|
|
|
|
|
|
|
||
Original Article |
aaronn{at}u.washington.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. After BCR ligation, Bam32 is recruited to the plasma membrane through its PH domain. Membrane recruitment requires phosphatidylinositol 3-kinase (PI3K) activity and an intact PI(3,4,5)P3-binding motif, suggesting that membrane association occurs through binding to 3-phosphoinositides. Expression of Bam32 in B cells leads to a dose-dependent inhibition of BCR-induced activation of nuclear factor of activated T cells (NF-AT), which is blocked by deletion of the PH domain or mutation of the PI(3,4,5)P3-binding motif. Thus, Bam32 represents a novel B cell–associated adaptor that regulates BCR signaling downstream of PI3K.
Key Words: immunoglobulin • germinal center • signal transduction • SH2 domain • pleckstrin homology domain
Ligation of the BCR leads to activation of nonreceptor protein tyrosine kinases (PTKs), which regulate several downstream signaling pathways 12. These include phospholipase C (PLC)
During B cell responses to thymus-dependent antigens, key B cell activation and differentiation events occur within germinal centers (GCs) 2122. The GC response is initiated when B cells activated by encounter with antigen and cognate T cell help migrate to the B cell follicles and begin proliferating rapidly in association with the follicular dendritic cell (FDC) network to give rise to a GC. GC B cells begin a complex differentiation program that incorporates somatic hypermutation coupled with selection for high-affinity antigen-specific Ig, Ig class switching, and differentiation into memory B cells or plasma cells. GC B cells represent a distinct differentiation state and display several unique properties such as a predisposition to apoptosis and reexpression of genes expressed during early B cell development 212223. The molecular basis for B cell activation and differentiation processes occurring within GCs is poorly understood. In this study, we have undertaken a screen for GC-associated genes and report the identification and characterization of a novel B cell–restricted signaling molecule that is highly expressed in GC B cells and appears to regulate B cell activation pathways downstream of PI3K.
Fluorescence In Situ Hybridization.
Northern Blot and RT-PCR Expression Analysis.
For analysis of Bam32 expression in primary B cell subsets, tonsillar B cells were prepared as described 26, stained with FITC-labeled anti-IgD (mAb
Expression Constructs and Antibodies.
Transient Transfection of BJAB Cells.
Immunoprecipitation and Blotting.
Confocal Microscopy Analysis of GFP Fusions.
Luciferase Assays.
Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
The population of B lymphocytes present in peripheral lymphoid tissues is dynamically maintained by processes that balance the continuous output from the bone marrow and proliferation in response to antigens with B cell terminal differentiation and death. The choices between the alternative fates of proliferation, differentiation, and death, are largely determined by intracellular signaling cascades triggered by receptor–ligand interactions. The B cell antigen receptor (BCR) is a central regulator of B cell fate 12. BCR signaling is required for survival and recirculation of naive B cells 3 as well as for antigen-specific immune responses. Ligation of the BCR by antigen can have different outcomes depending on the differentiation stage of the B cell, the molecular form of antigen, and the immunological context of the antigen encounter 45. These different outcomes can be due to differences in quality or quantity of signals emanating from the BCR itself 46 and/or differential signaling through other key receptors such as CD19, CD22, CD40, CD72, CD95, CDw150, and FcRII 178. These coreceptors can act by directly modifying receptor-proximal events in BCR signaling or by activating additional signaling pathways which influence the outcome of BCR signaling. , which, upon activation, hydrolyzes phosphatidylinositol 45 bisphosphate (PI(4,5)P2) to produce inositol 1,4,5 trisphosphate (IP3), which triggers the release of calcium from intracellular stores, and diacylglycerol (DAG), which can activate protein kinase C isoforms. Other pathways that are activated downstream of PTKs include the Ras pathway 9 and the phosphatidylinositol 3-kinase (PI3K) pathway 10. Activation of PI3K leads to activation of the serine/threonine kinase Akt 1112 and regulates the membrane association and function of the Tec family PTK, Bruton's tyrosine kinase (Btk) 1314. Adaptor proteins such as B cell linker (BLNK), which contain protein–protein interaction domains but no catalytic activity, play critical roles in linking BCR-induced PTK activation to downstream effectors 1516. The BCR signaling cascade ultimately leads to activation of transcription factors such as nuclear factor of activated T cells (NF-AT) and nuclear factor of 
binding (NF-B) 17181920. In at least one case, alternative outcomes of BCR signaling correlate with differential activation of these transcription factors 6.
Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Isolation of the Bam32 cDNA.
Enriched FDC populations were obtained from human tonsils according to the method of Liu et al. 24. Cells (106) were pooled from three preparations, total RNA was isolated, and double-stranded cDNA was produced using the switching mechanism at RNA termini (SMART) PCR cDNA synthesis method (Clontech). PCR analysis of the resulting cDNA using primers that can distinguish FDC and B cell isoforms of CD21 24 indicated that both isoforms were present in approximately equal proportions (data not shown). A double-stranded driver cDNA was concomitantly produced by the same method using an equal mixture of RNA from the fibroblast cell lines HFF and 122 and the epithelial line HeLa. A suppression subtractive hybridization (SSH) PCR subtraction procedure was carried out according to the manufacturer's protocol (PCR Select; Clontech), using the FDC cDNA as tester and the fibroblast/epithelial cell cDNA as driver. The pool of differentially expressed gene fragments generated was then cloned into the pCRII vector (Invitrogen), and 60 clones were randomly picked and screened for differential expression using tester and driver cDNA probes. Differentially expressed clones were sequenced by dye-terminator sequencing (PE Biosystems). The Bam32 SSH fragment was used as a probe to screen a human lymph node cDNA library, and several positive clones were obtained and sequenced. A fragment of the murine Bam32 cDNA was obtained by low stringency reverse transcription (RT)-PCR, and then the entire cDNA was obtained using rapid amplification of cDNA ends (RACE) with an adaptor-ligated cDNA template derived from Balb/c spleen (Clontech).
Plasmids containing 5' and 3' fragments of the Bam32 cDNA were labeled with biotin-11-dATP by nick translation (GIBCO BRL). Metaphase chromosome preparations from lymphocytes of a human male were obtained using 0.075 M KCl as a hypotonic buffer and methanol/acetic acid (3:1 vol/vol) as a fixative. Hybridization was carried out as described previously 25. The chromosomes were banded using Hoechst 33258–actinomycin D staining and counterstained with propidium iodide. The chromosomes and hybridization signals were visualized by fluorescence microscopy using a dual bandpass filter (Omega).
A 32P-labeled Bam32 cDNA probe was hybridized to human multiple tissue Northern blots (Clontech) and to a Northern blot containing 2 µg of poly A+ RNA from human tonsils, according to the manufacturer's protocol. For RT-PCR analysis, 2 µg of total RNA from the indicated cell lines was reverse transcribed using Superscript II reverse transcriptase (GIBCO BRL). 1/10 of the resulting cDNA was subjected to PCR amplification for 30 cycles using Bam32-specific primers TGTCTCACAGAGCGAGAAGGTGTCAGG and GAACCATCAGAGTGCCTGTCTCGCTTCC or glyceraldehyde-3-phosphate dehydrogenase (G3PDH) control primers TGAAGGTCGGAGTCAACGGATTTGGT and CATGTGGGCCATGAGGTCCACCAC. The resulting PCR products were run on agarose gels, Southern blotted, and hybridized with oligonucleotide probes: CTCTACCTCTGTGAAGGGCGCGAATG (Bam32) and TGGGCGCCTGGTCACCAGGGCTGCTT (G3PDH). 
STA4-1) and PE-labeled anti-CD38 (Immunotech), and sorted into IgD+CD38– (naive), IgD–CD38+ (GC), and IgD–CD38+ (memory) fractions 27 using a FACStarPLUSTM instrument (Becton Dickinson). For in vitro stimulation experiments, naive (high density) B cells were prepared by Percoll fractionation of tonsillar B cells, as described 26. Cells were stimulated with 2 µg/ml anti-CD40 (mAb G28-5) and harvested at the indicated time. The indicated dilution of first-strand cDNA was used for PCR amplification as above.
Eukaryotic expression vectors were generated by inserting the full-length coding sequence or sequence encoding amino acids 1–142 (
PH COOH-terminal truncation mutant) into pcDNA3 (Invitrogen). Myc-tagged Bam32 expression vector was generated by inserting the Bam32 coding sequence into pcDNA3.1 myc/hisA (Invitrogen) in frame with the myc tag. Constructs encoding Bam32–enhanced green fluorescent protein (EGFP) fusion proteins were generated by inserting either sequence encoding the full-length protein (EGFP-Bam32), amino acids 1–142 (EGFP-SH2), or amino acids 133–280 (EGFP-PH) into the pEGFP-C1 vector (Clontech). R61K, R184C, and K197E point mutants were generated with mutant PCR primers using the splicing by overlap extension (SOE) method 28 and inserted into pEGFP-C1 (PH domain only) or pcDNA3 (full-length). The Btk PH domain construct contains amino acids 1–195 inserted into pEGFP-C1. Prokaryotic expression vectors encoding a Bam32 SH2 domain (amino acids 1–142)–glutathione S-transferase (GST) fusion protein or a full-length Bam32-GST fusion protein were generated by inserting the appropriate Bam32 coding sequence into the pGEX 5-x-2 vector (Amersham Pharmacia Biotech). Fusion proteins were purified with glutathione-sepharose beads (Amersham Pharmacia Biotech), according to the manufacturer's protocol. An anti-Bam32 serum (4210K) was generated by immunizing rabbits with a Bam32-GST fusion protein. A Bam32-specific mAb (UW32; IgG1 isotype) was generated by immunizing mice with Bam32-GST fusion protein, followed by fusion with NS-1 cells and ELISA screening of clones for reactivity against Bam32-GST but not GST alone. Other antibodies used were biotinylated phosphotyrosine-specific mAb 4G10 (Upstate Biotechnology), anti-myc mAb 9E10, anti-BLNK mAb 2C9 (Santa Cruz Biotechnology), and affinity-purified rabbit anti-PLC1 and anti-PLC2 sera (Santa Cruz Biotechnology).
For transient transfection experiments, BJAB cells were resuspended in tissue culture medium at 3 x 107/ml and 400 µl of cells was mixed with the indicated amount of plasmid constructs in a 0.4-cm-gap electroporation cuvette (Bio-Rad) and incubated on ice for 10 min. Cells were then electroporated using a Gene Pulser apparatus (Bio-Rad) set at 240 V, 960 µF, incubated on ice for a further 10 min, and then transferred to a tissue culture dish containing 20 ml of complete RPMI medium containing 15% FCS and no antibiotics and incubated overnight in a 37°C, 5% CO2 incubator. Cells were then harvested, counted, and used in the indicated assays.
For stimulation experiments, Ramos cells were resuspended at 2 x 107/ml and stimulated for the indicated periods of time with 10 µg/ml of goat anti–human IgM F(ab')2 fragments (Jackson ImmunoResearch Laboratories) or 2.5 mM of H2O2 plus 250 µM of sodium orthovanadate (referred to as pervanadate), washed with 10 vol of ice-cold PBS containing 0.1% sodium azide, and lysed at 4 x 107 cells/ml in NP-40 lysis buffer (150 mM NaCl, 50 mM Tris, pH 8.0, 5 mM EDTA, 0.5% NP-40, protease inhibitors [2 mM PMSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 1 µg/ml pepstatin], and phosphatase inhibitors [10 mM NaF, 1 mM Na3VO4, and 5 mM Na4P2O7]). Immunoprecipitation, SDS-PAGE, and Western blot analysis were conducted as described 29. Far-Western blotting with the Bam32 SH2 domain–GST fusion protein were performed as described 30.
10 µg of the indicated pEGFP vectors was transfected into BJAB cells by electroporation. After 18–20 h, cells were harvested, washed, and rested overnight in low-serum medium (1.25% FCS). This manipulation reduced the basal membrane association of the PH domain–containing fusion proteins. Cells were then harvested and resuspended at 4–6 x 106/ml in low-serum medium. Cells were incubated for 30 min at 37°C with or without PI3K inhibitors wortmannin (20 ng/ml; Calbiochem) or LY294002 (25 µM; Calbiochem), and then stimulated with 10 µg/ml goat anti–human IgM F(ab')2 fragments for the indicated time. Cells were then washed in 10 vol of ice-cold PBS, fixed in 2% paraformaldehyde/PBS for 30 min at room temperature, washed twice in PBS, and then mounted on slides using an aqueous mounting solution (Aqua Polymount; Polysciences, Inc.). EGFP fluorescence was examined using a scanning laser confocal microscope equipped with LaserSharp software (MRC-1024 system; Bio-Rad). The ratio of membrane to cytoplasmic EGFP fluorescence intensity was determined from digital images using ImageQuant® software (Molecular Dynamics). For each cell, the peak pixel intensity at 4 points on the plasma membrane was averaged and divided by the average pixel intensity within a defined area of cytoplasm (avoiding the nucleus).
BJAB B cells were transfected by electroporation with pcDNA3 expression vectors containing wild-type or mutant Bam32 and an NF-AT-luciferase reporter construct (gift from Dr. Gary Koretzky, University of Iowa, Iowa City, IA). After 18–20 h, cells were harvested and plated in 96-well plates at 2 x 105/well. Triplicate cultures were incubated in media alone, with 5 µg/ml anti-IgM F(ab')2 fragments or 50 nM phorbol-12,13-dibutyrate (PdBu; Calbiochem) and 2.5 µM ionomycin (Calbiochem). After 6 h, the cells were lysed and luciferase activity was measured as described 31.
Results
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Cloning of Bam32, A Novel GC-associated Signaling Adaptor.
To identify genes expressed in GCs, we carried out an SSH experiment using an enriched preparation of human FDCs as a source of tester cDNA (see Materials and Methods). PCR analysis indicated that our tester cDNA included both transcripts derived from FDCs and transcripts derived from adhering B cells (data not shown). One of the differentially expressed clones isolated from this subtraction experiment contained a partial coding sequence for a novel SH2 domain–containing protein. Several cDNA clones containing the entire protein coding sequence for this gene were obtained by screening a human lymph node cDNA library. The cDNA sequence predicts a 32-kD protein containing an NH2-terminal SH2 domain and a COOH-terminal PH domain, but lacking any known catalytic domains (Fig. 1 A). The sequence contains 10 tyrosines, 1 of which matches the consensus motif for a tyrosine-phosphorylation site. Thus, this molecule represents a new member of the adaptor class of signaling molecules. Based on this structure and the restricted expression pattern of this gene (see below), we have designated this molecule Bam32 for B lymphocyte adaptor molecule of 32 kD.
|
Bam32 Is Expressed by B Lymphocytes, but Not T Cells or Nonhematopoietic Cells.
Expression of Bam32 in human tissues was determined by Northern blot analysis (Fig. 2 A). Our Bam32 cDNA probe detects both a predominant 2.9-kb transcript, corresponding in size to our largest cDNA clones, and a much less abundant 4.4-kb transcript. Bam32 transcripts are detected in all hematopoietic tissues tested (bone marrow, spleen, lymph node, and peripheral blood leukocytes) with the exception of the thymus, which shows little or no expression. Bam32 expression was also observed in trachea and placenta, but not in 14 other nonlymphoid tissues including brain, heart, kidney, liver and skeletal muscle, indicating that expression is largely confined to cells of the immune system. Consistent with the restricted tissue distribution pattern, RT-PCR analyses indicated that Bam32 is expressed in all B cell lines examined, but not in T cell, epithelial cell, fibroblast, or myelocytic leukemia lines (Fig. 2 B). As expected, Bam32 transcripts were detected in the sort-enriched tonsillar FDC tester RNA, but not in the fibroblast pool driver RNA.
|
|
2 after BCR Ligation or Pervanadate Stimulation.
140 and 35/36 kD were detected in Bam32 immunoprecipitates from BCR- or pervanadate-stimulated Ramos cells. As expected, neither of these bands was observed in immunoprecipitates from pervanadate-stimulated Jurkat cells, which do not express Bam32. We found no evidence for a phosphoprotein running at 32 kD; however, when Bam32 immunoprecipitates were blotted with polyclonal Bam32 antibodies, an additional band of 35/36 kD was detectable after BCR or pervanadate activation (Fig. 4 A, bottom). This band was not present in unstimulated cells and comigrated with the 35/36 kD band detected by antiphosphotyrosine blotting, indicating that it represents tyrosine-phosphorylated Bam32. Consistent with this conclusion, myc epitope–tagged Bam32 also underwent a bandshift and was tyrosine-phosphorylated after pervanadate stimulation (Fig. 4 B).
|
2, whereas neither PLC1 nor BLNK could be detected in Bam32 immunoprecipitates (Fig. 5 A). Although we can detect some constitutive association of Bam32 with PLC2, association is substantially increased after activation (Fig. 5 B). A Bam32 SH2 domain fusion protein bound in vitro to tyrosine-phosphorylated PLC2 immobilized on a nitrocellulose membrane, but not to CD22 (Fig. 5 C), syk, or SH2 domain–containing inositol 5-phosphatase (SHIP) (data not shown), suggesting that the Bam32–PLC2 interaction is direct and mediated by the SH2 domain. Weak binding of the Bam32 SH2 fusion protein to PLC1 was also detected under these conditions (Fig. 5 C, and data not shown). These results indicate that Bam32 can interact with tyrosine-phosphorylated signaling molecules after B cell activation through its SH2 domain and may function in part by regulating the activity and/or location of PLC2.
|
|
5 min, and then slowly declines back to basal levels. The Btk PH domain was recruited with similar kinetics; however, a significantly lower proportion of the fusion protein is present at the plasma membrane (relative to the cytoplasm) at each time point, and membrane association was not observed in unstimulated cells (Fig. 6 B). Unlike Bam32, a significant proportion of the Btk PH domain fusion protein localized to the nucleus as observed previously 14. These results suggest that the Bam32 PH domain is rapidly and quantitatively recruited to the plasma membrane after BCR ligation, and may have a higher selectively for binding to the activated plasma membrane than the Btk PH domain.
Recruitment of the Bam32 PH Domain to the Plasma Membrane Is Dependent on PI3K Activity and an Intact PI(3,4,5)P3-binding Motif.
We examined whether membrane association of the Bam32 PH domain was dependent on PI3K activity by preincubating cells expressing EGFP-Bam32 or EGFP-Bam32 PH domain fusion proteins with two structurally unrelated PI3K inhibitors, wortmannin or LY294002, before BCR ligation (Fig. 7 A). These inhibitors blocked membrane association of both fusion proteins, demonstrating that membrane association of both the PH domain and Bam32 as a whole is dependent on PI3K activity. Alignment of the Bam32 PH domain with other PH domains reveals that Bam32 contains a series of amino acids in the β2 and β3 strands that are conserved among PI(3,4,5)P3-binding PH domains 32, including the arginine corresponding to R28 in Btk, which is mutated in human X-linked agammaglobulinemia patients 34 and Xid mice 35, and which forms part of the PI(3,4,5)P3-binding pocket 3637. To test whether membrane association of the Bam32 PH domain requires the conserved arginine in this putative PI(3,4,5)3-binding pocket, we generated a construct encoding EGFP fused to the Bam32 PH domain bearing an R184C mutation. The R184C mutation completely abrogated membrane association (Fig. 7 B), providing support for the hypothesis that the PI3K-dependent association of the Bam32 PH domain occurs through direct binding to PI(3,4,5)3. Interestingly, when aligned with the Btk PH domain, the Bam32 PH domain also contains an amino acid substitution in the β3 strand found in a gain-of-function Btk mutant that shows constitutive membrane association (E41K; references 14, 38). To examine the role of this residue in Bam32 membrane association, we generated a K197E mutant PH domain and examined membrane association (Fig. 7 B). Surprisingly, the K197E mutation also completely disrupted membrane association, suggesting that this residue, which is not conserved among phosphoinositide-binding PH domains, has a critical role in phosphoinositide binding of the Bam32 PH domain. We have confirmed the effect of the R28C and K41E mutations on membrane association by immunofluorescence staining of full-length Bam32 proteins expressed in BJAB cells (data not shown). Together, the results in Fig. 6 and Fig. 7 suggest that, after BCR ligation, Bam32 is recruited to the plasma membrane at sites of PI3K activation through binding to PI(3,4,5)P3 in a manner analogous to Btk.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Expression and Chromosomal Location of Bam32.
Bam32 is clearly expressed in B, but not T lymphocytes; however, the present data do not rule out expression in myeloid or other hematopoietic lineages. Indeed, Bam32 is expressed at high levels in the trachea, which contains few lymphocytes but significant numbers of dendritic cells 48. Our preliminary results suggest that Bam32 is expressed in monocyte-derived dendritic cells (Marshall, A.J., D. Magaletti, and E.A. Clark, unpublished data), which could potentially account for Bam32 expression in the trachea. In the B lineage, Bam32 is expressed as early as the pre-B cell stage (Marshall, A.J., and E.A. Clark, unpublished data). Expression in mature B cells is modulated during activation and subsequent differentiation, with a marked increase in expression during the naive to GC B cell transition, and a dramatic decrease in memory B cells (Fig. 3). Among human B cell lines, we observe the highest levels of Bam32 protein in the typical Burkitt's lymphoma lines Ramos and Daudi (data not shown), which share many features with GC B cells 49. Finally, we find that cross-linking CD40 on naive B cells, which can turn on some phenotypic characteristics of GC B cells 50, leads to a rapid increase in Bam32 expression (Fig. 3 B). Interestingly, BCR ligation alone does not significantly affect Bam32 expression, and does not affect upregulation when used in combination with CD40 ligation, suggesting that transcription of Bam32 is specifically CD40 responsive. Together, these data strongly suggest that Bam32 expression is increased during T cell–dependent B cell activation and the subsequent GC response. It is tempting to speculate that Bam32 upregulation may be an important factor in the cross-talk between CD40 and BCR signaling pathways and/or in tuning B cell responses to antigen during affinity maturation in GCs.
The human Bam32 gene is located on chromosome 4 q25–q27, an interval containing several other immunologically relevant genes such as IL-2, epidermal growth factor, fibroblast growth factor 2, caspase 6, I factor (complement), and lymphoid enhancer-binding factor 1. Consistent with the chromosomal assignment, the Bam32 cDNA sequence matches a sequence-tagged site (STS) on chromosome 4 (data not shown). Interestingly, loss of this region of chromosome 4 is observed in many Hodgkin's lymphomas 51, which are thought to originate from GC B cells 52. Given that Bam32 may negatively regulate NF-AT activation in B cells, it will be important to determine whether defects in Bam32 expression could contribute to increased B cell proliferation and potentially malignant transformation in Hodgkin's lymphoma.
Tyrosine Phosphorylation of Bam32.
Bam32 is tyrosine phosphorylated after BCR ligation, indicating that it is a target of a kinase activated downstream of the BCR. While Bam32 contains 10 tyrosine residues, only 1 (Y139) matches the general consensus motif for a tyrosine phosphorylation site in which a basic followed by an acidic amino acid are present 4–6 residues NH2-terminal to the tyrosine. This tyrosine lies in an SIYESV motif, which fits the preferred target sequence for src family kinases (I/L-Y-D/E), but not for syk kinase (D-Y-E) 53. When phosphorylated, this site could form a target for binding of some SH2 domain–containing proteins 54. The phosphorylation of Bam32 correlates with a bandshift of 2–3 kD on our SDS-PAGE gels, suggesting that either (a) phosphorylation at tyrosine 139 leads a stable conformational change that retards the migration of Bam32, (b) phosphorylation at tyrosine 139 is upstream of multiple phosphorylations by serine/threonine kinases, or (c) Bam32 is phosphorylated on multiple tyrosines not conforming to the consensus tyrosine-phosphorylation site. We have found that phosphorylated Bam32 is poorly recognized by our mAb, consistent with a stable conformational change. Interestingly, preliminary evidence indicates that Bam32 phosphorylation is inhibited by wortmannin pretreatment (Niiro, H., A.J. Marshall, and E.A. Clark, unpublished), suggesting that membrane recruitment of Bam32 is required for its phosphorylation and/or that activation of the kinase responsible is dependent on PI3K activity.
Structure and Function of the Bam32 SH2 Domain.
BLAST sequence similarity searching (available at http://www.ncbi.nlm.nih.gov/BLAST) indicated that the Bam32 SH2 domain is most highly related (30–37% identity) to those of the adaptor protein Nck, PLC1, PI3K p85 subunit, and the protein tyrosine phosphatases SHP-1 and SHP-2. The Bam32 SH2 domain shows the greatest overall similarity with the Nck SH2 domain (37% identity, 62% similarity), including identical residues at the βD3 and βD5 positions, which are thought to be critical in determining specificity of binding to phosphotyrosine motifs 55. Despite the similarity with the Nck SH2 domain, we have been unable to detect association of Bam32 with proteins known to associate with Nck in activated lymphocytes such as BLNK, p62 DOK, and p120 Ras-GAP (Niiro, H., A.J. Marshall, and E.A. Clark, unpublished data). However, we can clearly detect association of Bam32 with PLC2 in vivo. Our results indicate that the Bam32 SH2 domain can directly bind phosphorylated PLC2 in vitro; however, we cannot exclude the possibility that the in vivo interaction is mediated by another protein. The finding that PLC2 but not PLC1 can be detected in Bam32 immunoprecipitates is intriguing, and could be due to differences in the tyrosine-phosphorylation motifs present in these two isoforms 56. However, we did detect some binding of the Bam32 SH2 domain to tyrosine-phosphorylated PLC1 in vitro, so we cannot completely exclude the possibility of a low stoichiometry association between Bam32 and PLC1 in vivo.
Structure and Function of the Bam32 PH Domain.
The PH domain of Bam32 appears to be both necessary and sufficient for membrane association of Bam32 (Fig. 6 A). We have observed no significant differences in the behavior of the full-length Bam32 fusion protein and the PH domain fusion protein in terms of the level of basal or induced membrane association or the sensitivity of membrane association to PI3K inhibitors; however, the present experiments do not rule out a contribution of the SH2 domain in regulating Bam32 localization. The PH domain of Bam32 is related (39% identity) to those of Grp1, cytohesin-1, and ADP ribosylation factor nucleotide binding site opener (ARNO), which bind to 3-phosphoinositides generated by PI3K 57585960. Bam32, like Grp1, Akt, and Btk also contains a series of conserved residues in the β1 and β2 strands of the PH domain that correlate with the ability to bind 3-phosphoinositides 32. Thus, the structure of the Bam32 PH domain is consistent with the hypothesis that it functions as a mediator of PI3K-dependent membrane association through binding of 3-phosphoinositides. Indeed, we find that association of Bam32 with the plasma membrane is strictly dependent on PI3K activity and an intact PI(3,4,5)P3-binding motif in the PH domain. During preparation of this manuscript, a molecule identical to Bam32 was described under the name DAPP1, for dual adaptor for phosphotyrosine and 3-phosphoinositides 61. In that report, the PH domain of DAPP1 was found to bind in vitro to the PI3K products PI(3,4,5)P3 and PI(3,4)P2, consistent with our in vivo findings of PI3K-dependent membrane recruitment.
Btk is another example of a B cell–specific protein that is recruited to the plasma membrane through its PH domain in a PI3K-dependent manner, through direct binding to PI(3,4,5)P3 143362. PH domain–dependent membrane recruitment of Btk is functionally relevant because point mutations that prevent membrane recruitment block Btk activation, leading to defective B cell development in X-linked agammaglobulinemia 1434, and point mutations that cause constitutive membrane association lead to constitutively active Btk 1438. Interestingly, direct comparison of the membrane recruitment of the Bam32 versus Btk PH domains indicated that the Bam32 PH domain associates with the plasma membrane of activated B cells with higher stoichiometry than the Btk PH domain (Fig. 6 B). Since our analysis considers the ratio of localization to the membrane versus the cytoplasm, this difference could be accounted for by a difference in their relative affinity for phosphoinositide ligands in the membrane or differences in affinity for potential protein ligands in the membrane or cytoplasm. The Bam32/DAPP1 PH domain was estimated to bind PI(3,4,5)P3 with an affinity of 3 nM, compared with 60 nM for 3-phosphoinositide–dependent kinase 1 (PDK1), which was used as an internal control in that study 61. In contrast, the Btk PH domain was estimated to bind PI(3,4,5)P3 with an affinity of 800 nM 62. Thus, the Bam32 PH domain appears to bind PI(3,4,5)P3 with an unusually high affinity.
Role of Bam32 in B Cell Activation.
The restricted expression pattern of Bam32, together with its upregulation during B cell activation, strongly suggests that Bam32 functions as a specific regulator of B cell signaling pathways. Regulation of Bam32 levels during B cell differentiation (Fig. 3) could potentially modulate the stoichiometry and/or kinetics of membrane-associated signaling complexes formed downstream of PI3K activation, thus altering the downstream consequences of activation signals. Given the apparent hierarchy of affinities present in PI(3,4,5)P3-binding proteins (Bam32
PDK1Btk/Akt), it seems likely that Bam32 is one of the first proteins recruited during activation of PI3K and/or that Bam32 can be recruited by lower levels of PI3K activation than these other proteins. Consistent with this idea, our data indicate that basal levels of PI(3,4,5)P3 may be sufficient for some Bam32 to associate with the plasma membrane so that Bam32 is at the membrane before BCR activation. Our present hypothesis, which we are currently testing, is that Bam32 regulates the activity of protein kinases that are recruited later in the PI3K-dependent cascade, such as Btk or Akt.
Our results indicate that one downstream effect of increasing Bam32 levels is an inhibition of BCR-induced activation of NF-AT. Although it is difficult to conclude simply from overexpression studies what precise role Bam32 plays in BCR signaling, it is clear that Bam32 can regulate the BCR signal transduction upstream of NF-AT. Activation of NF-AT transcriptional activity in B cells, as in T cells, requires both Ca2+ mobilization and PKC activation 1718. We find that treatment of BJAB B cells with PI3K inhibitors leads to inhibition of BCR-induced NF-AT activation (Fig. 8 D), indicating that the PI3K pathway recruits essential effectors upstream of NF-AT activation in B cells. The requirement for PI3K in NF-AT activation may reflect, at least in part, the role of PI3K in activation of PLC and subsequently Ca2+ mobilization 63. Recent work has implicated Btk as a PI3K-dependent effector which is required for full activation of PLC leading to influx of Ca2+ across the plasma membrane 64. Since Bam32 binds the same phospholipid as Btk and associates with PLC2, it is tempting to speculate that Bam32 could regulate the activation of PLC2 by Btk. Overexpression of Bam32 in BJAB cells to levels that inhibit NF-AT activation by >50% does not lead to detectable changes in BCR-induced Ca2+ flux (data not shown); however, it remains possible that Bam32 regulates the sustained phase of the Ca2+ response, which is Btk dependent 6364 and critical for full activation of NF-AT–dependent transcription 6566. Another possibility is that Bam32 could modulate NF-AT activation by regulating Ca2+-independent signaling events downstream of PI3K, such as Akt activation 11. Akt could regulate NF-AT activation through phosphorylation and inhibition of glycogen synthase kinase 3 67, whose activity opposes calcineurin-dependent translocation of NF-AT to the nucleus 68. Expression of constitutively active Akt enhances TCR-induced NF-AT activation 43, consistent with a role for Akt in NF-AT activation.
The PI3K pathway has been shown to be essential for B cell activation and differentiation in studies examining the effect of PI3K inhibitors on B cell responses in vitro 697071 and the effect of PI3K p85
deficiency in mice 7273. Furthermore, the PI3K pathway is subject to opposing regulation by the CD19 coreceptor, which recruits PI3K to the antigen receptor complex 74, and the inhibitory Fc receptor FcRII, which specifically antagonizes the PI3K pathway by recruiting the inositol phosphatase SHIP 13. Bam32 is clearly a novel component of this critical PI3K activation pathway in B lymphocytes, and our results suggest that it may specifically regulate PI3K-dependent effectors involved in activation of NF-AT. Modulation of BCR-induced NF-AT activation by Bam32 could have important functional consequences for B cells, since B cells from NF-ATc–deficient mice have diminished proliferative responses to a variety of stimuli, including BCR or CD40 ligation 3940. In contrast, B cells from NF-ATp–deficient mice are hyperproliferative 42 and B cells from NF-AT4–deficient mice show an activated phenotype in vivo 41. We speculate that upregulation of Bam32 during the GC response may lead to qualitative changes in BCR signaling to the nucleus necessary for the exquisitely sensitive process of selection based on affinity for antigen.
|
Acknowledgments |
|---|
This work was supported by National Institutes of Health grants AI44257, GM37905, DE08229, and AI45088 (to E.A. Clark). A.J. Marshall is supported by a Medical Research Council of Canada postdoctoral fellowship. H. Niiro is supported by grants from the Yoshitomi Medical Research Foundation and the Clinical Research Foundation of Japan.
Submitted: 29 November 1999
Revised: 15 February 2000
Accepted: 23 February 2000
B, nuclear factor of binding; PdBu, phorbol-12,13-dibutyrate; PH, pleckstrin homology; PI, phosphatidylinositol; PI3K, phosphatidylinositol 3-kinase; PLC, phospholipase C; PTK, protein tyrosine kinase; RACE, rapid amplification of cDNA ends; RT, reverse transcription; SH2, src homology 2; SSH, suppression subtractive hybridization.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Craxton A., Otipoby K.L., Jiang A. & Clark E.A.. Signal transduction pathways which regulate the fate of B lymphocytes, Adv. Immunol., 73, 1999, 79–152.[Medline]
Kurosaki T.. Genetic analysis of B cell antigen receptor signaling, Annu. Rev. Immunol., 17, 1999, 555–592.[Medline]
Lam K.-P., Kuhn R. & Rajewsky K.. In vivo ablation of surface immunoglobulin on mature B cells by inducible gene targeting results in rapid cell death, Cell., 90, 1997, 1073–1083.[Medline]
Healy J.I. & Goodnow C.C.. Positive versus negative signaling by lymphocyte antigen receptors, Annu. Rev. Immunol., 16, 1998, 645–670.[Medline]
Nossal G.J.. Cellular mechanisms of immunological tolerance, Annu. Rev. Immunol., 1, 1983, 33–62.[Medline]
Healy J.I., Dolmetsch R.E., Timmerman L.A., Cyster J.G., Thomas M.L., Crabtree G.R., Lewis R.S. & Goodnow C.C.. Different nuclear signals are activated by the B cell receptor during positive versus negative signaling, Immunity., 6, 1997, 419–428.[Medline]
Coggeshall K.M.. Inhibitory signaling by B cell Fc gamma RIIb, Curr. Opin. Immunol., 10, 1998, 306–312.[Medline]
Fujimoto M., Poe J.C., Inaoki M. & Tedder T.F.. CD19 regulates B lymphocyte responses to transmembrane signals, Semin. Immunol., 10, 1998, 267–277.[Medline]
Harwood A.E. & Cambier J.C.. B cell antigen receptor cross-linking triggers rapid protein kinase C independent activation of p21ras1, J. Immunol., 151, 1993, 4513–4522.[Abstract]
Gold M., Chan V., CW T. & DeFranco A.. Membrane Ig cross-linking regulates phosphatidylinositol 3-kinase in B lymphocytes, J. Immunol., 148, 1992, 2012–2022.[Abstract]
Craxton A., Jiang A., Kurosaki T. & Clark E.A.. Syk and Bruton's tyrosine kinase are required for B cell antigen receptor-mediated activation of the kinase Akt, J. Biol. Chem., 274, 1999, 30644–30650.
Aman M.J., Lamkin T.D., Okada H., Kurosaki T. & Ravichandran K.S.. The inositol phosphatase SHIP inhibits Akt/PKB activation in B cells, J. Biol. Chem., 273, 1998, 33922–33928.
Bolland S., Pearse R.N., Kurosaki T. & Ravetch J.V.. SHIP modulates immune receptor responses by regulating membrane association of Btk, Immunity., 8, 1998, 509–516.[Medline]
Varnai P., Rother K.L. & Balla T.. Phosphatidylinositol 3-kinase-dependent membrane association of the Bruton's tyrosine kinase pleckstrin homology domain visualized in single living cells, J. Biol. Chem., 274, 1999, 10983–10989.
Fu C., Turck C.W., Kurosaki T. & Chan A.. BLNKa central linker protein in B cell activation, Immunity., 9, 1998, 93–103.[Medline]
Ishiai M., Kurosaki M., Pappu R., Okawa K., Ronko I., Fu C., Shibata M., Iwamatsu A., Chan A.C. & Kurosaki T.. BLNK required for coupling Syk to PLC gamma 2 and Rac1-JNK in B cells, Immunity., 10, 1999, 117–125.[Medline]
Choi M.S.K., Brines R.D., Holman M.J. & Klaus G.G.B.. Induction of NF-AT in normal B lymphocytes by anti-immunoglobulin or CD40 ligand in conjunction with IL-4, Immunity., 1, 1994, 179–187.[Medline]
Venkataraman L., Francis D.A., Wang Z., Liu J., Rothstein T.L. & Sen R.. Cyclosporin-A sensitive induction of NF-AT in murine B cells, Immunity., 1, 1994, 189–196.[Medline]
Clipstone N.A. & Crabtree G.R.. Signal transduction between the plasma membrane and the nucleus of T lymphocytes, Annu. Rev. Biochem., 63, 1994, 1045–1083.[Medline]
Baeuerle P.A. & Henkel T.. Function and activation of NF-B in the immune system, Annu. Rev. Immunol., 12, 1994, 141–179.[Medline]
Liu Y.J. & Arpin C.. Germinal center development, Immunol. Rev., 156, 1997, 111–126.[Medline]
MacLennan I.C.M.. Germinal centers, Annu. Rev. Immunol., 12, 1994, 117–139.[Medline]
Han S., Zheng B., Takahashi Y. & Kelsoe G.. Distinctive characteristics of germinal center B cells, Semin. Immunol., 9, 1997, 255–260.[Medline]
Liu Y.J., Xu J., de Bouteiller O., Parham C., Grouard G., Djossou O., de Saint-Vis B., Lebecque S., Banchereau J. & Moore K.. Follicular dendritic cells specifically express the long CR2/CD21 isoform, J. Exp. Med., 185, 1997, 165–170.
Edelhoff S.E., Ayer D.E., Zervos A.S., Steingrimsson E., Jenkins N.A., Copeland N.G., Eisenman R.N., Brent R. & Disteche C.M.. Mapping of two genes encoding members of a distinct subfamily of MAX interacting proteinsMAD to human chromosome 2 and mouse chromosome 6, and MXII to human chromosome 10 and mouse chromosome 19, Oncogene., 9, 1994, 665–668.[Medline]
Barrett T.B., Shu G.L., Draves K.E., Pezzutto A. & Clark E.A.. Signaling through CD19, Fc receptors or transforming growth factor-betaeach inhibits the activation of resting human B cells differently, Eur. J. Immunol., 20, 1990, 1053–1059.[Medline]
Liu Y.J., Barthelemy C., de Bouteiller O., Arpin C., Durand I. & Banchereau J.. Memory B cells from human tonsils colonize mucosal epithelium and directly present antigen to T cells by rapid up-regulation of B7-1 and B7-2, Immunity., 2, 1995, 239–248.[Medline]
Ho S.N., Hunt H.D., Horton R.M., Pullen J.K. & Pease L.R.. Site-directed mutagenesis by overlap extension using the polymerase chain reaction, Gene., 77, 1989, 51–59.[Medline]
Leprince C., Draves K.E., Ledbetter J.A., Torres R.M. & Clark E.A.. Characterization of molecular components associated with surface immunoglobulin M in human B lymphocytespresence of tyrosine and serine/threonine protein kinases, Eur. J. Immunol., 22, 1992, 2093–2099.[Medline]
Law C.L., Chandran K.A., Sidorenko S.P. & Clark E.A.. Phospholipase c-1 interacts with conserved phosphotyrosyl residues in the linker region of Syk and is a substrate for Syk, Mol. Cell. Biol., 16, 1996, 1305–1315.[Abstract]
Law C.L., Ewings M.K., Chaudhary P.M., Solow S.A., Yun T.J., Marshall A.J., Hood L. & Clark E.A.. GrpL, a Grb2-related adaptor protein, interacts with SLP-76 to regulate nuclear factor of activated T cell activation, J. Exp. Med., 189, 1999, 1243–1253.
Isakoff S.J., Cardozo T., Anreev J., Li Z., Ferguson K.M., Abagyan R., Lemmon M.A., Aronheim A. & Skolnik E.Y.. Identification and analysis of PH domain-containing targets of phosphatidylinositol 3-kinase using a novel in vivo assay in yeast, EMBO (Eur. Mol. Biol. Organ.) J., 17, 1998, 5374–5387.[Medline]
Salim K., Bottomley M.J., Querfurth E., Zvelebil M.J., Gout I., Scaif R., Margolis R.L., Gigg R., Smith C.I.E. & Driscoll P.C.. Distinct specificity in the recognition of phosphoinositides by the pleckstrin homology domains of dynamin and the Bruton's tyrosine kinase, EMBO (Eur. Mol. Biol. Organ.) J., 15, 1996, 6241–6250.[Medline]
Conley M.E. & Cooper M.D.. Genetic basis of abnormal B cell development, J. Exp. Med., 10, 1998, 399–406.
Rawlings D., Saffran D., Tsukada S., Largaespada D., Grimaldi J.C., Cohen L., Mohr R., Bazan J.F., Howard M. & Copeland N.. Mutation of unique region of Bruton's tyrosine kinase in immunodeficient XID mice, Science., 261, 1993, 358–361.
Baraldi E., Carugo K.D., Hyvonen M., Surdo P.L., Riley A.M., Potter B.V., O'Brien R., Ladbury J.E. & Saraste M.. Structure of the PH domain from Bruton's tyrosine kinase in complex with inositol 1,3,4,5-tetrakisphosphate, Structure., 7, 1999, 449–460.[Medline]
Hyvonen M. & Saraste M.. Structure of the PH domain and Btk motif from Bruton's tyrosine kinasemolecular explanations for X-linked agammaglobulinaemia, EMBO (Eur. Mol. Biol. Organ.) J., 16, 1997, 3396–3404.[Medline]
Li T., Tsukuda S., Satterthwiate A., Havlik M.H., Park H., Takatsu K. & Witte O.N.. Activation of Bruton's tyrosine kinase (BTK) by a point mutation in its pleckstrin homology (PH) domain, Immunity., 2, 1995, 451–460.[Medline]
Yoshida H., Nishina H., Takimoto H., Marengere L.E., Wakeham A.C., Bouchard D., Kong Y.Y., Ohteki T., Shahinian A. & Bachmann M.. The transcription factor NF-ATc1 regulates lymphocyte proliferation and Th2 cytokine production, Immunity., 8, 1998, 115–124.[Medline]
Ranger A.M., Hodge M.R., Gravallese E.M., Oukka M., Davidson L., Alt F.W., de la Brousse F.C., Hoey T., Grusby M. & Glimcher L.H.. Delayed lymphoid repopulation with defects in IL-4-driven responses produced by inactivation of NF-ATc, Immunity, 8, 1998, 125–134.[Medline]
Oukka M., Ho I.C., Charles de la Brousse F., Hoey T., Grusby M.J. & Glimcher L.H.. The transcription factor NF-AT4 is involved in the generation and survival of T cells, Immunity., 9, 1998, 295–304.[Medline]
Hodge M.R., Ranger A.M., de la Brousse F.C., Hoey T., Grusby M.J. & Glimcher L.H.. Hyperproliferation and dysregulation of IL-4 expression in NF-ATp-deficient mice, Immunity., 4, 1996, 397–405.[Medline]
Eder A.M., Dominguez L., Frannke T.F. & Ashwell J.D.. Phosphoinositide 3-kinase regulation of T cell receptor-mediated interleukin-2 gene expression in normal T cells, J. Biol. Chem., 273, 1998, 28025–28031.
Clements J.L., Yang B., Ross-Barta S.E., Eliason S.L., Hrstka R.F., Williamson R.A. & Koretzky G.A.. Requirement for the leukocyte-specific adaptor protein SLP-76 for normal T cell development, Science., 281, 1998, 416–419.
Sayos J., Wu C., Morra M., Wang N., Zhang X., Allen D., van Schaik S., Notarangelo L., Geha R. & Roncarolo M.G.. The X-linked lymphoproliferative-disease gene product SAP regulates signals induced through the co-receptor SLAM, Nature., 395, 1998, 462–469.[Medline]
Clements J.L., Boerth N.J., Lee J.R. & Koretzky G.A.. Integration of T cell receptor-dependent signaling pathways by adaptor proteins, Annu. Rev. Immunol., 17, 1999, 89–108.[Medline]
Rudd C.E.. Adaptors and molecular scaffolds in immune cell signaling, Cell., 96, 1999, 5–8.[Medline]
McWilliam A.S., Nelson D.J. & Holt P.G.. The biology of airway dendritic cells, Immunol. Cell Biol., 73, 1995, 405–413.[Medline]
Ling N.R., Hardie D., Lowe J., Johnson G.D., Khan M. & MacLennan I.C.. A phenotypic study of cells from Burkitt lymphoma and EBV-B-lymphoblastoid lines and their relationship to cells in normal lymphoid tissues, Int. J. Cancer., 15, 1989, 112–118.
Galibert L., Burdin N., de Saint-Vis B., Garrone P., Van Kooten C., Banchereau J. & Rousset F.. CD40 and B cell antigen receptor dual triggering of resting B lymphocytes turns on a partial germinal center phenotype, J. Exp. Med., 183, 1996, 77–85.
Atkin N.B.. Cytogenetics of Hodgkin's disease, Cytogenet. Cell. Genet., 80, 1998, 23–27.[Medline]
Kuppers R. & Rajewsky K.. The origin of Hodgkin and Reed/Sternberg cells in Hodgkin's disease, Annu. Rev. Immunol., 16, 1998, 471–493.[Medline]
Schmitz R., Baumann G. & Gram H.. Catalytic specificity of phosphotyrosine kinases Blk, Lyn, c-Src and Syk as assessed by phage display, J. Mol. Biol., 260, 1996, 664–677.[Medline]
Songyang Z., Shoelson S.E., Chaudhuri M., Gish G., Pawson T., Haser W.G., King F., Roberts T., Ratnofsky S. & Lechleider R.J.. SH2 domains recognize specific phosphopeptide sequences, Cell., 12, 1993, 767–778.
Songyang Z., Gish G., Mbamalu G., Pawson T. & Cantley L.C.. A single point mutation switches the specificity of group III Src homology (SH) 2 domains to that of group I SH2 domains, J. Biol. Chem., 270, 1995, 26029–26032.
Noh D.Y., Shin S.H. & Rhee S.G.. Phosphoinositide-specific phospholipase C and mitogenic, Biochim. Biophys. Acta., 1242, 1995, 99–113.[Medline]
Chardin P., Paris S., Antonny B., Robineau S., Beraud-Dufour S., Jackson C.L. & Chabre M.. A human exchange factor for ARF contains Sec7- and pleckstrin-homology domains, Nature., 384, 1996, 481–484.[Medline]
Karlund J.K., Guilherme A., Holik J.J., Virbasius A. & Czech M.P.. Signaling by 3,4,5-phosphoinositide through proteins containing pleckstrin and Sec7 homology domains, Science., 275, 1997, 1927–1930.
Kolanus W., Nagel W., Shiller B., Zeitlmann L., Godar S., Stockinger H. & Seed B.. Alpha L beta 2 integrin/LFA-1 binding to ICAM-1 induced by cytohesin-1, a cytoplasmic regulatory molecule, Cell., 86, 1996, 233–242.[Medline]
Venkateswarlu K., Gunn-Moore F., Oatey P.B., Tavare J.M. & Cullen P.J.. Nerve growth factor- and epidermal growth factor-stimulated translocation of the ADP-ribosylation factor-exchange factor GRP1 to the plasma membrane of PC12 cells requires activation of phosphatidylinositol 3-kinase and the GRP1 pleckstrin homology domain, J. Biochem., 335, 1998, 139–146.
Dowler S., Currie R.A., Downs C.P. & Alessi D.R.. DAPP1a dual adaptor for phosphotyrosine and 3-phosphoinositides, Biochem. J., 342, 1999, 7–12.[Medline]
Rameh L.E., Arvidsson A.K., Carraway K.L. III, Couvillon A.D., Rathbun G., Crompton A., VanRenterghem B., Czech M.P., Ravichandran K.S. & Burakoff S.J.. A comparative analysis of the phosphoinositide binding specificity of pleckstrin homology domains, J. Biol. Chem., 272, 1997, 22059–22066.
Scharenberg A.M. & Kinet J.P.. PtdIns-3,4,5-P3a regulatory nexus between tyrosine kinases and sustained calcium signals, Cell., 94, 1998, 5–8.[Medline]
Fluckiger A.C., Li Z., Kato R.M., Wahl M.I., Ochs H.D., Longnecker R., Kinet J.P., Witte O.N., Scharenberg A.M. & Rawlings D.J.. Btk/Tec kinases regulate sustained increases in intracellular Ca2+ following B-cell receptor activation, EMBO (Eur. Mol. Biol. Organ.) J., 17, 1998, 1973–1985.[Medline]
Timmerman L.A., Clipstone N.A., Ho S.N., Northrop J.P. & Crabtree G.R.. Rapid shuttling of NF-AT in discrimination of Ca2+ signals and immunosuppression, Nature., 383, 1996, 837–840.[Medline]
Dolmetsch R., Lewis R., Goodnow C.C. & Healy J.I.. Differential activation of transcription factors induced by Ca2+ response, amplitude and duration, Nature., 386, 1997, 855–858.[Medline]
Cross D.A., Alessi D.R., Cohen P., Andjelkovich M. & Hemmings B.A.. Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B, Nature., 378, 1995, 785–789.[Medline]
Beals C.R., Sheridan C.M., Turck C.W., Gardner P. & Crabtree G.R.. Nuclear export of NF-ATc enhanced by glycogen synthase kinase-3, Science., 275, 1997, 1930–1934.
Aagaard-Tillery K.M. & Jelinek D.F.. Phosphatidylinositol 3-kinase activation in normal human B lymphocytes. Differential sensitivity of growth and differentiation to wortmannin, J. Immunol., 156, 1996, 4543–4554.[Abstract]
Beckwith M., Fenton R.G., Katona I.M. & Longo D.L.. Phosphatidylinositol-3-kinase activity is required for the anti-Ig-mediated growth inhibition of a human B-lymphoma cell line, Blood., 87, 1996, 202–210.
Venkataraman C., Shankar G., Sen G. & Bondada S.. Bacterial lipopolysaccharide induced B cell activation is mediated via a phosphatidylinositol 3-kinase dependent signaling pathway, Immunol. Lett., 69, 1999, 233–238.[Medline]
Suzuki H., Terauchi Y., Fujiwara M., Aizawa S., Yazaki Y., Kadowaki T. & Koyasu S.. Xid-like immunodeficiency in mice with disruption of the p85alpha subunit of phosphoinositide 3-kinase, Science., 283, 1999, 390–392.
Fruman D.A., Snapper S.B., Yballe C.M., Davidson L., Yu J.Y., Alt F.W. & Cantley L.C.. Impaired B cell development and proliferation in absence of phosphoinositide 3-kinase p85alpha, Science., 283, 1999, 393–397.
Buhl A.M., Pleiman C.M., Rickert R.C. & Cambier J.C.. Qualitative regulation of B cell antigen receptor signaling by CD19selective requirement for PI3-kinase activation, inositol-1,4,5-trisphosphate production, and Ca2+ mobilization, J. Exp. Med., 186, 1997, 1897–1910.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Facebook 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|
