.D2; H-2^b and H-2^k 5CC7 TCR mice, by crossing B6 5CC7 TCR mice 27 to B10 or B10.A; and H-2^b and H-2^b class I^–/– P14 TCR mice 28, by backcrossing 10 times to B6 and then to β₂m^–/– 29. Except where noted, all TCRβ transgenic mice were on the positive-selecting MHC background: AND TCR (H-2^b or H-2^k), 5CC7 TCR (H-2^k), DO11.10 TCR (H-2^d), HY TCR (H-2^b), and P14 TCR (H-2^b). TCR transgenic mice included the G8 TCR mice (H-2^b β₂m^–/–) crossed and selected as described 7, or H-2^b TG78 TCR mice 30, backcrossed eight times to B6.

Fetal mice were obtained from timed matings. The day of finding a vaginal plug was designated as day 0 of embryonic development. Mice were bred and maintained in a National Institutes of Allergy and Infectious Diseases Research Animal Facility or on a National Institutes of Allergy and Infectious Diseases contract to Taconic Farms, Inc., according to American Association of Accreditation of Laboratory Animal Care specifications. All protocols for animal studies were approved by the National Institutes of Allergy and Infectious Diseases Animal Care and Use Committee.

Cell Preparation, Antibodies, and Flow Cytometry.
Cultured cell lines used for these studies included: DN7.3 (TCRV2/V5), a mouse CD4^–CD8^– T cell/BW5147 hybridoma, and DCEK, a mouse L cell fibroblast line transfected with EE^bk. Thymocytes, LNs, and LN T cells were prepared in single cell suspensions as described previously 31. For enrichment of heat stable antigen (HSA)^lo (CD24^lo) thymocytes, a culture supernatant of anti-HSA (J11d) antibody was used with a 1:10 dilution of Lo-Tox–M rabbit complement (Cedarlane) and DNase (10⁶ U/ml; Calbiochem). For magnetic bead isolation of CD4^–CD8^– thymocytes or LN T cells, 10⁷ cells were reacted with 250 µl of purified H129.19 and 53-6.7 (and RA3-6B2, for LN T cells) antibodies (30 min, 4°C). CD4⁺CD8⁺ cells were removed by treatment with sheep anti–rat IgG-coated magnetic beads (30 min, 4°C) at a 5:1 bead to cell ratio, using an MPC-1 magnetic particle concentrator (Dynal). This process was repeated at a 10:1 bead to cell ratio. Epidermal lymphocytes were isolated and prepared in a single cell suspension as described 32. Trypsinized surface antigens were resynthesized in overnight culture with 20 U/ml recombinant IL-2 (Genzyme). To enrich for viable cells, harvested cells were incubated with biotin-labeled goat anti–hamster IgG (Caltag) (30 min, 4°C), washed twice, and bound to streptavidin-coated magnetic beads (Miltenyi Biotech) (30 min, 4°C). Cells were passed over a MACS column (Miltenyi Biotech) and the nonadherent fraction was collected.

Antibodies and staining reagents included: anti–TCRβ–FITC, –PE or –allophycocyanin (APC) (H57-597), anti– TCR-FITC, -PE, or unlabeled (GL3), anti-CD4–FITC, –PE, –APC, or –CyChrome (RM4-5), anti-CD8–CyChrome or unlabeled (53-6.7), anti-CD8β.2–FITC (53-5.8), anti–IL-2Rβ–FITC (TM-β1), anti-NK1.1–PE (PK136), anti-CD5–FITC (53-7.3), anti-V11 TCR–FITC or unlabeled (RR8-1), anti-V2–FITC or –PE (B20.1), anti-A^b–FITC or –PE (AF6-120.1), anti-E^k–FITC (14-445), anti–H-2K^d–FITC (SF1-1.1), anti–H-2K^k–FITC (36-75), anti–H-2K^b–FITC (AF6-88.5), anti–H-2K^q–FITC (KH-114), and anti-CD45R/B220–FITC, –PE, or unlabeled (RA3-6B2), all obtained from BD PharMingen; anti-CD8–FITC, –PE, or –biotin (CT-CD8a), anti-CD4–biotin (YTS 191.1), Thy 1.2–FITC or –PE (5a-8), streptavidin-APC or -TriColor, goat anti–mouse IgG1–PE, goat anti–mouse IgG2a–FITC, all obtained from Caltag; goat anti–rat IgG–FITC (Kirkegaard & Perry); rat anti–mouse IgG1–FITC and streptavidin-FITC (Zymed Laboratories); and anti-CD24 (J11d), anti-HY TCR (T3.70), anti-HA TCR (6.5), and anti-DO11.10 TCR (KJ-126) culture supernatants.

Cells were stained and analyzed by flow cytometry and/or electronically sorted using standard protocols 33. For some analyses, cells were pretreated with an unlabeled anti-FcR culture supernatant (24G2) to block Fc receptor binding of the labeled antibodies. Multicolor flow cytometry was performed on a FACS^® 440, FACSCalibur^TM, FACStar^PlusTM, or FACS Vantage^TM (Becton Dickinson). Dead cells were excluded by light scatter and propidium iodide gating. 150,000 events were collected for three- and four-color analyses. For live-gated samples, 10,000–20,000 CD4^–CD8^– events were collected. Isolation of thymocyte and LN T cell subsets by electronic cell sorting was performed on a FACStar^PlusTM (Becton Dickinson) or an EPICS 753 (Beckman Coulter).

For typing of transgenic or mutant mice, peripheral blood lymphocytes were stained with labeled antibody to the appropriate surface antigen, counterstained with Thy1.2 or B220 (used for live gating for T or B cells, respectively). After staining, samples were depleted of red blood cells with ACK lysing buffer (pH 7.4) and analyzed by flow cytometry.

In Vitro TCR Stimulation for Proliferation, Induction of CD8 Expression, and IL-4 Secretion.
For TCR stimulation, cells were added to U-bottomed 96-well plates coated with anti-TCR antibodies as described 31. Proliferation was determined on day 3 of culture, measuring [³H]thymidine incorporation (1 µCi/ml pulse for 18 h). Coexpression of CD8 and CD8β was assessed on day 4 of culture by flow cytometry. IL-4 production was assayed by specific ELISA 34 using 100 µl of supernatant collected at day 3 of culture and stored at –20°C.

Radiation Bone Marrow Chimeras.
Bone marrow chimeras were made as described by reconstituting irradiated recipients (1,000 rads, Cs source) with T-depleted bone marrow 19. For the cyclosporine A (CsA) experiments, reconstituted mice received daily intraperitoneal injections of 0.4 or 0.6 mg Sandimmune^TM CsA (Sandoz) in 100 µl olive oil (Bertolli Classico) or of 100 µl olive oil only, starting on day 3 after reconstitution.

Quantitative PCR.
T cell subsets were isolated by electronic cell sorting. 10⁵ sorted cells were digested using 1x PCR Buffer (PerkinElmer), 2.5 mM MgCl₂, 20 mg/ml proteinase K, 0.05% Tween 20, and 20% InstaGene Matrix (Bio-Rad Laboratories) at 56°C (2 h), followed by boiling (10 min). PCR was performed using a reaction mixture containing 1x PCR Buffer (PerkinElmer), 2.5 mM MgCl₂, 200 µM each dNTP, 12.5 pmol each primer, and 0.25 U native Taq polymerase (PerkinElmer) bound to anti-Taq (CLONTECH Laboratories, Inc.). The total reaction volume was 50 µl with 5 µl of DNA. Samples were incubated at 95°C (5 min); amplified for 40 cycles at 94°C (30 s), 56°C (1 min), and 72°C (1.5 min), and incubated at 72°C (10 min) using a 96-well plate in a PTC-100 thermocycler (MJ Research, Inc.). Aliquots of 5 µl were removed every three cycles beginning at cycle 18.

The following primers and probes were used: V2, TGTCCTTGCAACCCCTACCC; J1, TGTTCCTTCTGCAAATACCTTG; V2 probe, GAGGAAGAAGACGAAGCTATC; 5' C1, TTACAGACAAAAGGCTTGAGTC; 3' C1, GTTCTCATGTTTGACAATACATCTG; and C1 probe, CTGAAGACTAACGACACATAC.

Quantitation was performed using a modified ELISA as described 35. In brief, one primer for each gene was labeled with a 5' biotin moiety allowing capture of the PCR product on an avidin-coated plate. The second strand was denatured with 0.1 M NaOH and an FITC-labeled probe was bound to the captured strand. Bound probe was detected with an anti-FITC labeled with alkaline phosphatase in the presence of substrate, CSPD (Tropix). Chemiluminescence was measured using a luminometer (Dynatech).

To estimate the relative frequency of V2–J1 rearrangements in the experimental populations, a standard curve generated by titrating DN7.3 cells (containing three V2–J1 rearrangements per cell 36) with DCEK fibroblast cells and amplifying the serially diluted samples in the same PCR. For each sample of 10⁵ cells, a PCR ELISA was performed and the quantity of PCR product (in light units) was determined as a function of cycle number (18–39 cycles). Primers and probes specific for C1 were used to normalize the amount of DNA present. Data from the luminometer were fit to a logistic equation, and the parameters were used to calculate the cycle value at half-maximum (C₅₀) of amplification 35. C₅₀ values were plotted against the corresponding log₁₀ cell number of DN7.3 cells in each input sample and a best-fit line was generated. C₅₀ values for experimental samples obtained in the same assay could be matched to this best-fit line to estimate the relative frequency of V2–J1 rearrangements.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
CD4^–CD8^– T Cells of TCRβ Transgenic Mice Have Properties of Lineage T Cells.
Wild-type mice bear two CD4^–CD8^– subpopulations of mature T cells, one bearing TCRβ (referred to as NK T cells) and the other, TCR. In contrast, an analysis for TCR on CD4^–CD8^– T cells of HY TCR (TCRβ) transgenic mice reveals no TCR⁺ and a larger than usual population of TCRβ⁺ cells 37. Also in contrast to CD4 or CD8 β lineage T cells, the CD4^–CD8^– T cells of HY TCR and 2B4 TCR transgenic mice express only the transgenic TCR and no endogenous TCR 1738. Because of these unusual features, we further characterized the TCRβDN subset of AND TCR and other TCR transgenic mice to assess lineage properties relative to normal T cell subsets.

TCRβDN cells were analyzed for phenotype and function and compared with the NK T, T, and the major CD4 and CD8 β T cell subsets of wild-type mice, as well as CD4^–CD8^–TCR⁺ cells of TCR transgenic mice (TG78) 30. As shown previously 8, freshly isolated NK T cells of B6 mice (TCRβDN) express IL-2R (CD122) and NK 1.1, and produce high amounts of IL-4 in response to in vitro TCR stimulation (Fig. 1A and Fig. B, and Fig. 2). In contrast, the TCRβDN population of AND TCR mice expresses lower levels of these markers and produces no IL-4 (39; Fig. 1A and Fig. B, and Fig. 2). The TCRβDN cells also express relatively lower levels of CD5, delineating this subset from mature CD4 and CD8 T cells, but not from TCR⁺ T cells (Fig. 1 C). Together these phenotypic and functional properties distinguish TCRβDN cells from NK T and the major β lineage, but not from lineage T cells.

View larger version (29K): [in this window] [in a new window] [Download PPT slide]   Figure 1 Phenotypic markers distinguish the TCRβDN T cell subset of TCRβ transgenic mice from β lineage T cells (CD4 and CD8), NK T, but not from lineage T cells. Thymocytes (A and B) or B cell–depleted lymph node T cells (C) from B6, transgenic TCR (TG78), or transgenic TCRβ (AND and P14) mice were each stained for TCRβ, TCR, CD4 and/or CD8, and a fifth marker (IL-2Rβ, NK1.1, or CD5), and analyzed by flow cytometry. The mean fluorescence intensity for the specified markers was determined for CD4/CD8 single positive (SP) T cells by software gating for CD4+CD8–TCRβhi and CD4–CD8+TCRβhi, or for CD4–CD8– T cells, by live gating for CD4–CD8– followed by software gating for TCRβ+ or TCR+. Each bar represents the means (with SE bars) collected from analysis of three individual mice with the exception of B6 (two mice).

 

View larger version (24K): [in this window] [in a new window] [Download PPT slide]   Figure 2 TCRβDN T cells respond to anti-TCR stimulation by proliferating but do not produce an IL-4 response. Lymph node CD4–CD8– or CD4+ T cells from AND TCR (V11/Vβ3), CD4–8–TCR+ T cells from G8 TCR mice (purified using magnetic beads and electronic cell sorting), or HSAlo B6 thymocytes (an enriched source of NK T cells), plated at 5 x 104 cells/well, were stimulated with 10 µg/ml immobilized anti-TCR antibody (anti-V11 for AND TCR, anti-TCR for G8 TCR, and anti-TCRβ for B6 TCR) and assayed for (A) IL-4 production where 1 unit = 0.5 pg of IL-4, and for (B) proliferation. Data are representative of two experiments, averaging values from triplicate wells, and are derived from dose–response curves using 0.1–100 µg/ml of antibody.

 
T cells appear early in adult T cell development, before the β lineage T cells 404142. To assess when the TCRβDN cells arise in thymic development, we generated hematopoietic stem cell chimeras using bone marrow from AND TCR mice to reconstitute irradiated recipients. Between days 10 and 15 after reconstitution, we observed a population of V11⁺CD4^–CD8^– followed by V11⁺ CD4⁺CD8⁺ thymocytes. By days 18–20, mature CD4⁺ CD8^– thymocytes develop (data not shown). On day 15, transgenic TCR⁺ (V11) CD4^–CD8^–, and CD4⁺CD8⁺ thymocytes were sorted and stimulated in vitro using anti-V11 antibody (Fig. 3, a and b). The V11⁺CD4^–CD8^– thymocytes are competent to incorporate [³H]thymidine in response to anti-V11 cross-linking while V11-bearing CD4⁺CD8⁺ thymocytes are not. Therefore, like T cells, TCRβDN T cells appear well before the CD4⁺ CD8^– thymocytes and much earlier than NK T cells that arise after the CD4⁺CD8^– and CD4^–CD8⁺ thymocytes in wild-type mice 8.

View larger version (24K): [in this window] [in a new window] [Download PPT slide]   Figure 3 TCRβDN cells appear early in thymic development. Thymocytes were harvested day 15 after reconstituting B10.BR or B10.A RAG-2–/– irradiated recipients with T-depleted H-2k AND TCR bone marrow. (a) Cells were stained for CD4, CD8, and V11 TCR and analyzed by three-color flow cytometry. (b) Thymocytes were electronically sorted for V11+CD4+CD8+ and V11+CD4–CD8–. Sorted cells (12 x 104/well) were tested in a proliferation assay for response to plate-bound anti-V11 (RR8-1) antibody. Proliferation data are representative of two sorting experiments, and the cytometric analysis on day 15 is representative from several series of analyses performed on thymocytes from chimeric mice on days 10–20 after reconstitution.

 
Previous studies 434445 have indicated that the development of the major β T cell subsets (CD4/CD8), as well as the minor TCRβ⁺CD4^–CD8^– (NK T) subset of wild-type mice, are inhibited by CsA. lineage T cells are relatively less sensitive. To further assess lineage properties, TCRβDN cells of AND TCR mice were tested for sensitivity to CsA, administered over the course of adult T cell development. Irradiated recipients reconstituted with AND TCR bone marrow were treated daily with CsA for 5 wk, after reconstitution. As shown in Table , the development of V11⁺CD4^–CD8^– TCR⁺ is up to 75-fold less sensitive to CsA than are V11⁺CD4⁺CD8^– thymocytes. These data indicate that TCRβ⁺DN cells are relatively resistant to CsA administered during development, as are lineage T cells.

View this table: [in this window] [in a new window]   Table 1 Effect of CsA on Developing Thymocyte Subsets

 
Since CD4^–CD8^– TCR⁺ thymocytes of wild-type mice can be induced to express CD8 after in vitro activation (46; Fig. 4 c), we tested the ability of mature TCRβDN cells to make this response. As shown in Fig. 4, a and b, V11⁺CD4^–CD8^–, but not V11⁺CD4⁺ T cells, are induced to express CD8 in response to anti-TCR stimulation. Similar responses have been obtained from TCRβDN splenocytes of TCR transgenic mice 39. Thus, by all of the criteria we examined, TCRβDN cells are clearly distinguished from conventional β lineage and NK T cells, and most resemble lineage T cells.

View larger version (26K): [in this window] [in a new window] [Download PPT slide]   Figure 4 TCR stimulation can induce CD8 expression on TCRβ DN T cells. (a) V11+ CD4–CD8–, (b) V11+CD4+ lymph node T cells from AND TCR mice (isolated by electronic cell sorting and cultured at 4 x 104/well on 30 µg/ml plate-bound anti-V11, RR8-1, in the presence of recombinant IL-1 and IL-2, 100 U/ml, each), and (c) CD4–CD8– thymocytes of day 1 neonatal mice (isolated by magnetic bead depletion and cultured at 10 x 104/well on 24 µg/ml immobilized anti-, GL-3, in the presence of rIL-1 and rIL-2, 20 U/ml each) were assayed for expression of CD8 and CD8β by flow cytometry. The data are representative of three or more experiments. B6 LN T cells were used as a positive control for CD8β staining (data not shown).

 
TCRβ DN Cells of TCRβ Transgenic Mice Do Not Require MHC for Development.
One of the hallmarks of β T cell development is the requirement for MHC-specific positive selection 47. In contrast, T cells fully mature in the absence of MHC 67. Since there are conflicting reports on the selection requirements of TCRβDN cells 101216, we tested several strains of TCRβ transgenic mice, bearing MHC class I– or class II–specific TCRs. As shown in Fig. 5, the TCRβDN cells of five different strains of TCRβ mice develop equally well in the positively selecting or in the neutral (nonselecting) MHC background. Development is comparable both in percentage (Fig. 5) and in absolute number (data not shown). Thus, TCRβDN cells show no MHC dependence for development, in clear contrast to mainstream β lineage T cells (CD4^–CD8⁺ or CD4⁺CD8^–) of the same mice that show an absolute requirement for specific MHC. These findings argue against the view that TCRβDN cells derive from conventional CD4 or CD8 T cells by the downregulation of a coreceptor.

View larger version (51K): [in this window] [in a new window] [Download PPT slide]   Figure 5 TCRβDN cells do not require MHC-dependent positive selection for development. Thymocytes were isolated from MHC class I–specific (HY and P14) or class II–specific (AND, 5CC7, and DO11.10) TCR transgenic mice bred onto a positively selecting (pos) or nonselecting, neutral (neut) MHC background. Cells were stained for CD4, CD8, and TCR (using antibodies: T370 for HY, anti-V2 for P14, anti-V11 for AND and 5CC7, and KJ-126 for DO11.10 TCR). The percent of transgenic (tg) TCRhi cells was determined from analysis of total thymocytes by software gating for CD4–CD8–, CD4–8+, or CD4+CD8–. Each bar represents the mean percentage (with SE bars) of TCRhi of CD4–CD8– or of total thymocytes from analyses of three to six individual mice per group.

 
TCRβDN Cells of Some Strains Coexpress Endogenous TCR and Transgenic TCRβ.
The analyses above indicate that TCRβDN cells have lineage properties. Therefore, CD4^–CD8^– T cells of several strains of TCRβ transgenic mice were analyzed for expression of TCR. An obvious population of CD4^–CD8^– thymocytes and peripheral T cells bearing only the transgenic TCRβ was apparent in all of the mice analyzed. In some strains, however, there existed a second subset of CD4^–CD8^– T cells coexpressing the transgenic TCRβ and endogenous TCR (Fig. 6 and Table ). This latter subset bearing both TCRs was most prominent in the P14 TCR mice. It is noteworthy that like the TCRβDN subset of AND TCR mice, both TCRβDN–bearing subsets of P14 TCR mice exhibited properties of lineage T cells (Fig. 1 and data not shown). It was previously reported that TCR⁺ cells develop in P14 TCR mice 48; however, it was not appreciated that these T cells coexpress the transgenic TCRβ.

View larger version (40K): [in this window] [in a new window] [Download PPT slide]   Figure 6 CD4–CD8– T cells of AND and HY TCR mice express transgenic TCRβ but no TCR, while those of P14 TCR mice coexpress transgenic TCRβ and endogenous TCR. Thymocytes and lymph node cells, stained for TCRβ (H57-597), TCR (GL3), CD4, and CD8, were analyzed by flow cytometry using live gating to collect data only from CD4–CD8– cells. The numbers inside the quadrants represent the percentage of CD4–CD8– thymocytes in each population. Statistics are given in Table .

 

View this table: [in this window] [in a new window]   Table 2 Coexpression of Transgenic TCRβ and Endogenous TCR in CD4–CD8– Thymocytes

 
These different patterns of TCR expression prompted us to investigate the timing of transgenic TCRβ expression during fetal thymic ontogeny, using the AND and P14 TCR mice as prototypes. As shown in Fig. 7, AND TCR is expressed early on a majority of E14 thymocytes. In contrast, the P14 TCR is first detected around E15–16, and then only on a minor subset of fetal thymocytes. These data, considered together with the data from adult thymocytes in Fig. 6, suggest that very early expression of the transgenic TCRβ inhibits endogenous TCR gene rearrangement and/or expression.

View larger version (39K): [in this window] [in a new window] [Download PPT slide]   Figure 7 The transgenic AND TCR is expressed much earlier than the P14 TCR in fetal development. Thymocytes from P14 TCR or AND TCR embryos, harvested on the days indicated (E13–18), were stained for Thy 1.2, CD4, CD8, and TCR (V2 for P14 and V11 for AND) and analyzed by four color flow cytometry. Distributions, gated for total Thy1.2+ thymocytes, display dual parameter, CD4 and CD8, or single parameter, TCR (shaded), overlaid with the negative control for background fluorescence (unshaded). Numbers indicate the percentage of cells within the indicated gates. Data are representative of two such experiments with similar time courses.

 
Endogenous TCR Gene Rearrangements Are Suppressed in TCRβDN Cells of AND, but Not in TCRβDN Cells of P14 TCR Mice.
To determine the basis for differences in TCR expression in TCRβDN cells of AND and P14 TCR mice, TCR gene rearrangements were examined using a quantitative PCR assay. Since TCRV2 is commonly used by lymphoid T cells 49, the frequency of TCRV2J1 rearrangement was determined in mature T cell subsets (Fig. 8). The analyses indicate that this gene rearrangement is much more suppressed in TCR⁺CD4^– CD8^– (TCRβDN) cells of AND TCR than of P14 TCR mice. Similar differences between AND TCR and P14 TCR mice were observed with other V and V gene segments, although the rearrangement frequencies were much lower (data not shown). Of note, the occurrence of V2J1 rearrangement in TCR⁺CD4^–CD8^– T cells of P14 TCR mice is equivalent to those of TCR⁺ cells of G8 TCR (V2⁺) transgenic mice and of B6 wild-type mice (Fig. 8 a). Thus, in the P14 TCR mice that express the transgenic receptor relatively late, TCR rearrangement is uninhibited and TCRβDN cells bearing TCR are observed (Fig. 6Fig. 7Fig. 8).

View larger version (40K): [in this window] [in a new window] [Download PPT slide]   Figure 8 V2–J1 gene rearrangements are suppressed in TCR+ CD4–CD8– (TCRβDN) cells of AND TCR but not of P14 TCR mice. Rearrangements are suppressed, independent of MHC haplotype, in the TCRβDN but not the TCR+CD4+CD8– subset of AND TCR mice. Samples of 105 each of TCR+ (V11+ for AND, V2+ for P14, TCR+ for G8 TCR, and TCR+ or TCRβ+ for B6) (a) CD4–CD8–, (b) CD4+CD8–, and (c) CD4–CD8+ lymph node T cells from AND TCR/H-2b, AND TCR/H-2b (MHC class II+/–, CD4+/–), AND TCR/H-2q, P14 TCR, G8 TCR, and B6 mice were isolated by electronic sorting. The relative frequency of V2–J1 rearrangements per sample was determined using a PCR ELISA as described in Materials and Methods. Bars represent the mean values (with SEs) of three individual sorts, using a total of five to eight mice per sort.

 
Interestingly, an analysis of the frequency of V2J1 rearrangements in CD4 T cells of AND TCR mice is increased in the semiselecting (class II^+/–, CD4^+/–) or nonselecting (H-2^q) MHC background in comparison over the frequency in the selecting MHC (H-2^b) background (Fig. 8 b). These results fit with the notion that MHC engagement terminates RAG expression during β development 50. In contrast, the TCRβDN cells developing in the CD4^–CD8^– () pathway follow different rules since rearrangement frequency is independent of MHC (Fig. 8 a). These findings suggest that TCR gene rearrangement is differentially regulated in the and β lineages.

TCR Is Expressed by Skin Lymphocytes of AND TCR Mice.
TCR gene rearrangements in thymocyte precursors that localize to skin epithelium occur much earlier in fetal development than those destined for migration and residence in the lymphoid tissues 2. Therefore, there was the possibility that the dendritic epidermal T lymphocytes of AND TCR mice would express TCR since some of their thymic precursors may have rearranged TCR before transgenic TCRβ expression. In contrast to the lymphoid CD4^–CD8^– T cells that fail to express TCR (Fig. 6), skin lymphocytes express two subsets of T cells (Fig. 9), one expressing TCRβ alone and the second expressing both TCRβ and TCR. Thus, when TCRβ transgene expression occurs after endogenous TCR rearrangements, rearrangement is not suppressed, and TCR and TCRβ can be expressed by the same cells. We determined in parallel analyses that these cells are CD4^–CD8^–, V11⁺, Vβ3⁺, and V3⁺.

View larger version (43K): [in this window] [in a new window] [Download PPT slide]   Figure 9 In contrast to lymphoid T cells, skin dendritic epithelial lymphocytes of AND TCR mice contain two subsets of T cells, one bearing only the transgenic TCRβ and a second coexpressing the transgenic TCRβ with endogenous TCR. Isolated epidermal lymphocytes of (a) H-2d AND TCR transgenic (tg) or (b) nontransgenic (non tg) B10.D2 mice were stained for TCRβ (H57-597) and TCR (GL3) and analyzed by flow cytometry. The numbers inside the quadrant represent the percentage of cells in each population. The data are representative of several analyses of AND TCR mice of H-2d or other H-2 haplotypes.

 
In the periphery of normal mice, the canonical V3⁺ TCR is expressed exclusively on skin lymphocytes 2. The finding that T cells, bearing the AND TCR and coexpressing the expected TCR, can home at the right time to what is normally a -specific site, provides additional evidence that TCRβDN cells are lineage T cells. Presumably, the skin lymphocytes expressing only the transgenic TCRβ have an out of frame TCR or, alternatively, some cells express the transgenic TCR early enough to suppress endogenous TCR rearrangements. In any case, the finding that even the TCRβ⁺TCR^– subpopulation is able to traffic to this traditionally -specific site demonstrates that skin homing is not dependent on the canonical TCR. These data, like those above, reveal that when the TCR is expressed early (regardless of whether it is TCR or TCRβ), the receptor allows lineage commitment and maturation in the lineage.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
These studies examine T cell development in transgenic mice with premature expression of TCRβ. An interesting feature of the mice is a population of mature CD4^–CD8^– thymocytes and peripheral T cells, expressing only the transgenic TCRβ (TCRβDN). To determine whether TCRβDN cells belong to the β or lineage, we analyzed these cells in several TCR transgenic strains and compared them to the T cell subsets of normal mice. By all criteria examined, the TCRβDN cells clearly exhibit characteristics of lineage T cells. The lack of a coreceptor, the level of CD5, and the early maturation delineate TCRβDN cells from the major TCRβ⁺ CD4 and CD8 T cell subsets. TCRβDN cells do not express NK1.1 or IL-2Rβ (CD122) or produce IL-4, distinguishing them from the NK T cells of wild-type mice. In contrast, TCRβDN cells are similar to T cells since their development is early, is relatively insensitive to CsA, and is MHC independent. Also, like lineage cells, TCRβDN cells can be induced to express CD8 homodimers in response to anti-TCR stimulation. Most notable, in TCRβ strains where the transgenic receptor is expressed later in development, CD4^–CD8^– T cells arise coexpressing the transgenic TCRβ and endogenous TCR (Table , and Fig. 6 and Fig. 7). TCRβDN cells with both receptors exhibit the same phenotype and properties as those lacking TCR expression. These findings provide the most direct evidence that TCRβDN cells are lineage T cells.

The different patterns of TCR expression in CD4^–CD8^– T cells of TCRβ mice appear to be related to the timing of TCRβ transgene expression with respect to endogenous TCR gene rearrangement. As modeled in Fig. 10, the early expression of transgenic TCRβ in precursor thymocytes of AND TCR mice causes suppression of endogenous TCR gene rearrangement; nevertheless, the transgenic receptor allows continued maturation in the CD4^–CD8^– () pathway. In P14 TCR mice, the transgenic receptor is expressed later such that TCR gene rearrangements occur normally. If rearrangements are productive, mature CD4^–CD8^– T cells emerge coexpressing the TCRβ (P14 TCR) and endogenous TCR (Fig. 6Fig. 7Fig. 8, and Table ). The different TCR expression patterns in skin versus lymph node CD4^–CD8^– T cells of AND TCR mice also can be explained by this model. A subset of epidermal lymphocytes coexpresses the transgenic TCRβ and endogenous TCR (Fig. 9), but lymph node T cells bear only the transgenic TCRβ (Fig. 6). Thus, the rearrangements of genes encoding the lymphoid type TCR are suppressed by AND TCR expression, whereas rearrangements that occur early in the fetal thymus, encoding the TCR of skin lymphocytes, are not suppressed. Of significance, either TCR expression pattern allows development in the CD4^–CD8^– () pathway.

View larger version (27K): [in this window] [in a new window] [Download PPT slide]   Figure 10 A model to explain the different patterns of TCR expression in CD4–CD8– thymocytes of TCRβ transgenic mice. Lymphoid-type TCR gene rearrangements occur at a distinct time (stage) in thymocyte development. In AND TCR mice, the transgenic TCRβ is expressed early with respect to TCR gene rearrangement and rearrangement is suppressed. Since transgenic TCRβ expression occurs somewhat later in P14 TCR mice, there is no interference with rearrangement and cells with in-frame TCR rearrangements can express both the transgenic TCRβ and endogenous TCR. Irrespective of the TCR expression pattern, CD4–CD8– cells mature with properties of lineage T cells.

 
We have considered these and previous results for understanding the role of the TCR in β versus lineage determination. Evidence exists for an instructional model in which successful rearrangement of TCR or TCRβ genes biases the decision of a precursor to become a or β lineage T cell. Of note, β lineage T cells are depleted of productive TCR and - rearrangements, suggesting that the production of a functional TCR favors a lineage decision 515253. In addition, mice deficient for the pT component of the pre-TCR show an increase in the number of lineage T cells, implying that normally pre-TCR signals inhibit lineage development 54. Other studies, however, have prompted speculation that /β lineage determination may occur before or independent of TCR gene rearrangement 55565758. Of relevance, a few CD4⁺CD8⁺ thymocytes arise in TCRβ^–/– null mutant mice 59, and these cells are enriched for in-frame TCR rearrangements 6061, indicating that TCR, in some circumstances, can promote β development. Moreover, CD4⁺CD8⁺ cells develop, although inefficiently, in TCR transgenic mice when endogenous TCRβ recombination is diminished or suppressed 5662. Even in normal mice, a minor population of TCR-bearing CD4⁺CD8⁺ cells has been observed 63. Complicating the issue further are reports that the majority of TCRβ rearrangements are productive in TCR⁺ T cells 5164. Others disagree, finding that these rearrangements are predominantly out of frame 65. Clearly, the data on this question are mixed and the issue is unresolved.

Since a transgenic TCRβ permits both and β development, our results and those of others 173839 could fit a model in which /β fate is predetermined, before or independent of TCR rearrangement/expression 466. In this scenario, the TCR plays no role in lineage commitment but is needed only for survival and/or lineage progression. While this model would not always couple the appropriate TCR with lineage commitment, it is noteworthy that additional mechanisms operate to correct TCR expression in the wrong lineage. In the β lineage, TCR is downregulated at the CD4⁺CD8⁺ stage 67 and TCR rearrangement results in the deletion of the TCR locus. In the pathway, pT is turned off 68 and TCR rearrangement is not upregulated 69.

At first glance, the finding that premature expression of TCRβ can permit both a and β cell fate appears to be inconsistent with an instructional mechanism for lineage commitment. However, one version of an instructional model proposes that TCR and pre-TCR signals influence lineage commitment, but does not necessarily imply that signaling differences are absolute or inherent in the TCR structure. Thus, quantitative differences in TCR and pre-TCR signaling could bias lineage choice. Perhaps signals generated by the prematurely expressed transgenic TCRβ quantitatively mimic TCR signals. An additional possibility is that the timing of TCR expression influences the lineage decision. Recent evidence indicates that TCR rearrangements occur slightly ahead of TCRβ in adult thymopoiesis 4142. Conceivably, these ordered rearrangements could be coordinated with developmentally regulated changes in TCR signal transduction such that the earliest TCR signals promote a fate, whereas later TCR signals favor an β fate. Our data could fit with such a sequential model since distinct TCR signals regulating lineage choice would be generated as a function of time, irrespective of TCR substitutions. In some sense, this sequential model can be seen as both predetermined and instructional: predetermined, since changes in intracellular TCR signals over time are developmentally preprogrammed, and instructional, since distinct signals mediate lineage commitment. However, such signals are not inherent to the TCR structure. In any case, the previous results demonstrating that β T cells are depleted of in-frame TCR rearrangements 515253 and the low frequency of productive TCRβ rearrangements in T cells 65 support a sequential model.

TCRβ transgenic mice are widely used to study antigen-specific immune responses in vivo. The studies reported here should send a note of caution regarding the use of such mice for this purpose. If, as we conclude, the transgenic TCRβ receptor can substitute for the TCR in lineage T cells, cells that would normally be immunologically silent can now participate in an antigen-specific response. Because T cells have unique developmental, functional, and homing properties, they could contribute to the response in nonphysiological ways. Thus, difficulties with these mice could be related to the large number of mature T cells expressing a single TCR, but also because lineage cells (bearing transgenic TCRβ) contribute to the antigenic response in unpredictable ways. Even sorting for CD4⁺ cells may not help, since a few T cells express CD4 57. A new generation of TCR transgenic mice, with delayed TCRβ expression, may provide a solution to this problem.

	Acknowledgments

 
The authors thank S. Hedrick, H. von Boehmer, D. Loh, F. Alt, L. Glimcher, B. Koller, H. Pircher, M. Davis, J. Bluestone, and G. Sims for gifts of transgenic or gene-targeted mutant mice, and A. Kruisbeek and Ron Germain for cell lines. We thank our colleagues R. Swofford and C. Eigsti for flow cytometry and sorting, and A. Bendelac, S. Gurunathan, E. Schweighoffer, E. Robey, and Juan Zuniga-Pflucker for advice, assistance, and/or critical comments on the manuscript.

K. Terrence and C. Pavlovich performed this work as Howard Hughes Medical Institute–National Institutes of Health Research Scholars.

Submitted: 7 April 2000
Revised: 23 May 2000
Accepted: 25 May 2000

Abbreviations used in this paper: APC, allophycocyanin; β₂m, β₂-microglobulin; B6, C57BL/6; B10, C57BL/10; CsA, cyclosporine A; HSA, heat stable antigen; RAG, recombination activating gene; TCRβDN, TCRβ⁺CD4^–CD8^–.

K. Terrence and C.P. Pavlovich contributed equally to this work.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

Bluestone J.A., Cron R.Q., Barrett T.A., Houlden B., Sperling A.I., Dent A., Hedrick S., Rellahan B. & Matis L.A.. Repertoire development and ligand specificity of murine TCR cells, Immunol. Rev., 120, 1991, 5–33.[Medline]

Allison J.. T-cell development, Curr. Opin. Immunol., 5, 1993, 241–246.[Medline]

von Boehmer H., Aifantis I., Azogui O., Feinberg J., Saint-Ruf C., Zober C., Garcia C. & Buer J.. Crucial function of the pre-T-cell receptor (TCR) in TCRβ selection, TCRβ allelic exclusion and β versus lineage commitment, Immunol. Rev., 165, 1998, 111–119.[Medline]

Kang J. & Raulet D.H.. Events that regulate differentiation of β TCR⁺ and TCR⁺ T cells from a common precursor, Semin. Immunol., 9, 1997, 171–179.[Medline]

Robey E. & Fowlkes B.J.. The β versus T-cell lineage choice, Curr. Opin. Immunol., 10, 1998, 181–187.[Medline]

Correa I., Bix M., Liao N.S., Zijlstra M., Jaenisch R. & Raulet D.. Most T cells develop normally in β₂- microglobulin-deficient mice, Proc. Natl. Acad. Sci. USA., 89, 1992, 653–657.[Abstract/Free Full Text]

Schweighoffer E. & Fowlkes B.J.. Positive selection is not required for thymic maturation of transgenic T cells, J. Exp. Med., 183, 1996, 2033–2041.[Abstract/Free Full Text]

Bendelac A., Rivera M.N., Park S.H. & Roark J.H.. Mouse CD1-specific NK1 T cellsdevelopment, specificity, and function, Annu. Rev. Immunol., 15, 1997, 535–562.[Medline]

MacDonald H.R.. NK1.1⁺ T cell receptor-/β⁺ cellsnew clues to their origin, specificity, and function, J. Exp. Med., 182, 1995, 633–638.[Free Full Text]

von Boehmer H., Kirberg J. & Rocha B.. An unusual lineage of β T cells that contains autoreactive cells, J. Exp. Med., 174, 1991, 1001–1008.[Abstract/Free Full Text]

Teh H.S., Kishi H., Scott B., Borgulya P., von Boehmer H. & Kisielow P.. Early deletion and late positive selection of T cells expressing a male-specific receptor in T-cell receptor transgenic mice, Dev. Immunol., 1, 1990, 1–10.[Medline]

Russell J.H., Meleedy-Rey P., McCulley D.E., Sha W.C., Nelson C.A. & Loh D.Y.. Evidence for CD8-independent T cell maturation in transgenic mice, J. Immunol., 144, 1990, 3318–3325.[Abstract]

Rocha B., von Boehmer H. & Guy-Grand D.. Selection of intraepithelial lymphocytes with CD8 / coreceptors by self-antigen in the murine gut, Proc. Natl. Acad. Sci. USA, 89, 1992, 5336–5340.[Abstract/Free Full Text]

Budd R.C. & Mixter P.F.. The origin of CD4^–CD8^–TCRβ⁺ thymocytesa model based on T-cell receptor avidity, Immunol. Today., 16, 1995, 428–431.[Medline]

Teh H.S., Kishi H., Scott B. & von Boehmer H.. Deletion of autospecific T cells in T cell receptor (TCR) transgenic mice spares cells with normal TCR levels and low levels of CD8 molecules, J. Exp. Med., 169, 1989, 795–806.[Abstract/Free Full Text]

Liu C.P., Kappler J.W. & Marrack P.. Thymocytes can become mature T cells without passing through the CD4⁺CD8⁺, double-positive stage, J. Exp. Med., 184, 1996, 1619–1630.[Abstract/Free Full Text]

Bruno L., Fehling H.J. & von Boehmer H.. The β T cell receptor can replace the receptor in the development of lineage cells, Immunity., 5, 1996, 343–352.[Medline]

DiSanto J.P., Guy-Grand D., Fisher A. & Tarakhovsky A.. Critical role for the common cytokine receptor chain in intrathymic and peripheral T cell selection, J. Exp. Med., 183, 1996, 1111–1118.[Abstract/Free Full Text]

Matechak E.O., Killeen N., Hedrick S.M. & Fowlkes B.J.. MHC class II-specific T cells can develop in the CD8 lineage when CD4 is absent, Immunity., 4, 1996, 337–347.[Medline]

Kaye J., Hsu M.L., Sauron M.E., Jameson S.C., Gascoigne N.R. & Hedrick S.M.. Selective development of CD4⁺ T cells in transgenic mice expressing a class II MHC-restricted antigen receptor, Nature, 341, 1989, 746–749.[Medline]

Shinkai Y., Rathbun G., Lam K.P., Oltz E.M., Stewart V., Mendelsohn M., Charron J., Datta M., Young F. & Stall A.M.. RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement, Cell., 68, 1992, 855–867.[Medline]

Grusby M.J., Johnson R.S., Papaioannou V.E. & Glimcher L.H.. Depletion of CD4⁺ T cells in major histocompatibility complex class II-deficient mice, Science., 253, 1991, 1417–1420.[Abstract/Free Full Text]

Killeen N. & Littman D.R.. Helper T-cell development in the absence of CD4-p56^lck association, Nature., 364, 1993, 729–732.[Medline]

Iwabuchi K., Nakayama K., McCoy R.L., Wang F., Nishimura T., Habu S., Murphy K.M. & Loh D.Y.. Cellular and peptide requirements for in vitro clonal deletion of immature thymocytes, Proc. Natl. Acad. Sci. USA., 89, 1992, 9000–9004.[Abstract/Free Full Text]

Kirberg J., Baron A., Jakob S., Rolink A., Karjalainen K. & von Boehmer H.. Thymic selection of CD8⁺ single positive cells with a class II major histocompatibility complex–restricted receptor, J. Exp. Med., 180, 1994, 25–34.[Abstract/Free Full Text]

Kisielow P., Bluthmann H., Staerz U.D., Steinmetz M. & von Boehmer H.. Tolerance in T cell receptor transgenic mice involves deletion of nonmature CD4⁺8⁺ thymocytes, Nature., 333, 1988, 742–746.[Medline]

Seder R.A., Paul W.E., Davis M.M. & de St. Groth B.F.. The presence of interleukin-12 acts directly on CD4⁺ T cells to enhance priming for interferon- production and diminishes interleukin-4 inhibition of such priming, J. Exp. Med., 176, 1992, 1091–1098.[Abstract/Free Full Text]

Pircher H., Burki K., Lang R., Hengartner H. & Zinkernagel R.M.. Tolerance induction in double specific T-cell receptor transgenic mice varies with antigen, Nature., 342, 1989, 559–561.[Medline]

Koller B.H., Marrack P., Kappler J.W. & Smithies O.. Normal development of mice deficient in β2M, MHC class I proteins, and CD8⁺ T cells, Science., 248, 1990, 1227–1230.[Abstract/Free Full Text]

Sim G.K., Olsson C. & Augustin A.. Commitment and maintenance of the β and T cell lineages, J. Immunol., 154, 1995, 5821–5831.[Abstract]

Ramsdell F., Jenkins M., Dinh Q. & Fowlkes B.J.. The majority of CD4⁺8^– thymocytes are functionally immature, J. Immunol., 147, 1991, 1779–1785.[Abstract]

Nixon-Fulton J.L., Bergstresser P.R. & Tigelaar R.E.. Thy-1⁺ epidermal cells proliferate in response to concanavalin A and interleukin 2, J. Immunol., 136, 1986, 2776–2786.[Abstract]

Coligan, J.E., A. Kruisbeek, D.H. Margulies, E.M. Shevach, and W. Strober. 1995. Current Protocols in Immunology. John Wiley and Sons, Inc., New York. 5.0.3–5.4.13

Seder R.A., Gazazinelli R., Sher A. & Paul W.E.. Interleukin-12 acts directly on CD4⁺ T-cells to enhance priming for interferon- production and diminishes interleukin-4 inhibition of such priming, Proc. Natl. Acad. Sci. USA, 90, 1993, 10188–10192.[Abstract/Free Full Text]

Umlauf S.W., Beverly B., Lantz O. & Schwartz R.H.. Regulation of interleukin 2 gene expression by CD28 costimulation in mouse T-cell clonesboth nuclear and cytoplasmic RNAs are regulated with complex kinetics, Mol. Cell. Biol., 15, 1995, 3197–3205.[Abstract]

Korman A.J., Marusic-Galesic S., Spencer D., Kruisbeek A. & Raulet D.H.. Predominant variable region gene usage by T cell receptor–bearing cells in the adult thymus, J. Exp. Med., 168, 1988, 1021–1040.[Abstract/Free Full Text]

von Boehmer H.. Developmental biology of T cells in T cell-receptor transgenic mice, Annu. Rev. Immunol., 8, 1990, 531–556.[Medline]

Fritsch M., Andersson A., Petersson K. & Ivars F.. A TCR chain transgene induces maturation of CD4^–CD8^– β⁺ T cells from T cell precursors, Eur. J. Immunol., 28, 1998, 828–837.[Medline]

Fritsch M. & Ivars F.. T-cell precursor-derived CD4^– CD8^– β T cells retain cell function, Scand. J. Immunol., 48, 1998, 8–14.[Medline]

Matsuzaki G., Yoshikai Y., Kishihara K. & Nomoto K.. Expression of T cell antigen receptor genes in the thymus of irradiated mice after bone marrow transplantation, J. Immunol., 140, 1988, 384–387.[Abstract]

Capone M., Hockett R.D. & Zlotnik A.. Kinetics of T cell receptor β, , and rearrangements during adult thymic developmentT cell receptor rearrangements are present in CD44⁺CD25⁺ Pro-T thymocytes, Proc. Natl. Acad. Sci. USA., 95, 1998, 12522–12527.[Abstract/Free Full Text]

Livak F., Tourigny M., Schatz D.G. & Petrie H.T.. Characterization of TCR gene rearrangements during adult murine T cell development, J. Immunol., 162, 1999, 2575–2580.[Abstract/Free Full Text]

Jenkins M.K., Schwartz R.H. & Pardoll D.M.. Effects of cyclosporine A on T cell development and clonal deletion, Science., 241, 1988, 1655–1658.[Abstract/Free Full Text]

Gao E.K., Lo D., Cheney R., Kanagawa O. & Sprent J.. Abnormal differentiation of thymocytes in mice treated with cyclosporin A, Nature., 336, 1988, 176–179.[Medline]

Takahama Y., Kosugi A. & Singer A.. Phenotype, ontogeny, and repertoire of CD4^–CD8^– T cell receptor β⁺ thymocytes. Variable influence of self-antigens on T cell receptor Vβ usage, J. Immunol., 146, 1991, 1134–1141.[Abstract]

MacDonald H.R., Schreyer M., Howe R.C. & Bron C.. Selective expression of CD8 (Ly-2) subunit on activated thymic cells, Eur. J. Immunol., 20, 1990, 927–930.[Medline]

Robey E. & Fowlkes B.J.. Selective events in T cell development, Annu. Rev. Immunol., 12, 1994, 675–705.[Medline]

Wilson A., Pircher H., Ohashi P. & MacDonald H.R.. Analysis of immature (CD4^–CD8^–) thymic subsets in T-cell receptor β transgenic mice, Dev. Immunol., 2, 1992, 85–94.[Medline]

Sperling A.I., Cron R.Q., Decker D.C., Stern D.A. & Bluestone J.A.. Peripheral T cell receptor variable gene repertoire maps to the T cell receptor loci and is influenced by positive selection, J. Immunol., 149, 1992, 3200–3207.[Abstract]

Brandle D., Muller C., Rulicke T., Hengartner H. & Pircher H.. Engagement of the T-cell receptor during positive selection in the thymus down-regulates RAG-1 expression, Proc. Natl. Acad. Sci. USA, 89, 1992, 9529–9533.[Abstract/Free Full Text]

Dudley E.C., Girardi M., Owen M.J. & Hayday A.C.. β and T cells can share a late common precursor, Curr. Biol., 5, 1995, 659–669.[Medline]

Livak F., Petrie H.T., Crispe I.N. & Schatz D.G.. In-frame TCR gene rearrangements play a critical role in the β/ T cell lineage decision, Immunity., 2, 1995, 617–627.[Medline]

Kang J., Baker J. & Raulet D.H.. Evidence that productive rearrangements of TCR genes influence the fate of progenitor cells to differentiate into β or T cells, Eur. J. Immunol., 9, 1995, 2706–2709.

Fehling H.J., Krotkova A., Saint-Ruf C. & von Boehmer H.. Crucial role of the pre-T-cell receptor gene in development of β but not T cells, Nature., 375, 1995, 795–798.[Medline]

Winoto A. & Baltimore D.. Separate lineages of T cells expressing the β and receptors, Nature, 338, 1989, 430–432.[Medline]

Livak F., Wilson A., MacDonald H.R. & Schatz D.G.. β lineage-committed thymocytes can be rescued by the T cell receptor (TCR) in the absence of TCRβ chain, Eur. J. Immunol., 27, 1997, 2948–2958.[Medline]

Fehling H.J., Iritani B.M., Krotkova A., Forbush K.A., Laplace C., Perlmutter R.M. & von Boehmer H.. Restoration of thymopoiesis in pT^–/– mice by anti-CD3 antibody treatment or with transgenes encoding activated Lck or tailless pT, Immunity., 6, 1997, 703–714.[Medline]

Mertsching E., Wilson A., MacDonald H.R. & Ceredig R.. T cell receptor gene rearrangement and transcription in adult thymic cells, Eur. J. Immunol., 27, 1997, 389–396.[Medline]

Mombaerts P., Clarke A.R., Rudnicki M.A., Iacomini J., Itohara S., Lafaille J.J., Wang L., Ichikawa Y., Jaenisch R., Hooper M.L. & Tonegawa S.. Mutations in T-cell antigen receptor genes and β block thymocyte development at different stages, Nature., 360, 1992, 225–231.[Medline]

Passoni L., Hoffman E.S., Kim S., Crompton T., Pao W., Dong M.Q., Owen M.J. & Hayday A.C.. Intrathymic selection events in cell development, Immunity., 7, 1997, 83–95.[Medline]

Washburn T., Schweighoffer E., Gridley T., Chang D., Fowlkes B.J., Cado D. & Robey E.. Notch activity influences the β versus T cell lineage decision, Cell., 88, 1997, 833–843.[Medline]

Kersh G.J., Hooshmand F.F. & Hedrick S.M.. Efficient maturation of β lineage thymocytes to the CD4⁺CD8⁺ stage in the absence of TCR-β rearrangement, J. Immunol., 154, 1995, 5706–5714.[Abstract]

Kang J., Coles M., Cado D. & Raulet D.H.. The developmental fate of T cells is critically influenced by TCR expression, Immunity., 8, 1998, 427–438.[Medline]

Burtrum D.B., Kim S., Dudley E.C., Hayday A.C. & Petrie H.T.. TCR gene recombination and β- lineage divergenceproductive TCR-β rearrangement is neither exclusive nor preclusive of cell development, J. Immunol., 157, 1996, 4293–4296.[Abstract]

Aifantis L., Azogui O., Feinberg J., Saint-Ruf C., Buer J. & von Boehmer H.. On the role of the pre-T cell receptor in β versus T lineage commitment, Immunity., 9, 1998, 649–655.[Medline]

MacDonald H.R. & Wilson A.. The role of the T-cell receptor (TCR) in β/ lineage commitmentclues from intracellular TCR staining, Immunol. Rev., 165, 1998, 87–94.[Medline]

Kang J.S., Fehling H.J., Laplace C., Malissen M., Cado D. & Raulet D.H.. T cell receptor gene regulatory sequences prevent the function of a novel TCR/pT pre-T cell receptor, Immunity., 8, 1998, 713–721.[Medline]

Bruno L., Rocha B., Rolink A., von Boehmer H. & Rodewald H.R.. Intra- and extra-thymic expression of the pre-T cell receptor gene, Eur. J. Immunol., 25, 1995, 1877–1882.[Medline]

Nikolic-Zugic J. & Moore M.W.. T cell receptor expression on immature thymocytes with in vivo and in vitro precursor potential, Eur. J. Immunol., 19, 1989, 1957–1960.[Medline]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Facebook

Reddit

Technorati

Twitter

This Article Abstract Full Text (PDF, 421K) PPT slides of all figures Alert me when this article is cited Citation Map Services Email this article Similar articles in this journal Similar articles in PubMed Alert me to new content in the JEM Download to citation manager Citing Articles Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Terrence, K. Articles by Fowlkes, B.J. Search for Related Content PubMed PubMed Citation Articles by Terrence, K. Articles by Fowlkes, B.J. Social Bookmarking                            What's this?