Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article Abstract Full Text (PDF, 157K) PPT slides of all figures Alert me when this article is cited Citation Map Services Email this article Similar articles in this journal Similar articles in PubMed Alert me to new content in the JEM Download to citation manager Citing Articles Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Degermann, S. Articles by Karjalainen, K. Search for Related Content PubMed PubMed Citation Articles by Degermann, S. Articles by Karjalainen, K. Pubmed/NCBI databases Gene Social Bookmarking                            What's this?

Brief Definitive Report

^a Basel Institute for Immunology, CH-4005 Basel, Switzerland
Basel Institute for Immunology, Grenzacherstr. 487, CH-4005 Basel, Switzerland.41-61-605-136441-61-605-1249

degermann{at}bii.ch

	Abstract

Top Abstract Materials and Methods Results and Discussion References

 
A striking feature of the T cell receptor (TCR) β chain structure is the large FG loop that protrudes freely into the solvent on the external face of the Cβ domain. We have already shown that a transgene-encoded Vβ8.2⁺ TCR β chain lacking the complete Cβ FG loop supports normal development and function of conventional /β T cells. Thus, the FG loop is not absolutely necessary for TCR signaling. However, further analysis has revealed that a small population of /β T cells coexpressing NK1.1 are severely depleted in these transgenic mice. The few remaining NK1.1 T cells have a normal phenotype but express very low levels of TCR. We find that the TCR Vβ8.2⁺ chain lacking the Cβ FG loop cannot pair efficiently with the invariant V14-J281 TCR chain commonly expressed by this T cell family. Consequently, fewer NK1.1 T cells develop in these mice. Our results suggest that expression of the V14⁺ TCR chain is particularly sensitive to TCR-β conformation. Development of NK1.1 T cells appears to need a TCR-β conformation dependent on the presence of the Cβ loop that is not necessarily required for assembly and function of TCRs on most /β T cells.

Key Words: TCR • Cβ FG loop • mutagenesis • NK1.1 T cells • V14

All crystal structures of the TCR β chain reported to date have shown that the constant and variable domains are closely associated, with a large, solvent-exposed loop of 14 amino acids protruding on the external face of the Cβ domain 1234. The location and size of this loop (almost half of an Ig domain) suggested that it could be the crucial link between TCR-/β recognition of antigen and transmission of signals by the invariant CD3 145. To study its function, we recently generated mice transgenic for a TCR β chain lacking the complete Cβ FG loop. The TCR β chain (Vβ8.2-Jβ2.1) chosen for mutagenesis has been crystallized 1; it was cloned from T cell hybridoma 14.3.d, which expresses a TCR chain (V4-J47) and recognizes a PR8 influenza hemagglutinin peptide, HA 110–119, presented by the I-E^d MHC molecule 6. Surprisingly, we found that development and function of conventional /β T cells was normal in mice transgenic for a TCR β chain lacking the Cβ FG loop. Thus, the Cβ FG loop is not absolutely required for transmitting the signal of antigen recognition by the TCR 7.

Further analysis revealed that a small population of /β T cells coexpressing NK1.1 is drastically diminished in these mice. Many features 8, including development, functional properties, and TCR repertoire, distinguish this latter population from conventional T cells. Development of NK1.1 T cells requires expression of the β₂ microglobulin–associated, class Ib–like CD1d1 molecule 910, which can restrict their response to lipid ligands such as glycosylphosphatidylinositols or glycosylceramides 1112. NK1.1 T cells can readily produce large amounts of cytokines upon activation 13, and they have been implicated in tumor rejection 1415 and may also play a regulatory role in autoimmune manifestations 161718. NK1.1 T cells express a limited Vβ repertoire highly skewed toward Vβ8.2, Vβ7, and Vβ2 8, and in transgenic mice expressing single Vβs such as Vβ3 and Vβ8.1, NK1.1 T cell development is totally abrogated 19. Furthermore, 80% of NK1.1 T cells express an invariant TCR chain (V14-J281) 2021 that is required for their development 15.

In this study, we present evidence that the Vβ8.2 TCR β chain lacking the complete Cβ FG loop cannot pair efficiently with the canonical V14⁺ TCR chain. Consequently, NK1.1 T cell development is severely impaired.

	Materials and Methods

Top Abstract Materials and Methods Results and Discussion References

 
TCR-β Mutagenesis.
The wild-type TCR β chain (Vβ8.2-Jβ2.1) cDNA was used as a template for mutagenesis. Deletion of the 14 nucleotides forming the Cβ FG loop has been described 7. Transgenic vectors have also been described previously 22.

Transfection of Cell Lines.
Packaging cell lines GP+E-86 23 were transfected with retroviral vector LXSN expressing the Vβ8.2-Jβ2.1⁺ TCR-β or β-loop^– chain or LXSP expressing the V4-J47⁺ or V14-J281⁺ TCR chain cDNA. The TCR chain (V14-J281) was cloned from NK1.1 /β⁺ T cell hybridoma total RNA provided by R. MacDonald (Ludwig Institute for Cancer Research, Lausanne, Switzerland). After appropriate selection of the packaging cells, the infectious supernatants were used to infect TCR^– hybridomas 24 as previously described 25. The TCR-β or β-loop^– chain was first introduced into the hybridomas and, after neomycin selection (G418; 1 mg/ml), these cells were superinfected with TCR chain by culturing them on packaging lines producing LXSP TCR- V4-J47 or V14-J281. The hybridomas were then maintained in IMDM supplemented with 2% FCS, neomycin, and puromycin (10 µg/ml). TCR expression was tested by FACS^TM as early as 4 d after selection. Stable transfectants were maintained in G418 and puromycin-containing medium.

TCR Immunoprecipitation and Western Blot Analysis.
Hybridomas were lysed at 2 x 10⁷ cells/ml in 1% Triton X-100 (Bio-Rad Labs.), 150 mM NaCl, 20 mM Tris/HCl, and 5 mM EDTA, pH 7.5, buffer containing complete protease inhibitors (Boehringer Mannheim) for 30 min at 4°C. Lysates cleared of cell debris were immunoprecipitated with purified mAb F23.1 (2 µg/ml) and protein G–Sepharose (Pharmacia). After washing with lysis buffer and PBS, the lyophilized pellets were resuspended in reducing SDS buffer, loaded on a 4–12% Bis-Tris precast gel (Novex), and transferred onto nitrocellulose membrane Hybond-C extra (Amersham). Blots were probed in PBS 6% blotting blocker nonfat milk (Bio-Rad Labs.) and 0.2% Tween with purified mAb H58 (anti-C), followed by goat anti–hamster horseradish peroxidase–labeled mAb (Southern Biotechnology Associates, Inc.) or biotinylated F23.1 (anti-Vβ8) mAb followed by streptavidin–horseradish peroxidase (Southern Biotechnology Associates, Inc.). The proteins were detected with a chemiluminescent detection system (Pierce Chemical Co.).

Mice.
BALB/c and C56BL/6 mice were purchased from IFFA-Credo. The TCR-β knockout mice have been described 26 and were bred in our specific pathogen–free animal facility with the TCR-β or TCR β-loop^– transgenic mice.

Cell Suspension, Flow Cytometry, and Antibodies.
Cell suspensions from thymi were depleted of CD8⁺ T cells with anti-CD8 31M antibody 27 and complement treatment (Cedarlane Labs.), and liver cells were simply ficolled to eliminate red cells before immunofluorescence stainings, performed as previously described 28. Flow cytometric analyses were performed on a FACSCalibur^TM equipped with CELLQuest software (Becton Dickinson). The reagents used were mAbs 145-2C11 (anti-CD3), NKR-P1C (anti-NK1.1), H57-597 (anti-Cβ), RM4-5 (anti-CD4), IM7 (anti-CD44, Pgp-1), TM-β1 (anti–IL-2R β chain), MEL-14 (anti-CD62L) (all seven mAbs purchased from PharMingen), biotinylated F23.1 (anti-Vβ8.1,2,3), and second step reagent streptavidin–allophycocyanin (Molecular Probes, Inc.).

Single-Cell Reverse Transcriptase–PCR.
Single NK1.1⁺CD3⁺ cells were sorted into polycarbonated 96-well plates (one cell per well in 5 µl of PBS) and immediately frozen on dry ice and stored at –70°C. To prepare cDNA, the plate was heated up to 65°C for 1 min before adding into each well 10 µl of the reverse transcriptase (RT)-PCR mix (reverse transcriptase Superscript II; GIBCO BRL) for 1 h at 42°C under standard reaction conditions. After heat inactivation of the enzyme (2 min at 95°C), DNA amplification was carried out as described 29. 75 µl of a PCR mix containing Taq polymerase and the primers necessary for DNA amplification of the V14⁺ TCR chain (5' V14 CTAAGCACAGCACGCTGCACA [reference 20]; 3' C ATGGATCCTCAACTGGACCACAGCCTCA) and Vβ8.2⁺ TCR β chain (5' Vβ8.2 CTTGAGCTCAAGATGGGCTCCAGGCTCTTC; 3' Jβ2.1 CTGCTCAGCATAACTCCCCCG) were added to the wells for the first round of PCR (30 cycles). An aliquot from this PCR (1 µl) was used for a second round of PCR (35 cycles) to individually reamplify the V14⁺ TCR chain or Vβ8.2⁺ TCR β chain using the same specific primers.

	Results and Discussion

Top Abstract Materials and Methods Results and Discussion References

 
To avoid any influence of the endogenous β locus on the expression of the mutated β chain, mice transgenic for the Vβ8.2⁺ TCR β chain lacking the Cβ FG loop (β-loop^–) were backcrossed to TCR-β^–/– mice 26. T cell development in these mice was compared with that in wild-type Vβ8.2⁺ TCR β chain transgenic mice, also with a β^–/– background. As described in our previous study 7, peripheral T cells from mice transgenic for the TCR β or β-loop^– chain express equal levels of the TCR–CD3 complex, and whereas the anti-Vβ8 F23.1 mAb recognizes all T cells, the Cβ-specific H57 mAb does not stain cells expressing the TCR β-loop^– chain (Fig. 1; reference 4). It is worth pointing out that in the absence of the Cβ FG loop, the anti-CD3 2C11 mAb stains better, suggesting that the epitope recognized is more accessible, a result that might not be surprising, as one of the CD3 chains is physically adjacent to the β chain in the TCR–CD3 complex 5.

View larger version (48K): [in this window] [in a new window] [Download PPT slide]   Figure 1 T cells expressing the Vβ8.2+ TCR β chain lacking the FG loop cannot be stained with the Cβ-specific H57 mAb. LN cell suspensions from TCR-β and β-loop– transgenic mice were stained with anti-CD3 together with anti-Vβ8 or anti-Cβ mAb.

 
We consistently found that TCR β-loop^– transgenic mice have significantly fewer NK1.1 /β⁺ T cells in the thymus, liver, and spleen (data not shown) in comparison to TCR-β transgenic mice or wild-type littermates (Fig. 2). Thus, a mutation in the Cβ domain can notably alter development of NK1.1 /β T cells. This result was puzzling, considering that conventional /β T cells are normal in TCR β-loop^– transgenic mice 7. Furthermore, the mutated TCR β chain uses Vβ8.2, a variable region that is usually expressed by >40% of NK1.1 /β T cells 30. Hence, monoclonal expression of the wild-type Vβ8.2⁺ TCR β chain allows NK1.1 T cell development comparable to that of nontransgenic littermates. Characteristically, NK1.1 T cells express intermediate levels of TCR 8. Interestingly, in TCR β-loop^– transgenic mice, TCR expression on the few remaining NK1.1 T cells is even lower than in control animals; these cells express about four times less TCR than do those in wild-type β-transgenic mice (Fig. 3). Otherwise, NK1.1 T cells in β-loop^– transgenic mice express normal levels of CD4 and are CD44⁺CD62 ligand (L)^– and IL-2Rβ⁺, as expected for this T cell population 8. CD1d, a β₂ microglobulin–associated molecule required for NK1.1 T cell development 910, is also expressed at normal levels in TCR β-loop^– transgenic mice (data not shown).

View larger version (41K): [in this window] [in a new window] [Download PPT slide]   Figure 2 Decreased amount of NK1.1 T cells in TCR β-loop– transgenic mice. Cell suspension from thymi previously depleted of CD8+ cells and livers from nontransgenic littermates (WT) or TCR-β or β-loop– transgenic mice were double stained with anti-NK1.1 together with anti-Cβ (to stain all T cells in WT mice) or anti-Vβ8 (which stains all T cells in transgenic mice) antibodies. Numbers express the percentages of total adjacent gated dots.

 

View larger version (19K): [in this window] [in a new window] [Download PPT slide]   Figure 3 The remaining NK1.1 T cells in TCR β-loop– transgenic mice have a normal phenotype. Liver cell suspensions from TCR-β or β-loop– transgenic mice were triple stained with anti-NK1.1, anti-Vβ8, and either anti-CD4 or anti-CD44 or anti-CD62L or anti–IL-2Rβ mAbs. Histograms represent NK1.1+Vβ8+ gated events. Numbers in parentheses represent the mean fluorescence intensity of Vβ8 staining. Negative controls of Vβ8 staining are shown (dashed lines).

 
To determine if development of NK1.1 /β⁺ T cells could be rescued by the expression of endogenous β chains, as has been described for other TCR-β transgenic mice 19, we studied NK1.1 T cell frequency in TCR β-loop^– transgenic mice on a β^+/– background. We have already observed that in these mice, inhibition of β rearrangements via allelic exclusion is not total, and 10–20% of peripheral T cells can express endogenous β chains (data not shown). NK1.1 /β⁺ T cells expressing endogenous β and β-loop^– chains could be distinguished by the Cβ-specific H57 mAb, which cannot stain T cells expressing the mutated β chain (Fig. 1). As shown in Fig. 4, expression of endogenous β chains can rescue NK1.1 T cell development to a certain extent. NK1.1 Cβ⁺ cells appear in the livers of TCR β-loop^– transgenic mice on a β^+/– background. Yet these cells only account for about one-third of the whole NK1.1 T cell population. The NK1.1 Cβ^– T cells are still predominant. There are two populations of NK1.1 Vβ8⁺ cells, which express either intermediate or low TCR levels in TCR β-loop^– transgenic mice on a β^1/– background. Interestingly, expression of endogenous β chains accounts for most of the NK1.1 T cells expressing intermediate TCR levels. Thus, expression of endogenous β chains did rescue some NK1.1 T cell development and restore TCR expression to intermediate levels. This result strongly suggested that the Cβ FG loop is needed for efficient TCR assembly in NK1.1 T cells.

View larger version (46K): [in this window] [in a new window] [Download PPT slide]   Figure 4 Expression of endogenous TCR β chains can rescue some NK1.1 T cell development. Liver cell suspensions from TCR β, β-loop– transgenic with a β–/– background (β-loop– β-endo–/–) or β–/+ background (β-loop– β-endo–/+) were triple stained with anti-NK1.1, anti-Cβ, and anti-Vβ8 mAbs. Numbers in dot plots are percentages of the total adjacent gated dots. Histograms represent expression of Cβ (in β-loop– transgenic mice with a β–/– or β–/+ background) for the NK1.1+ gated population expressing either intermediate (NK1.1+Vβ8int) or low levels of TCR (NK1.1+Vβ8low).

 
As most NK1.1 /β⁺ T cells express an invariant V14-J281 TCR chain 2021, and the mutant TCR β chain is expressed at normal levels by conventional /β T cells (Fig. 1) but not by NK1.1 T cells (Fig. 3), we assessed whether the mutant Vβ8.2⁺ TCR β chain could still pair with the V14⁺ TCR chain. TCR^– hybridomas were transfected with cDNAs coding for either the wild-type TCR β or β-loop^– chain together with the V14⁺ TCR chain or V4⁺ TCR chain (the original partner of the nonmutated β chain) cDNAs. As shown in Fig. 5 A, the TCR β-loop^– chain clearly pairs with and is expressed on the cell surface with the V4⁺ TCR chain but is barely detectable on the cell surface with the V14⁺ TCR chain. In contrast, the wild-type TCR β chain is expressed on the cell surface with both chains (Fig. 5). However, the V14⁺ TCR is expressed at lower levels than is the V4⁺ TCR. This observation may reflect the in vivo situation in which a TCR on NK1.1 T cells is expressed at lower levels than on conventional /β T cells. To assess whether impaired cell surface expression of the TCR wild-type β and β-loop^– chain together with the V14⁺ TCR chain is due to a problem of pairing, TCRs from the transfectants were immunoprecipitated with anti-Vβ8 mAb. As can be seen in Fig. 5 B, the TCR chain can be coimmunoprecipitated with the TCR β chain in all transfectants expressing the TCR on the cell surface. In contrast, the V14⁺ TCR chain cannot be coimmunoprecipitated with the mutant β chain in detectable amounts. This result implies that the V14⁺ TCR chain pairs very poorly with the Vβ8⁺ TCR β chain lacking the Cβ FG loop. It is worth pointing out that in the hybridomas producing the wild-type β and V14⁺ chains, many fewer assembled /β dimers can be immunoprecipitated compared with control Vβ8.2/V4 dimers. This latter result suggests that mere physical constraints on the assembly of the β chain with the V14⁺ TCR chain exist and is consistent with the low TCR expression on normal NK1.1 T cells.

View larger version (67K): [in this window] [in a new window] [Download PPT slide]   Figure 5 Inefficient pairing of the V14+ TCR chain with the Vβ8.2+ TCR β chain lacking the complete Cβ FG loop. (A) TCR– hybridomas were transfected with either the Vβ8.2+ wild-type TCR β or β-loop– chain, together with the V14+ TCR chain or V4+ TCR chain. Stable transfectants were stained with biotinylated anti-CD3 mAb, followed by streptavidin–allophycocyanin. Stainings of cells transfected with only the TCR β or β-loop– chain are shown as controls. Numbers in parentheses represent the mean fluorescence intensities of CD3 staining. (B) TCRs of transfected hybridomas or Vβ8+ T hybridoma control (A5) (8.0, 8.0, 10.0, 14.0, 20.0, 20.0, and 8.0 x 107 cells per lane, respectively, from left to right) were immunoprecipitated with anti-Vβ8 mAb (F23.1), electrophoresed on a 4–12% gel in reducing conditions, and blotted with anti-C (H58) or anti-Vβ8 mAb as described in Materials and Methods. Numbers represent protein molecular mass (kD).

 
Next, we assessed whether the NK1.1 /β⁺ T cells that do develop in TCR β-loop^– transgenic mice express the V14⁺ TCR chain by performing RT-PCR on single NK1.1 CD3⁺ T cells sorted from TCR-β and β-loop^– transgenic mice. As summarized in Table , the frequency of NK1.1 T cells expressing V14 is not significantly decreased in TCR β-loop^– transgenic mice in comparison to wild-type TCR-β transgenic animals. One has to keep in mind, however, that there are few NK1.1 T cells in the mutant mice, and these express much lower levels of TCR (Fig. 3). This, together with biochemical data, strongly suggests that in TCR β-loop^– transgenic mice, both the impaired development of NK1.1 T cells and their weak TCR expression is due to the physical constraints on the assembly of the β chain lacking the Cβ FG loop with the V14⁺ TCR chain.

View this table: [in this window] [in a new window]   Table 1 Expression of the V14+ TCR Chain by the Remaining NK1.1 T Cells in TCR β-loop– Transgenic Mice

 
We have previously shown that in conventional T cells expressing Vβ8.2, deletion of the Cβ FG loop has no effect on V 7 and J repertoire usage (our unpublished data). This result suggested that no drastic conformational changes in the TCR β chain were created by the mutation. However, in this study we clearly show that expression of the V14⁺ chain is sensitive to deletion of the Cβ FG loop. Therefore, deletion of the Cβ FG loop must create some subtle change in TCR β chain conformation. It seems that expression of the V14⁺ chain does not allow much structural flexibility of the TCR, as it is particularly sensitive to TCR β chain conformation. Its expression might impose stringent constraints on /β assembly. This could at least partially explain why the Vβ repertoire of NK1.1 T cells is relatively limited 30. Pairing with the apparently conformation-sensitive V14-J281 TCR chain could be the initial pressure on Vβ usage in NK1.1 T cells 19. Recently, results obtained by using V14-transgenic mice suggested that selection was the main force in shaping the NK1.1 T cell repertoire 31. Here we have shown that in addition to selection, differential V–Vβ pairing can also potentially influence the NK1.1 T cell diversity. In summary, our data show that subtle changes in the TCR β chain conformation (which do not seem to affect conventional Vβ8.2⁺ /β TCRs) can substantially alter pairing with the V14⁺ chain and impair NK1.1 T cell development.

	Acknowledgments

The Basel Institute for Immunology was founded and is supported by F. Hoffmann-La Roche Ltd., Basel, Switzerland.

Submitted: 22 April 1999
Revised: 25 August 1999
Accepted: 26 August 1999

	References

Top Abstract Materials and Methods Results and Discussion References

 

Bentley G., Boulot G., Karjalainen K. & Mariuzza R.. Crystal structure of the β chain of a T cell antigen receptor, Science., 267, 1995, 1984–1987.[Abstract/Free Full Text]

Garcia K., Degano M., Stanfield R., Brunmark A., Jackson M., Peterson P., Teyton L. & Wilson I.. An /β T cell receptor structure at 2.5 Å and its orientation in the TCR-MHC complex, Science., 274, 1996, 209–219.[Abstract/Free Full Text]

Garboczi D., Ghosh P., Utz U., Fan Q., Biddison W. & Wiley D.. Structure of the complex between human T-cell receptor, viral peptide and HLA-A2, Nature., 384, 1996, 134–141.[Medline]

Wang J., Lim K., Smolyar A., Teng M., Liu J., Tse A., Hussey R., Chishti Y., Thomson C. & Sweet R.. Atomic structure of an /β T cell receptor (TCR) heterodimer in complex with an anti-TCR fab fragment derived from a mitogenic antibody, EMBO (Eur. Mol. Biol. Organ.) J., 17, 1998, 10–26.[Medline]

Ghendler Y., Smolyar A., Chang H. & Reinherz E.. One of the CD3 subunits within a T cell receptor complex lies in close proximity to the Cβ FG loop, J. Exp. Med., 187, 1998, 1529–1536.[Abstract/Free Full Text]

Weber S., Traunecker A., Oliveri F., Gerhard W. & Karjalainen K.. Specific low-affinity recognition of major histocompatibility complex plus peptide by soluble T-cell receptor, Nature., 356, 1992, 793–796.[Medline]

Degermann S., Sollami G. & Karjalainen K.. T cell receptor β chain lacking the large solvent-exposed Cβ FG loop supports normal /β T cell development and function in transgenic mice, J. Exp. Med., 189, 1999, 1679–1683.[Abstract/Free Full Text]

Bendelac A., Rivera M., Park S. & Roark J.. Mouse CD1-specific NK1 T cellsdevelopment, specificity, and function, Annu. Rev. Immunol., 15, 1997, 535–562.[Medline]

Mendiratta S., Martin W., Hong S., Boesteanu A., Joyce S. & Van K.L.. CD1d1 mutant mice are deficient in natural T cells that promptly produce IL-4, Immunity., 6, 1997, 469–477.[Medline]

Chen Y., Chiu N., Mandal M., Wang N. & Wang C.. Impaired NK1⁺ T cell development and early IL-4 production in CD1-deficient mice, Immunity., 6, 1997, 459–467.[Medline]

Joyce S., Woods A., Yewdell J., Bennink J., De S.A., Boesteanu A., Balk S., Cotter R. & Brutkiewicz R.. Natural ligand of mouse CD1d1cellular glycosylphosphatidylinositol, Science., 279, 1998, 1541–1544.[Abstract/Free Full Text]

Kawano T., Cui J., Koezuka Y., Toura I., Kaneko Y., Motoki K., Ueno H., Nakagawa R., Sato H. & Kondo E.. CD1d-restricted and TCR-mediated activation of V14 NKT cells by glycosylceramides, Science., 278, 1997, 1626–1629.[Abstract/Free Full Text]

Chen H. & Paul W.. Cultured NK1.1⁺CD4⁺ T cells produce large amounts of IL-4 and IFN- upon activation by anti-CD3 or CD1, J. Immunol., 159, 1997, 2240–2249.[Abstract/Free Full Text]

Takeda K., Seki S., Ogasawara K., Anzai R., Hashimoto W., Sugiura K., Takahashi M., Satoh M. & Kumagai K.. Liver NK1.1⁺CD4⁺ /β T cells activated by IL-12 as a major effector in inhibition of experimental tumor metastasis, J. Immunol., 156, 1996, 3366–3375.[Abstract]

Cui J., Shin T., Kawano T., Sato H., Kondo E., Toura I., Kaneko Y., Koseki H., Kanno M. & Taniguchi M.. Requirement for V14 NKT cells in IL-12-mediated rejection of tumors, Science., 278, 1997, 1623–1626.[Abstract/Free Full Text]

Mieza M., Itoh T., Cui J., Makino Y., Kawano T., Tsuchida K., Koike T., Shirai T., Yagita H. & Matsuzawa A.. Selective reduction of V14 NKT cells associated with disease development in autoimmune-prone mice, J. Immunol., 156, 1996, 4035–4044.[Abstract]

Hammond K., Poulton L., Palmisano L., Silveira P., Godfrey D. & Baxter A.. /β–T cell receptor (TCR)⁺ CD4^–CD8^– (NKT) thymocytes prevent insulin-dependent diabetes mellitus in nonobese diabetic (NOD)/Lt mice by the influence of interleukin (IL)-4 and/or IL-10, J. Exp. Med., 187, 1998, 1047–1055.[Abstract/Free Full Text]

Wilson S., Kent S., Patton K., Orban T., Jackson R., Exley M., Porcelli S., Schatz D., Atkinson M. & Balk S.. Extreme Th1 bias of invariant V24JQ T cells in type 1 diabetes, Science., 391, 1998, 177–181.

Ohteki T. & MacDonald H.. Stringent Vβ requirement for the development of NK1.1⁺ T cell receptor-/β¹ cells in mouse liver, J. Exp. Med., 183, 1996, 1277–1282.[Abstract/Free Full Text]

Lantz O. & Bendelac A.. An invariant T cell receptor chain is used by a unique subset of major histocompatibility complex class I–specific CD4⁺ and CD4^–8^– T cells in mice and humans, J. Exp. Med., 180, 1994, 1097–1106.[Abstract/Free Full Text]

Shimamura M., Ohteki T., Beutner U. & MacDonald H.. Lack of directed V14-J281 rearrangements in NK1⁺ T cells, Eur. J. Immunol., 27, 1997, 1576–1579.[Medline]

Kirberg J., Baron A., Jakob S., Rolink A., Karjalainen K. & von Boehmer H.. Thymic selection of CD8⁺ single positive cells with a class II major histocompatibility complex–restricted receptor, J. Exp. Med., 180, 1994, 25–34.[Abstract/Free Full Text]

Markowitz D., Goff S. & Bank A.. A safe packaging line for gene transferseparating viral genes on two different plasmids, J. Virol., 62, 1988, 1120–1124.[Abstract/Free Full Text]

Letourneur F. & Malissen B.. Derivation of a T cell hybridoma variant deprived of functional T cell receptor alpha and beta chain transcripts reveals a nonfunctional alpha-mRNA of BW5147 origin, Eur. J. Immunol., 19, 1989, 2269–2274.[Medline]

Backstrom B., Milia E., Peter A., Jaureguiberry B., Baldari C. & Palmer E.. A motif within the T cell receptor chain constant region connecting peptide domain controls antigen responsiveness, Immunity., 5, 1996, 437–447.[Medline]

Mombaerts P., Clarke A., Rudnicki M., Iacomini J., Itohara S., Lafaille J., Wang L., Ichikawa Y., Jaenisch R. & Hooper M.. Mutations in T-cell antigen receptor genes and β block thymocyte development at different stages, Nature., 360, 1992, 225–231.[Medline]

Sarmiento M., Dialynas D.P., Lancki D.W., Wall K.A., Lorber M.I., Loken M.R. & Fitch F.W.. Cloned T lymphocytes and monoclonal antibodies as probes for cell surface molecules active in T cell-mediated cytolysis, Immunol. Rev., 68, 1982, 135–169.[Medline]

Degermann S., Surh C., Glimcher L., Sprent J. & Lo D.. B7 expression on thymic medullary epithelium correlates with epithelium-mediated deletion of Vβ51 thymocytes, J. Immunol., 152, 1994, 3254–3263.[Abstract]

Ten Boekel E., Melchers F. & Rolink A.. The status of Ig rearrangements in single cells from different stages of B cell development, Int. Immunol., 7, 1995, 1013–1019.[Abstract/Free Full Text]

Arase H., Arase N., Ogasawara K., Good R. & Onoe K.. An NK1.1⁺ CD4⁺CD8^– single-positive thymocyte subpopulation that expresses a highly skewed T-cell antigen receptor Vβ family, Proc. Natl. Acad. Sci. USA., 89, 1992, 6506–6510.[Abstract/Free Full Text]

Bendelac A., Hunziker R. & Lantz O.. Increased interleukin 4 and immunoglobulin E production in transgenic mice overexpressing NK1 T cells, J. Exp. Med., 184, 1996, 1285–1293.[Abstract/Free Full Text]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Facebook

Reddit

Technorati

Twitter

This Article Abstract Full Text (PDF, 157K) PPT slides of all figures Alert me when this article is cited Citation Map Services Email this article Similar articles in this journal Similar articles in PubMed Alert me to new content in the JEM Download to citation manager Citing Articles Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Degermann, S. Articles by Karjalainen, K. Search for Related Content PubMed PubMed Citation Articles by Degermann, S. Articles by Karjalainen, K. Pubmed/NCBI databases Gene Social Bookmarking                            What's this?