|
||
Original Article |
La Jolla Institute for Allergy and Immunology, 10355 Science Center Dr., San Diego, CA 92121.619-558-3525619-678-4559
eli{at}liai.org
| Abstract |
|---|
|
|
|---|
Key Words: neonatal tolerance deletion/anergy nasal instillation HEL T cell repertoire
Several experiments have supported the hypothesis that tolerance to a minimal determinant results in clonal inactivation via deletion or anergy 11, whereas direct thymic studies demonstrate a loss of T cells by negative selection in the thymus 12. Recently, however, additional studies have suggested that Th1/Th2 deviation may be the sole consequence of neonatal Ag administration 34. In those studies, neonatal BALB/c mice were given an intraperitoneal injection of the model Ag, hen egg white lysozyme (HEL) emulsified in IFA, and then were analyzed as adults for T cell–proliferative and cytokine recall responses to cognate Ag. The results showed that although the draining LN proliferative response was dramatically reduced, the splenic proliferative response to Ag remained significant and Th2 in nature 34. A similar result was obtained in a different H-2 haplotype using a high-level neonatal exposure to a murine leukemia virus 13. These findings would appear to contradict our previous results indicating that neonatal tolerance to a minimal determinant results in clonal inactivation via deletion or anergy 11. However, the current results demonstrate that clonal inactivation of Th1 cells can proceed concomitantly with the appearance of different Th2 cells of the same antigenic specificity. In this study, we have addressed the question of whether the residual responsive splenic T cell repertoire seen in neonatally treated ("tolerized") mice utilizes a qualitatively different responder T cell population compared with untreated mice. Splenic T cells were specifically targeted because historically, LN cells display a classic "tolerant" phenotype after neonatal treatment 111415, whereas splenic T cells remain responsive 34.
In contrast to other studies that focus on the cytokine profile of a single clone in response to in vitro stimulation with altered peptide ligands 16 or differing Ag concentrations 1718, we investigated the T cell repertoire after tolerance induction at the clonal level within the polyclonal context of the spleen. This distinction allowed us to directly follow the fate of the cell(s) as opposed to the fate of the response.
Despite the existence of many other potential determinants, BALB/c mice (H-2d) immunized with whole HEL mount a response directed almost completely to a single determinant of the molecule with a core of peptide (p)108–116 19. Most importantly, repertoire analysis has identified a public TCR gene rearrangement that is used by all BALB/c mice when mounting an anti-HEL T cell response 20. This T cell expansion, originally described by Cibotti et al. 20, has also held true for all unmanipulated, HEL-primed BALB/c mice tested to date in our laboratory. It is characterized by a TCR gene rearrangement containing a Vβ8.2 variable region and a Jβ1.5 joining region that together encode for a CDR3 length of eight amino acids, GTGNNQAP 20. The technique of CDR3 length repertoire analysis (immunoscope) allows such public expansions to be followed in the presence of a polyclonal repertoire. Here we show that BALB/c mice tolerized as neonates with HEL in IFA can generate a significant splenic proliferative response to HEL as adults; however, this response excludes the public clone upon subsequent challenge with HEL–CFA. Similar results were obtained when animals were nasally instilled with p106–116 and then challenged with HEL–CFA. Thus, these methods of tolerance induction can induce both clonal deletion (or anergy) of the dominant T cell clone as well as immune deviation of other Ag-specific T cells. These findings demonstrate that previous observations concerning clonal deletion and cytokine deviation of the T cell response after neonatal exposure to Ag were describing the fates of different populations.
Neonatal Tolerance Induction.
Adult Nasal Tolerance Induction.
Adult Antigenic Challenge.
Tissue Culture.
Protein and Peptide Ags.
T Cell Proliferation Assay.
ELISPOT Cellular Assays for Cytokine Production.
Assays for Serum Abs.
T Cell Receptor Repertoire Analysis.
![]()
Introduction
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
Early discussions of transplantation tolerance and high dose tolerance 12 revolved around the debate as to whether they represented a "central" or a "peripheral" response deficit. Recently, this discussion has centered on assessing roles of deletion or anergy versus cytokine deviation in Ag-induced tolerance 34. Additionally, regulation via Ag- and receptor-centered devices has also been considered as a plausible component of response tolerance 5678910.
![]()
Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
Mice.
BALB/cJ mice were purchased from The Jackson Laboratory and bred in our specific pathogen–free colony at the La Jolla Institute for Allergy and Immunology. Neonatal mice used in all experiments were age matched, housed in filter top cages, and fed autoclaved chow. For the nasal instillation experiments, the mice were also sex matched.
Three groups of neonatal mice, receiving a total of 0.01, 100, or 500 µg of HEL, were tolerized as described 11. In brief, the two groups of neonates were given intraperitoneal injections of 50 µl containing 0.005, 50, or 250 µg of HEL, respectively. Injections were given within the first 18 h of life and then again at 72 h. HEL was dissolved in PBS and emulsified 1:1 in IFA (Difco Labs., Inc.). A control group of neonates was given intraperitoneal injections of IFA without Ag, also administered at 18 and 72 h.
Nasal instillation treatment was initiated in female mice at 5 wk of age. Mice were separated into two groups, one receiving 10 and the other 100 µg of HEL p106–116 dissolved in 20 µl of PBS and delivered to the tip of the nose after light anesthesia (halothane). 7 d later, animals were given a second identical instillation. A control group was given two 20-µl instillations of PBS, also 1 wk apart.
In neonatal tolerance experiments, mice were immunized at 6 wk of age in the hind foot pads (
25 µl per foot pad) with HEL emulsified 1:1 in CFA, such that each mouse received a total of 100 µg of HEL–CFA. In the nasal instillation experiments, mice were immunized with 100 µg of HEL emulsified 1:1 in CFA 10 d after the final nasal instillation of p106–116. 14 d after the HEL–CFA immunization, tissues were harvested.
Individual spleens and LNs were aseptically removed, and single-cell suspensions were prepared in petri dishes containing DME (GIBCO BRL Life Technologies, Inc.). Large debris was removed by decanting, followed by two washes in DME. Splenocytes and LN cells were adjusted to 6 x 106 and 4 x 106 cells/ml, respectively, for subsequent culture. The medium employed in all tissue culture was serum-free HL-1 (BioWhittaker) supplemented with 5 x 10–5 M 2-ME (Sigma Chemical Co.), 4 mM of L-glutamine, 100 U/ml of benzyl penicillin, and 100 µg/ml of streptomycin sulfate (all three from GIBCO BRL). All cultures were incubated at 37°C in a humidified atmosphere of 5% CO2.
HEL was purchased from Sigma Chemical Co. and then further purified on a Bio-Rex 70 column (Bio-Rad Labs.). HEL p106–116 (NAWVAWRNRCK) was purchased from Macromolecular Resources and found to be 95% pure by mass spectrometry.
Splenocytes and LN cells were cultured in 96-well plates at 6 x 105 and 4 x 105 cells/well, respectively, in the presence or absence of Ag. Proliferation was measured by incorporation of 1 µCi of [3H]thymidine (ICN, Inc.) for the last 18 h of a 4-d culture. The cells were harvested onto glass fiber filter mats (LKB-Wallac Ltd.) using a Mach III Harvester 96 (Tomtec), and [3H]thymidine incorporation was measured using a scintillation counter (Microbeta +; LKB-Wallac).
After 36 h of culture in the presence or absence of Ag, splenocytes and LN cells were washed once and adjusted to 5 x 106 cells/ml in fresh, supplemented HL-1 serum-free medium. IFN-
, IL-4, and IL-5 production was then determined using standard ELISPOT assays, as described in detail elsewhere 21. In brief, cells were incubated on nitrocellulose plates previously coated with anticytokine mAb and blocked with 1% FBS/PBS for 24 h at multiple dilutions. After washing and lysing of cells in chilled PBS/0.5% Tween 20, bound cytokines were detected by adding biotinylated anticytokine mAb directed to a nonoverlapping epitope on the cytokine. After incubation of plates with streptavidin peroxidase (Vector Labs.), plate-bound enzyme was visualized using 3-amino-9-ethyl carbazole (Sigma Chemical Co.) as a substrate. Plates were washed in distilled water and dried before subsequent visual spot enumeration under a dissecting microscope.
ELISA with anti–mouse Ig was used to determine serum levels of Abs specific for HEL. Affinity-purified rabbit Ab specific for IgG1 or IgG2a H chains were obtained from Zymed Labs. In brief, Maxisorp Immunoplates were coated for 1 h at 37°C with 50 µl per well of HEL diluted to 10 µg/ml in carbonate/bicarbonate buffer, pH 9.6. After washing twice in PBS/0.05% Tween 20, plates were blocked at 37°C for 1 h with 200 µl per well of a PBS/1% BSA solution. After two washes, sera to be tested were then added at 50 µl per well in dilutions ranging from 1/10 to 1/500 and incubated overnight at 4°C. Pooled sera from HEL-immunized mice were used as a positive standard. After three further washes in PBS/Tween 20, antiisotype conjugate was added at an optimal (1/500) dilution in PBS/BSA and incubated at 37°C for 1 h. After eight additional washes, the amount of enzyme bound to the wells was assessed using p-nitrophenyl phosphate as the substrate for 20–30 min at 37°C. The plates were then assayed at OD 405 nm on a multiscan plate reader.
Repertoire analyses were performed using a modified protocol similar that described by Pannetier et al. 22. Total RNA was isolated from cell suspensions of individual samples using Trizol reagent according to product instructions (GIBCO BRL Life Technologies). cDNA syntheses were then performed using an oligo-dT primer (dT)15 according to the manufacturer's instructions (GIBCO BRL Life Technologies). From each cDNA, PCR reactions were then performed using a Vβ8.2 primer (CATTATTCATATGGTGCTGGC) and a common Cβ primer (CACTGATGTTCTGTGTGACA). Using 2 µl of this product as a template, run-off reactions were performed with a single internal fluorescent primer for each Jβ tested, a 1-min 94°C denature and then five cycles of 94°C for 45 s, 60°C for 45 s, and 72°C for 45 s, followed by a 1-min extension at 72°C. These products were then denatured in formamide and analyzed on an Applied Biosystems 310 Prism using GeneScan 2.0 software (Perkin-Elmer Corp.). Labeled products were analyzed separately or duplexed as four-color electrofluorographs. These data determine peak areas and confirm appropriate product specificity based upon size and color (primer specificity). The relative intensity of signal (RIS) value was calculated as the area under the experimental peak divided by the area under the control peak found within a Gaussian distribution. Peaks were normalized before division. Control peaks obtained from either IFA/CFA-immunized animals or naive animals gave equivalent RIS values. RIS values >4 are considered significant 22.
![]()
Results and Discussion
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
Neonatal Administration of HEL Inhibits the Clonal Expansion of the Public Repertoire.
As all HEL-primed BALB/c mice utilize an identical "public" clone that could be readily followed, we measured its expansion in tolerized and untolerized animals to determine whether the mechanism of neonatal tolerance involves T cell deletion or anergy. BALB/c mice were treated neonatally with HEL in IFA (as described in Materials and Methods). Upon reaching adulthood, spleens from neonatally treated animals that had not been challenged in vivo were examined for T cell response after in vitro stimulation with HEL. Fig. 1 shows that adult BALB/c mice treated neonatally with HEL continue to mount a strong in vitro splenic proliferative response to whole HEL as well as to its dominant determinant, p106–116. Clearly, not all HEL-specific T cells are deleted in this form of tolerance induction.
|
|
To further characterize the residual HEL-specific T cells in mice that were both neonatally treated and challenged in adulthood with HEL, the Ig isotypes and cytokines produced in response to HEL were identified. When compared with untolerized animals, the IgG2a anti-HEL responses (Th1) were significantly reduced in the neonatally treated group. In fact, IgG2a responses were essentially undetectable in five out of seven animals in the tolerized group and were marginal in the remaining two animals. IgG1 responses (Th2), however, were not affected in six out of seven tolerized animals (Fig. 3). In addition, ELISPOT cytokine analysis revealed that IL-5 responses were significantly increased in the neonatally treated animals, whereas IFN-
responses were lower or remained unchanged (data not shown).
|
|
|
Furthermore, there is evidence that IL-2–producing Th1 cells are more susceptible to activation-induced cell death than Th2 cells 28. In our study, there is a clear deficit of at least one major TCR expansion in the tolerized animals that are immunologically challenged. Therefore, we postulate that the Th2 nature of the residual splenic T cells arises from the relatively weak interaction of their TCRs with p106–116-bound MHC class II complexes. This notion is supported by the finding that low concentrations of Ag tend to promote the development of Th2 cells 171829. Therefore, a low-affinity TCR might signal for a similar response. In accord with this concept, it has been shown in the I-Au system that Th2 responses to the NH2-terminal region of myelin basic protein result from sparse ligand display, low-affinity TCR, or both. However, T cells with a higher avidity receptor may adopt either a Th1 or Th2 phenotype depending on the density of the ligand 16. In short, in the spectrum of p103–120-specific T cells, there exist some low-avidity T cells that are stimulated by HEL-derived peptides from this region to respond in a Th2 fashion just as there exist altered peptide ligands capable of inducing Th2 responses 30.
Determinant Display and the Induction of Tolerance.
It has been shown that tolerance is induced best to well-processed and -presented determinants and that subdominant and cryptic determinants are less efficient at tolerance induction using whole protein Ags 3132. Conceivably, the recall response to HEL seen in Fig. 1 might be augmented by responses to previously subdominant and latent cryptic determinants. This could explain why the response to p106–116 is slightly lower than that to HEL (Fig. 1). In addition, it has been postulated that the same peptide can bind in multiple overlapping registers (our unpublished results) or possibly in multiple conformations to the class II MHC molecule 33. Thus, a portion of the residual response measured after tolerance induction might be specific for a particular conformation or register that is disfavored when processed from the intact protein. In either case, the Th2 phenotype can be explained in terms of a low density of determinant display in the appropriate conformation/register, which, as in the case of a low Ag concentration, would favor the development of Th2 cells 1718. Perhaps several of these possibilities simultaneously contribute to our observed results.
A third consideration, which is not addressed experimentally at present, is the cytokine milieu surrounding the differentiating T cell. The amount of IL-12 and IL-4 in this milieu has been shown to have profound effects on the development of Th1 and Th2 cells, respectively 34. We cannot dismiss the importance of these effects. In our experiments, however, both tolerized and control animals were immunized with HEL emulsified in CFA. Because of this, the cytokine milieu should have remained largely constant between tolerized and untolerized groups, except for cytokines produced by HEL-specific cells, which could have helped to drive the response one way or the other. In fact, adult immunization with HEL–IFA, presumably a Th2-inducing stimulus 3, does expand the public clone (data not shown). Thus, the probability of a T cell responding to an antigenic stimulus in a Th1 or Th2 fashion depends on multiple factors, one of which is the particular TCR borne by the T cell.
Tolerance Redefined.
In earlier experiments when Ab-producing B cell activity was sought after neonatal or adult tolerance to high-level Ag (BSA), none was found 35. Furthermore, early T cell tolerance experiments were interpreted to indicate that central T cell activity had been inhibited. Therefore, in light of the finding that considerable residual responsiveness remains or is revealed in the spleen when the appropriate T cell population is studied directly despite neonatal or nasal "tolerance regimens," the term "tolerance" needs to be carefully defined. Classic experiments by Billingham et al. 2 and Owen et al. 36 showed that fetal or neonatal exposure to transplant Ags resulted in an immune system that would tolerate and not react against these same alloantigens. Although it is possible that all alloreactive cells were simply converted to a nonaggressive phenotype (Th2), it is likely that as shown here with HEL, many of the highly reactive cells could have been deleted or anergized. Accordingly, the residual T cell repertoire directed to any self-Ag would largely remain as a contingent of cells capable of responding to many of its subdominant/cryptic determinants, regardless of the extent of previous tolerogenic exposure. Within the body of T cells directed against the dominant determinant(s), the high-avidity members would become tolerized, whereas the lower avidity group should remain available to respond to sufficient levels of appropriate versions of the dominant determinant. It appears that complete silencing of the whole contingent of immune cells directed against the whole Ag cannot be achieved. Nevertheless, the term "tolerance," implying a qualitative variety of ways of safely dealing with self-Ags, might usefully be retained as an envelope term, providing that the context of its usage does not overstep its limitations.
| Acknowledgments |
|---|
Submitted: 29 September 1999
Accepted: 29 October 1999
Abbreviations used in this paper: HEL, hen egg white lysozyme; RIS, relative intensity of signal.
| References |
|---|
|
|
|---|
Surh C.D. & Sprent J.. T-cell apoptosis detected in situ during positive and negative selection in the thymus, Nature., 372, 1994, 100–103.[Medline]
Billingham M.A., Brent L. & Medawar P.B.. Actively acquired tolerance of foreign cells, Nature., 172, 1953, 603–606.[Medline]
Forsthuber T., Yip H.C. & Lehmann P.V.. Induction of TH1 and TH2 immunity in neonatal mice, Science., 271, 1996, 1728–1730.[Abstract]
Singh R.R., Hahn B.H. & Sercarz E.E.. Neonatal peptide exposure can prime T cells and, upon subsequent immunization, induce their immune deviationimplications for antibody vs. T cell–mediated autoimmunity, J. Exp. Med., 183, 1996, 1613–1621.
Ben-Nun A., Wekerle H. & Cohen I.R.. Vaccination against autoimmune encephalomyelitis with T-lymphocyte line cells reactive against myelin basic protein, Nature., 292, 1981, 60–61.[Medline]
Vandenbark A.A., Hashim G. & Offner H.. Immunization with a synthetic T-cell receptor V-region peptide protects against experimental autoimmune encephalomyelitis, Nature., 341, 1989, 541–544.[Medline]
Howell M.D., Winters S.T., Olee T., Powell H.C., Carlo D.J. & Brostoff S.W.. Vaccination against experimental allergic encephalomyelitis with T cell receptor peptides, Science., 246, 1989, 668–670.
Lohse A.W., Mor F., Karin N. & Cohen I.R.. Control of experimental autoimmune encephalomyelitis by T cells responding to activated T cells, Science., 244, 1989, 820–822.
Kumar V. & Sercarz E.E.. The involvement of T cell receptor peptide-specific regulatory CD4+ T cells in recovery from antigen-induced autoimmune disease, J. Exp. Med., 178, 1993, 909–916.
Sercarz E. & Krzych U.. The distinctive specificity of antigen-specific suppressor T cells, Immunol. Today., 12, 1991, 111–118.[Medline]
Gammon G., Dunn K., Shastri N., Oki A., Wilbur S. & Sercarz E.E.. Neonatal T-cell tolerance to minimal immunogenic peptides is caused by clonal inactivation, Nature., 319, 1986, 413–415.[Medline]
Kappler J.W., Roehm N. & Marrack P.. T cell tolerance by clonal elimination in the thymus, Cell., 49, 1987, 273–280.[Medline]
Sarzotti M., Robbins D.S. & Hoffman P.M.. Induction of protective CTL responses in newborn mice by a murine retrovirus, Science., 271, 1996, 1726–1728.[Abstract]
Clayton J.P., Gammon G.M., Ando D.G., Kono D.H., Hood L. & Sercarz E.E.. Peptide-specific prevention of experimental allergic encephalomyelitis. Neonatal tolerance induced to the dominant T cell determinant of myelin basic protein, J. Exp. Med., 169, 1989, 1681–1691.
Gammon G.M., Oki A., Shastri N. & Sercarz E.E.. Induction of tolerance to one determinant on a synthetic peptide does not affect the response to a second linked determinant. Implications for the mechanism of neonatal tolerance induction, J. Exp. Med., 164, 1986, 667–672.
Kumar V., Bhardwaj V., Soares L., Alexander J., Sette A. & Sercarz E.. Major histocompatibility complex binding affinity of an antigenic determinant is crucial for the differential secretion of interleukin 4/5 or interferon gamma by T cells, Proc. Natl. Acad. Sci. USA., 92, 1995, 9510–9514.
Hosken N.A., Shibuya K., Heath A.W., Murphy K.M. & O'Garra A.. The effect of antigen dose on CD4+ T helper cell phenotype development in a T cell receptor-alpha beta-transgenic model, J. Exp. Med., 182, 1995, 1579–1584.
Constant S., Pfeiffer C., Woodard A., Pasqualini T. & Bottomly K.. Extent of T cell receptor ligation can determine the functional differentiation of naive CD4+ T cells, J. Exp. Med., 182, 1995, 1591–1596.
Gammon G., Geysen H.M., Apple R.J., Pickett E., Palmer M., Ametani A. & Sercarz E.E.. T cell determinant structurecores and determinant envelopes in three mouse major histocompatibility complex haplotypes, J. Exp. Med., 173, 1991, 609–617.
Cibotti R., Cabaniols J.P., Pannetier C., Delarbre C., Vergnon I., Kanellopoulos J.M. & Kourilsky P.. Public and private V beta T cell receptor repertoires against hen egg white lysozyme (HEL) in nontransgenic versus HEL transgenic mice, J. Exp. Med., 180, 1994, 861–872.
Gabaglia C.R., Pedersen B., Hitt M., Burdin N., Sercarz E.E., Graham F.L., Gauldie J. & Braciak T.A.. A single intramuscular injection with an adenovirus-expressing IL-12 protects BALB/c mice against Leishmania major infection, while treatment with an IL-4–expressing vector increases disease susceptibility in B10.D2 mice, J. Immunol., 162, 1999, 753–760.
Pannetier C., Cochet M., Darche S., Casrouge A., Zoller M. & Kourilsky P.. The sizes of the CDR3 hypervariable regions of the murine T-cell receptor beta chains vary as a function of the recombined germ-line segments, Proc. Natl. Acad. Sci. USA., 90, 1993, 4319–4323.
Anderton S.M. & Wraith D.C.. Hierarchy in the ability of T cell epitopes to induce peripheral tolerance to antigens from myelin, Eur. J. Immunol., 28, 1998, 1251–1261.[Medline]
Tian J., Atkinson M.A., Clare-Salzler M., Herschenfeld A., Forsthuber T., Lehmann P.V. & Kaufman D.L.. Nasal administration of glutamate decarboxylase (GAD65) peptides induces Th2 responses and prevents murine insulin-dependent diabetes, J. Exp. Med., 183, 1996, 1561–1567.
Melo M.E., Goldschmidt T.J., Bhardwaj V., Ho L., Miller A. & Sercarz E.. Immune deviation during the induction of tolerance by way of nasal installationnasal installation itself can induce Th-2 responses and exacerbation of disease, Ann. NY Acad. Sci., 778, 1996, 408–411.[Medline]
Hagerty D.T. & Allen P.M.. Intramolecular mimicry. Identification and analysis of two cross-reactive T cell epitopes within a single protein, J. Immunol., 155, 1995, 2993–3001.[Abstract]
Bhardwaj V., Kumar V., Geysen H.M. & Sercarz E.E.. Degenerate recognition of a dissimilar antigenic peptide by myelin basic protein-reactive T cells. Implications for thymic education and autoimmunity, J. Immunol., 151, 1993, 5000–5010.[Abstract]
Van Parijs L. & Abbas A.K.. Homeostasis and self-tolerance in the immune systemturning lymphocytes off, Science., 280, 1998, 243–248.
Rogers P.R. & Croft M.. Peptide dose, affinity, and time of differentiation can contribute to the Th1/Th2 cytokine balance, J. Immunol., 163, 1999, 1205–1213.
Boutin Y., Leitenberg D., Tao X. & Bottomly K.. Distinct biochemical signals characterize agonist- and altered peptide ligand-induced differentiation of naive CD4+ T cells into Th1 and Th2 subsets, J. Immunol., 159, 1997, 5802–5809.[Abstract]
Gammon G. & Sercarz E.. How some T cells escape tolerance induction, Nature., 342, 1989, 183–185.[Medline]
Cibotti R., Kanellopoulos J.M., Cabaniols J.P., Halle-Panenko O., Kosmatopoulos K., Sercarz E. & Kourilsky P.. Tolerance to a self-protein involves its immunodominant but does not involve its subdominant determinants, Proc. Natl. Acad. Sci. USA., 89, 1992, 416–420.
Viner N.J., Nelson C.A., Deck B. & Unanue E.R.. Complexes generated by the binding of free peptides to class II MHC molecules are antigenically diverse compared with those generated by intracellular processing, J. Immunol., 156, 1996, 2365–2368.[Abstract]
Constant S.L. & Bottomly K.. Induction of Th1 and Th2 CD4+ T cell responsesthe alternative approaches, Annu. Rev. Immunol., 15, 1997, 297–322.[Medline]
Sercarz E.E. & Coons A.H.. Specific inhibition of antibody formation during immunological paralysis and unresponsiveness, Nature., 184, 1959, 1080–1082.[Medline]
Owen R.D.. Immunogenetic consequences of vascular anastomoses between bovine twins, Science., 102, 1945, 400–401.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|