|
|
|
|
|
|
|
||
Brief Definitive Report |
Boddu001{at}mc.duke.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Key Words: arachidonic acid • neutrophil influx • knock-out • sex-related • chemotaxis
Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Leukotriene B4 (LTB4) is a potent chemoattractant for neutrophils, eosinophils, and macrophages and also activates the respiratory burst and granule release from neutrophils 1. Leukotriene C4 (LTC4) activates smooth muscles and is a potent bronchoconstrictor 23. G protein–coupled receptors LTB4 receptor (BLTR) and Cys-LTR mediate the activity of LTB4 and LTC4, respectively 45. BLTR is expressed in spleen and on leukocytes, whereas Cys-LTR is expressed mainly in smooth muscle and spleen and on leukocytes and pulmonary macrophages. BLTRs activate the Gi family of G proteins to mediate chemotaxis but use other G proteins as well to mediate cytotoxic activities 46. Leukotrienes play a major role in the pathophysiology of asthma and other pulmonary diseases 78. Several inhibitors of leukotriene biosynthesis and activity have been developed for clinical use 9. Studies on mouse models and antagonists of LTB4 suggested a role for BLTR in rheumatoid arthritis, skin inflammation, and acute septic peritonitis 101112. Mice with targeted disruption of 5-lipoxygenase (5-LO), 5-LO activating protein (FLAP), and, more recently, LTA4 hydrolase allowed the determination of the role of leukotrienes in inflammation and hypersensitivity 13141516. Nonenzymatic formation of LTB4 receptor agonists have been demonstrated 17, and the nuclear receptor peroxisome proliferator-activated receptor 
was shown to mediate several of the effects of LTB4 18. Therefore, to determine the in vivo biological functions of BLTR and the potential consequences of chronic BLTR deficiency, we used gene targeting in embryonic stem (ES) cells to disrupt the mouse BLTR gene. The results demonstrate that BLTR deficiency blocks cellular responses to LTB4 and diminishes acute inflammatory responses. The data also disclosed an unexpected role for BLTR in sex-dependent leukotriene effects in mediating hypersensitivity to platelet-activating factor (PAF).
Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Targeting Construct and Generation of BLTR-deficient Mice.
The mouse BLTR gene was isolated as BAC clones from a genomic library from 129/SvJ strain from Research Genetics using an EST clone for mouse BLTR 1920. The BAC clones were mapped by restriction analysis, and a 10-kb BamHI fragment (see Fig. 1 A) was subcloned as two BamHI–SacII fragments into pBluescript. The knockout construct was made in a vector (pPNT) containing both PGK-neo and PGK-tk cassettes 21. A SpeI linker was added to the SacII end of the 3' BamHI–SacII clone. A 1.5-kb SpeI–KpnI fragment from this clone was subcloned into XbaI–KpnI sites in pPNT vector in between the neo and tk cassettes. The 5' BamHI–XhoI fragment was excised from the pBluescript clone as a NotI–XhoI fragment and cloned into the same sites of the pPNT already containing the 3' SacII (SpeI)–KpnI fragment. The resulting final knockout construct pHB–BLTR was 13 kb in length. A mock construct prepared by inserting the 3' 4.5-kb SacII–BamHI fragment into the same sites of pPNT served as a positive control for PCR screening of the ES cell clones. AK7 (129S4/SvJaeSor) ES cells (107) were electroporated with 25 µg of NotI-linearized pHB–BLTR DNA. The transfected cells were grown in DMEM media with 200 µg/ml G418 and 2 x 10–6 M gancyclovir for 10 d. Surviving clones (95) were tested for recombination using a neomycin-coding sequence primer, tcgcagcgcatcgccttctatcg, and a primer from the 3' end of BLTR gene external to the knockout construct, gctgggagtcatcaacaagcactc. Of the 25 positive clones, 15 were expanded, and the genotypes were confirmed by Southern blot analysis with 10–20 µg of DNA using the 0.9-kb probe (BglII–BamHI fragment) external to the 3' end of the knockout construct (see Fig. 1 A). Six undifferentiated clones were individually microinjected into C57BL/6J blastocysts and transferred into pseudopregnant C57BL/6 mice. Chimeric mice generated from two individual cell clones resulted in immediate germline transmission, and the F1 (C57BL/6 and 129 SvJ) offspring were used to establish the mouse colonies. Genotyping was performed using Southern blot analysis with the same probe indicated above or more routinely using a three-primer PCR reaction with the primers (i) tcacttcgaagactcaggaatgg, (ii) tgcggggcagcgtctgaggctgg, and (iii) ttccatcagaagctgactctac. All mice were housed in a specific pathogen–free barrier facility. Mice were 8–12 wk old at the time of use. All studies and procedures were approved by the Animal Care and Use Committee of Duke University Medical Center.
|
Neutrophil Calcium Mobilization and Chemotaxis.
The 4-h zymosan-elicited peritoneal lavage cells contained >80% neutrophils and were used in functional assays. For calcium mobilization, 3 x 106 cells were washed and loaded with 1.0 µM INDO-1 AM for 30 min at room temperature as previously described 6. Calcium traces were recorded in a Perkin-Elmer fluorescence spectrometer (model 650-19) with an excitation wavelength of 355 nm and an emission wavelength of 405 nm. Chemotaxis of peritoneal exudate cells was measured by a 48-well microchemotaxis chamber technique as described 6.
Arachidonic Acid–induced Ear Inflammation.
Mice were intravenously injected with PBS containing 0.5% Evans blue and indomethacin (Sigma-Aldrich) at final amounts of 10 mg/kg body weight to minimize the contribution from cyclooxygenase products 14. The inside of the right ear of each mouse was painted with 20 µl of arachidonic acid (AA; 100 mg/ml in acetone; Sigma-Aldrich), and the left ear was painted with acetone alone. Ear thickness was measured at 0 and 90 min after AA application using a calibrated thickness gauge (Mitutoyo). Mice were killed by CO2 asphyxiation, a 5-mm-diameter disc of tissue was punched from the center of each ear, and edema was measured by determining the wet weight of the ear punches. The punches were then extracted in 0.5 ml of formamide at 55°C for 48 h. Evans blue extravasation was determined by measuring the absorbance at 610 nm in a spectrophotometer. Histological sections of the ears were stained with hematoxylin and eosin.
PAF-induced Anaphylaxis.
Mice were intravenously injected with PAF-16 (Calbiochem) at a dose of 200 µg/kg body weight in saline containing 0.25% BSA. Animals were observed over a 24-h period. All animals alive after 1 h made a full recovery.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To confirm that the mutation disrupted BLTR expression and not other chemoattractant receptors, zymosan-elicited peritoneal exudate cells (>80% neutrophils) were analyzed for calcium mobilization and chemotaxis. LTB4, C5a, and PAF all induced calcium mobilization in cells from littermate wild-type animals (Fig. 2 A). In contrast, cells from the BLTR–/– animals showed no calcium mobilization in response to LTB4 but showed equivalent responses to C5a and PAF compared with cells from BLTR+/+ mice. In addition, no calcium response was observed even at 1.0 µM LTB4 in cells from BLTR–/– animals (data not shown). Chemotaxis assays also showed no response to LTB4 by BLTR–/– cells, whereas cells from both BLTR–/– and BLTR+/+ animals showed similar levels of migration to C5a (Fig. 2 B). Peritoneal injection of LTB4 led to a rapid neutrophil influx in BLTR+/+ mice that was completely abrogated in BLTR–/– mice (Fig. 2 C; P < 0.05). No statistically significant differences were observed in macrophage numbers at this time point.
|
Peritoneal Inflammation Induced by Zymosan.
To assess the role of BLTR in neutrophil and macrophage recruitment in response to a "nonspecific" inflammatory stimulus, zymosan was injected into the peritoneum of BLTR+/+ and BLTR–/– mice. In uninjected mice, there were no significant differences in the resident peritoneal leukocyte populations in the BLTR+/+ versus BLTR–/– mice (Fig. 3). In contrast, 4 and 18 h after zymosan injection, significantly fewer neutrophils were recovered from BLTR–/– relative to BLTR+/+ mice (Fig. 3 A; P < 0.05). Likewise, significantly lower numbers of macrophages were recovered from BLTR–/– relative to BLTR+/+ mice at 18 h after injection (Fig. 3 B; P < 0.01). However, at 72 h after injection, no differences were seen in the recovery of either cell type from BLTR–/– or BLTR+/+ mice. Levels of LTB4 in peritoneal lavage fluids at 4 h ranged from 1.2 ± 0.3 ng/ml in BLTR+/+ animals to 1.0 ± 0.2 ng/ml in BLTR–/– animals.
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The lack of developmental defects correlates with the observation that mice deficient for 5-LO, FLAP, or LTA4 hydrolase all develop normally, indicating that neither enzymatic production of leukotrienes nor their action on specific receptors is essential for growth or development 13141516. Similarly, no developmental defects have been observed in mice deficient for C5a or N-formylpeptide receptors, indicating the nonessential nature of individual neutrophil chemoattractant receptors 2223. The observation that elicited peritoneal neutrophils did not display any calcium mobilization or chemotaxis to LTB4, and the complete absence of neutrophil accumulation to peritoneal LTB4 challenge in the BLTR–/– mice indicates that BLTR is likely the sole LTB4-responsive G protein–coupled receptor mediating inflammatory responses in mice.
Recent studies demonstrated that transgenic mice overexpressing human BLTR displayed a profound increase in neutrophil recruitment in skin inflammation, peritonitis, and reperfusion-initiated second organ injury 24. These results are in agreement with the current studies that neutrophil influx was reduced at early times (4 and 18 h) in zymosan-induced peritonitis. In addition, a reduction in the 18-h recruitment of macrophages suggests a role for LTB4 in the early times of monocyte/macrophage migration during peritoneal inflammation. Zymosan activates complement to produce C5a, resulting in neutrophil influx 25. The data from the studies in this paper indicate that LTB4 and BLTR also play a role in this process. Indeed, previous studies indicated that LTB4 is the major AA metabolite produced by the entering neutrophils in murine zymosan-induced peritonitis 25. LTB4 likely produced by the resident macrophages and/or early accumulating neutrophils may be involved in an autocrine loop of neutrophil accumulation during inflammation. The early reduction of neutrophil influx in BLTR–/– mice may have resulted in reduced synthesis of other mediators for further monocyte influx. However, the similar macrophage levels at 72 h after zymosan treatment in the BLTR–/– and BLTR+/+ mice indicate the existence of as yet unknown compensatory mechanisms.
Previous studies with mice deficient in leukotriene synthesis showed decreased inflammatory responses to AA 141516. Although the relative contributions of LTB4 and LTC4 were not clear, both protein extravasation and cellular infiltration were affected. Intermediate responses were observed in LTA4 hydrolase–deficient mice relative to 5-LO– and FLAP-deficient mice. However, the LTA4 hydrolase–deficient mice produced larger amounts of LTC4 relative to control mice. Current studies with BLTR–/– mice indicate that both edema and cellular components of inflammation were decreased, suggesting a role for BLTR in both vascular leakage and neutrophil accumulation.
A surprising observation from the current studies in this paper is the relative resistance of female BLTR–/– mice to PAF-induced immediate hypersensitivity. Previous studies with 5-LO– and FLAP-deficient animals showed a strong protection from PAF-induced lethality 131415. However, sex differences in survival, if any, were not reported. These studies show clear differences in the survival of female versus male BLTR–/– mice to challenge with PAF. Several autoimmune diseases such as rheumatoid arthritis and systemic lupus erythematosus (SLE) display sex-dependent predilection, with females being most severely affected 2627. In autoimmune disease–prone MRL-lpr/lpr mice, females are more susceptible to SLE-like pathology, whereas males appear to express increased inflammatory responsiveness to leukotrienes 28. Studies with 5-LO–deficient mice on the MRL-lpr/lpr background showed that males lost their survival advantage and became as susceptible to disease as females, suggesting that leukotrienes protect against SLE-like disease 28. The relevance, if any, of the sex-related difference in PAF anaphylaxis in BLTR–/– mice to autoimmune diseases is unknown at this time. The loss of male advantage against SLE in 5-LO–deficient MRL-lpr/lpr mice needs to be placed in context with our results of gain of a female advantage in BLTR–/– mice. We postulate that a threshold level of leukotriene responsiveness provides protection against autoimmune disease but produces susceptibility to PAF-mediated anaphylaxis. If so, males may have greater leukotriene responsiveness than females. The mice with 5-LO or BLTR deficiency cross these thresholds to result in either male susceptibility to SLE or female protection to PAF anaphylaxis, respectively. Clearly, PAF-induced anaphylaxis is a complex process, as all 5-LO–deficient mice are protected but the male BLTR–/– mice are not. Further studies on hormonal effects will likely delineate the sex-dependent leukotriene effects in these mice.
In summary, this study has shown that deletion of BLTR reduced the vascular and cellular components of acute inflammatory responses in mice. In addition, these data suggest a role for BLTR in mediating systemic anaphylaxis, with female mice being more dependent on this pathway than males. Inhibition of BLTR function may provide a target for therapeutic intervention in certain human inflammatory conditions. Further studies with expression of the BLTR deficiency on different strain backgrounds will allow investigation of the role of BLTR in asthma, rheumatoid arthritis, lupus, and colitis as well as infectious diseases.
|
Acknowledgments |
|---|
This work was supported by National Institutes of Health grants AI-43184, AR-39162, and DE-03738.
Submitted: 29 March 2000
Revised: 1 May 2000
Accepted: 5 May 2000
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Smith M.J., Ford-Hutchinson A.W. & Bray M.A.. Leukotriene Ba potential mediator of inflammation, J. Pharm. Pharmacol., 32, 1980, 517–518.[Medline]
Samuelsson B., Dahlen S.E., Lindgren J.A., Rouzer C.A. & Serhan C.N.. Leukotrienes and lipoxinsstructures, biosynthesis, and biological effects, Science., 237, 1987, 1171–1176.
Dahlen S.E., Hedqvist P., Hammarstrom S. & Samuelsson B.. Leukotrienes are potent constrictors of human bronchi, Nature., 288, 1980, 484–486.[Medline]
Yokomizo T., Izumi T., Chang K., Takuwa Y. & Shimizu T.. A G-protein-coupled receptor for leukotriene B-4 that mediates chemotaxis, Nature., 387, 1997, 620–624.[Medline]
Lynch K.R., O'Neill G.P., Liu Q.Y., Im D.S., Sawyer N., Metters K.M., Coulombe N., Abramovitz M., Figueroa D.J. & Zeng Z.Z.. Characterization of the human cysteinyl leukotriene CysLT(1) receptor, Nature., 399, 1999, 789–793.[Medline]
Haribabu B., Zhelev D.V., Pridgen B.C., Richardson R.M., Ali H. & Snyderman R.. Chemoattractant receptors activate distinct pathways for chemotaxis and secretion-role of G-protein usage, J. Biol. Chem., 274, 1999, 37087–37092.
Henderson W.R. Jr., Lewis D.B., Albert R.K., Zhang Y., Lamm W.J., Chiang G.K., Jones F., Eriksen P., Tien Y.T. & Jonas M.. The importance of leukotrienes in airway inflammation in a mouse model of asthma, J. Exp. Med., 184, 1996, 1483–1494.
Peters-Golden M.. Pulmonary diseases other than asthma as potential targets for antileukotriene therapy, Clin. Rev. Allergy. Immunol., 17, 1999, 247–260.[Medline]
Showell H.J. & Cooper K.. Inhibitors and antagonists of cyclooxygenase, 5-lipoxygenase, and platelet activating factor, Gallin J.I. & Snyderman R., InflammationBasic Principles and Clinical Correlates, 3rd ed, 1999, 1177–1193, Lippincott, Williams & Wilkins, Philadelphia.
Griffiths R.J., Pettipher E.R., Koch K., Farrell C.A., Breslow R., Conklyn M.J., Smith M.A., Hackman B.C., Wimberly D.J. & Milici A.J.. Leukotriene B4 plays a critical role in the progression of collagen-induced arthritis, Proc. Natl. Acad. Sci. USA., 92, 1995, 517–521.
Tsuji F., Miyake Y., Horiuchi M. & Mita S.. Involvement of leukotriene B4 in murine dermatitis models, Biochem. Pharmacol., 55, 1998, 297–304.[Medline]
Matsukawa A., Hogaboam C.M., Lukacs N.W., Lincoln P.M., Strieter R.M. & Kunkel S.L.. Endogenous monocyte chemoattractant protein-1 (MCP-1) protects mice in a model of acute septic peritonitiscross-talk between MCP-1 and leukotriene B-4, J. Immunol., 163, 1999, 6148–6154.
Chen X.S., Sheller J.R., Johnson E.N. & Funk C.D.. Role of leukotrienes revealed by targeted disruption of the 5-lipoxygenase gene, Nature., 372, 1994, 179–182.[Medline]
Goulet J.L., Snouwaert J.N., Latour A.M., Coffman T.M. & Koller B.H.. Altered inflammatory responses in leukotriene-deficient mice, Proc. Natl. Acad. Sci. USA., 91, 1994, 12852–12856.
Byrum R.S., Goulet J.L., Griffiths R.J. & Koller B.H.. Role of the 5-lipoxygenase-activating protein (FLAP) in murine acute inflammatory responses, J. Exp. Med., 185, 1997, 1065–1075.
Byrum R.S., Goulet J.L., Snouwaert J.N., Griffiths R.J. & Koller B.H.. Determination of the contribution of cysteinyl leukotrienes and leukotriene B-4 in acute inflammatory responses using 5-lipoxygenase- and leukotriene A(4) hydrolase-deficient mice, J. Immunol., 163, 1999, 6810–6819.
Harrison K.A. & Murphy R.C.. Isoleukotrienes are biologically active free radical products of lipid peroxidation, J. Biol. Chem., 270, 1995, 17273–17278.
Devchand P.R., Keller H., Peters J.M., Vazquez M., Gonzalez F.J. & Wahli W.. The PPARalpha-leukotriene B4 pathway to inflammation control, Nature., 384, 1996, 39–43.[Medline]
Huang W.W., Garcia-Zepeda E.A., Sauty A., Oettgen H.C., Rothenberg M.E. & Luster A.D.. Molecular and biological characterization of the murine leukotriene B4 receptor expressed on eosinophils, J. Exp. Med., 188, 1998, 1063–1074.
Martin V., Ronde P., Unett D., Wong A., Hoffman T.L., Edinger A.L., Doms R.W. & Funk C.D.. Leukotriene binding, signaling, and analysis of HIV coreceptor function in mouse and human leukotriene B4 receptor-transfected cells, J. Biol. Chem., 274, 1999, 8597–8603.
Tybulewicz V.L., Crawford C.E., Jackson P.K., Bronson R.T. & Mulligan R.C.. Neonatal lethality and lymphopenia in mice with a homozygous disruption of the c-abl proto-oncogene, Cell., 65, 1991, 1153–1163.[Medline]
Hopken U.E., Lu B., Gerard N.P. & Gerard C.. The C5a chemoattractant receptor mediates mucosal defence to infection, Nature., 383, 1996, 86–89.[Medline]
Gao J.L., Lee E.J. & Murphy P.M.. Impaired antibacterial host defense in mice lacking the N-formylpeptide receptor, J. Exp. Med., 189, 1999, 657–662.
Chiang N., Gronert K., Clish C.B., JA O.B., Freeman M.W. & Serhan C.N.. Leukotriene B-4 receptor transgenic mice reveal novel protective roles for lipoxins and aspirin-triggered lipoxins in reperfusion, J. Clin. Invest., 104, 1999, 309–316.[Medline]
Rao T.S., Currie J.L., Shaffer A.F. & Isakson P.C.. In vivo characterization of zymosan-induced mouse peritoneal inflammation, J. Pharmacol. Exp. Ther., 269, 1994, 917–925.
Ansar Ahmed S., Penhale W.J. & Talal N.. Sex hormones, immune responses, and autoimmune diseases. Mechanisms of sex hormone action, Am. J. Pathol., 121, 1985, 531–551.[Abstract]
Pisetsky D.S.. Systemic lupus erythematosus, Curr. Opin. Immunol., 3, 1991, 917–923.[Medline]
Goulet J.L., Griffiths R.C., Ruiz P., Spurney R.F., Pisetsky D.S., Koller B.H. & Coffman T.M.. Deficiency of 5-lipoxygenase abolishes sex-related survival differences in MRL-lpr/lpr mice, J. Immunol., 163, 1999, 359–366.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Facebook 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|
