|
||
Original Article |
Production in Human T Lymphocytes
t2sakane{at}marianna-u.ac.jp
| Abstract |
|---|
|
|
|---|
producing potential. Txk transfection of Jurkat T cells resulted in a several-fold increase of IFN-
mRNA expression and protein production; interleukin (IL)-2 and IL-4 production were unaffected. Antisense oligodeoxynucleotide of Txk specifically inhibited IFN-
production of normal peripheral blood lymphocytes, antigen-specific Th1 clones, and Th0 clones; IL-2 and IL-4 production by the T cells was unaffected. Txk cotransfection led to the enhanced luciferase activity of plasmid (p)IFN-
promoter/enhancer (pIFN-
[-538])-luciferase–transfected Jurkat cells upon mitogen activation. Txk transfection did not affect IL-2 and IL-4 promoter activities. Thus, Txk specifically upregulates IFN-
gene transcription. In fact, Txk translocated from cytoplasm into nuclei upon activation and transfection with a mutant Txk expression plasmid that lacked a nuclear localization signal sequence did not enhance IFN-
production by the cells, indicating that nuclear localization of Txk is obligatory for the enhanced IFN-
production. In addition, IL-12 treatment of peripheral blood CD4+ T cells enhanced the Txk expression, whereas IL-4 treatment completely inhibited it. These results indicate that Txk expression is intimately associated with development of Th1/Th0 cells and is significantly involved in the IFN-
production by the cells through Th1 cell–specific positive transcriptional regulation of the IFN-
gene.
Key Words: Txk gene transcription T helper 1/T helper 2 cells human interferon 
Thelper type 1 cells are characterized by their secretion of IFN-
The Tec family has emerged recently as a subfamily of nonreceptor tyrosine kinases and consists of Tec, Btk, Itk/Tsk/Emt, Bmx, and Txk/Rlk 10111213141516171819202122232425. Because many members of this family have been shown to be activated in response to growth and differentiation stimuli in hematopoietic tissues, they are presumed to function in vivo as important signaling mediators 17; indeed, mutations in Btk cause agammaglobulinemia in humans 1825.
Information concerning roles of Txk in human T lymphocyte function is limited. Txk displays highly cell type–specific expression largely restricted to T cells and some mast cell and myeloid cell lines 101117. Txk has src homology (SH)21 and SH3 domains and a nuclear localization signal sequence but lacks a pleckstrin homology domain 10111217. The NH2 terminus of Txk in humans and that of Rlk, a mouse homologue of human Txk, possess an unusual cysteine-rich string, suggesting that Txk/Rlk functions in a manner that differs from the other pleckstrin homology domain–containing Tec family kinases 10111217. More recently, Schneider et al. reported that Rlk is capable of phosphorylating CTL-associated antigen (CTLA)-4, suggesting that Rlk may participate in CTLA-4 function 15.
The finding that mouse Rlk is expressed on Th1 but not Th2 cells 10 prompted us to study the role of Txk in Th1 responses in humans. In this study, we found that Txk expression is restricted to Th1/Th0 cells and that Txk is involved in the regulation of Th1 cytokine production by human T lymphocytes.
Purification of CD3+, CD4+CD3+, and CD8+CD3+ T Cells.
Construction of Wild-Type and Mutant Txk Expression Vectors.
The Txk mutant was created using the QuickChange site-directed mutagenesis kit (Stratagene Inc.). In brief, pME18S-Txk was used as a template. The primers containing the desired mutation were employed for PCR amplification using PfuTurbo DNA polymerase (Stratagene Inc.). The amplification cycle consisted of 1 cycle of denaturation (95°C) for 1 min, followed by 18 cycles of denaturation (95°C) for 30 s, annealing for 1 min (55°C), and polymerization for 10 min (68°C). After PCR cycling, the PCR product was treated with DpnI, which is specific for methylated and hemimethylated DNA, and the synthesized nonmethylated DNA containing the desired mutation was recovered. The resultant mutant vector was used for transformation of Escherichia coli DH5
A part of the hypothetical nuclear localization sequence of Txk, KRKP, was deleted from the wild-type Txk, and the rest of Txk cDNA was kept intact 161729. The primers used for constructing the deletion mutant were as follows: KRKP-deletion, 5'-CGGGCCGTGTGCAGCCGTCACTGCCTCCCCTCCCACCCTC-3' and 5'-GAGGGTGGGAGGGGAGGCAGTGACGGCTGCACACGGCCCG-3'. Fidelity of all the constructs was confirmed by DNA sequencing.
Transfection into Cell Lines and Luciferase Assay.
pIL-2(-568)-luciferase (provided by Dr. C.B. Wilson) with pRSV-CAT and pIL-4(-265)-CAT (provided by Dr. S.N. Georas, Johns Hopkins University, Baltimore, MD) with pGL-3 control vector (SV-40 promoter; Promega Corp.) were similarly transfected. 48 h after transfection, the Jurkat cells were stimulated with PHA plus PMA for 8 h. Thereafter, luciferase assay and CAT-ELISA (Roche Diagnostics) of the cells were carried out 30.
Antibodies.
Immunofluorescence Staining of Intracytoplasmic Proteins.
Immunocytochemical Staining.
Reverse Transcription–PCR Analysis.
Antisense Oligodeoxynucleotide and Cell Culture.
and induce macrophage cytotoxicity, delayed-type hypersensitivity, and enhanced cellular immunity 123. It has been suggested that cytokines and their receptors, transcription factors, MHC determinants, Ag peptides, and costimulatory signals are important for Th1 and Th2 cell differentiation 123456789. However, to date, the precise mechanism responsible for the differentiation and development of polarized Th1 responses has not been fully clarified in humans.
![]()
Materials and Methods
Top
Abstract
Materials and Methods
Results and Discussion
References
Establishment of Ag-specific T Cell Clones and Cytokine Production.
House dust mite–specific, Japanese cedar pollen Cryptomeria japonica 1–specific, and purified protein derivatives of tuberculosis (PPD)-specific T cell clones were established by a standard procedure using limiting dilution technique 26. All of the clones expressed TCR-
/β, CD3, CD4, and CD45RO but were negative for CD8. To induce cytokine production, the clones were stimulated with the relevant Ag plus irradiated autologous PBMCs and, in some experiments, irradiated autologous purified monocytes as APCs for 18–24 h. IL-2 (BioSource International), IL-4 (R & D Systems, Inc.), and IFN-
(BioSource International) levels of culture supernatants were measured using ELISA kits. We assigned Th0, Th1, and Th2 as follows 26: Th1 clones that produce IFN-
and undetectable IL-4 (<10 pg/ml); Th2 clones that produce IL-4 and undetectable IFN-
(<10 pg/ml); and Th0 clones that produce both IL-4 and IFN-
.
PBMCs were separated into sheep red blood cell (SRBC)-rosetted cells and unrosetted cells. CD3+ T cells were purified from SRBC-rosetted cells by magnetic bead depletion (MBD) of CD11a, CD14, CD19, and CD56 cells 27. CD4+CD3+ and CD8+CD3+ T cell subsets were similarly purified by the MBD technique. The resulting cell populations were always >97% pure for cells of the relevant phenotype.
Human Txk cDNA in
phage was provided by Dr. G.W. Litman (University of South Florida, St. Petersburg, FL) 11. Full length Txk cDNA was amplified by PCR using a sense primer (CGGAATTCATGATCCTTTCCTCCTATAACA) and an antisense primer (TTCTCTAGATCACCAGGTTTCCGCAATCTC), and the product was ligated into a mammalian expression vector, pME18S (SR-
promoter; provided by Dr. K. Maruyama, Tokyo Medical and Dental University, Tokyo, Japan) 28. The vector pME18S-Txk carries the full length wild-type human Txk cDNA.
.
Purified plasmids were transfected into Jurkat and Raji cells by electroporation as described 28. After a 48-h incubation, cells were collected, counted, and stimulated with PHA (1 µg/ml) plus PMA (10 ng/ml) or PMA (10 ng/ml) plus ionomycin (1 µg/ml) for 24 h to induce lymphokine production. 5 µg of plasmid (p)IFN-
(-538)-luciferase (provided by Dr. C.B. Wilson, University of Washington, Seattle, WA), 5 µg pRSV (Rous sarcoma virus)–chloramphenicol acetyl transferase (CAT), and 10 µg of pME18S-Txk (Txk transfection) or pME18S (empty vector; mock transfection) was cotransfected into Jurkat cells.
Txk expression of transfected cells and normal lymphocytes was studied by immunoblotting 28, immunocytochemical staining 31, and immunofluorescence analysis using goat anti–Txk Ab (Santa Cruz Biotechnology). Fluorescence-conjugated anti–IFN-
mAb (Immunotech) was used for intracytoplasmic IFN-
staining.
Immunofluorescence staining of intracytoplasmic proteins was carried out by a modification of the method of Sander et al. 32. In brief, the cells were fixed by using 4% paraformaldehyde and permeabilized by 0.1% saponin (Sigma Chemical Co.) in PBS with 0.01 M Hepes buffer solution. Thereafter, intracytoplasmic antigens were stained with purified first Abs, biotin-conjugated second Abs, and streptavidin–fluorochrome. Thereafter, the cells were analyzed by flow cytometry. Appropriate control Abs were included to define the background immunofluorescence of the cells in this study.
T cells or T cell clones were recovered and cytospin preparations of them were made. The samples were fixed with cold acetone for 15 min and were blocked with 2% skim milk for 30 min. The samples were incubated with first Abs overnight at 4°C. All subsequent procedures were performed using an LSAB kit (DAKO JAPAN).
IFN-
mRNA expression of Jurkat cells was estimated by reverse transcription (RT)-PCR using limiting dilutions of cDNA to accurately estimate the relative amounts of mRNA expression in different samples as previously reported 31. Txk-transfected and mock-transfected Jurkat cells were cultured for 48 h and then stimulated with PHA plus PMA for 8 h. Total RNA was extracted from these cells, and was cDNA synthesized. The sequences of IFN-
, IL-4, and β-actin primers and PCR conditions were reported previously 33. For amplification of Txk cDNA, the following primers were used: Txk sense, TTGCTGTTCAGTGCAGAA; Txk antisense, GCA- CCTTCTTTAGACTCT; 475-bp product.
Sense (GGGCTACCATGAGGTTTC) and antisense (GAAACCTCATGGTAGCCC) oligodeoxynucleotides (ODNs) specific for Txk were synthesized as a sulfonylated form. Peripheral blood T cells and Ag-specific cloned T cells (106 cells/ml) were incubated in the presence of various concentrations of ODNs for several hours. Thereafter, peripheral blood T cells were stimulated with PHA (1 µg/ml) and Ag-specific cloned T cells with irradiated autologous PBMCs plus the optimal concentration of Ag 26.
![]()
Results and Discussion
Top
Abstract
Materials and Methods
Results and Discussion
References
We first studied Txk expression of various cell types. Jurkat and MOLT-4 cells (T cell lines) but not Raji (a B cell line)- nor EBV-transformed B cells expressed Txk. Both peripheral blood CD4+ and CD8+ T cells expressed Txk; peripheral blood B cells and monocytes, however, never expressed it. We next asked whether Txk expression is restricted to a certain T cell subpopulation, such as Th1 cells. Various Ag-specific T cell clones that had been cultured for 7 d after the last stimulation with irradiated autologous PBMCs plus the relevant Ags were recovered. RT-PCR analysis revealed that all 20 Th1 cell clones and all 20 Th0 clones tested expressed Txk mRNA, whereas none of the 20 Th2 clones expressed it (Fig. 1 a).
|
producing potential (Fig. 1, a and b). However, Th2 clones, regardless of Ag specificity or the donor, did not express Txk at all (Fig. 1, a and b). Thus, there is an intimate association between Txk expression and Th1/Th0 clones with IFN-
producing potential.
We next studied the effects of Txk overexpression on cytokine production by T cells. To this end, Jurkat cells were transfected with pME18S-Txk. We used Jurkat cells in these experiments because they produce relatively low levels of Th1 cytokines upon mitogen activation. Overexpression of Txk by the transfection was confirmed by immunoblotting with anti-Txk Ab (Fig. 2 a). In parallel experiments, Jurkat cells were stimulated with PHA plus PMA. When we used ELISA to detect cytokine secretion, Txk transfection resulted in several-fold more IFN-
production as compared with the mock transfection (Fig. 2 b). We also confirmed that Txk transfection of Jurkat cells enhances IFN-
production by using an IFN-
–specific ELISpot assay (data not shown).
|
staining of the Jurkat cells was carried out. As shown in Fig. 2 c, Txk transfection of Jurkat cells led to a several-fold increase of intracytoplasmic IFN-
–positive cells; in mock-transfected Jurkat cells stimulated with PHA plus PMA, 13% were intracytoplasmic IFN-
–positive cells; in Txk-transfected Jurkat cells stimulated with PHA plus PMA, 36% were intracytoplasmic IFN-
–positive cells (Fig. 2 c). Txk transfection did not affect IL-2 production of the Jurkat cells (Fig. 2 b). Txk-transfected and mock-transfected Jurkat cells did not produce detectable levels of IL-4 upon stimulation (Fig. 2 b). Txk transfection of Raji cells did not induce IFN-
, IL-2, or IL-4 production, even upon stimulation with PMA plus ionomycin (Fig. 2 b). These results suggest that Txk has a key role in IFN-
production by T cells.
We next studied the IFN-
mRNA expression of the Jurkat cells. Txk transfection led to enhanced IFN-
mRNA expression by the Jurkat cells as compared with the mock transfection (Fig. 2 d). We also examined whether Txk transfection positively affects IFN-
gene transcription by enhancing IFN-
promoter/enhancer activity. To this end, we cotransfected pIFN-
(-538)-luciferase and pME18S-Txk into Jurkat cells. We found that Txk transfection induced several-fold more luciferase activity in the cells than the mock (pIFN-
[-538]-luciferase and pME18S)-transfected cells (Fig. 2 e). As control cytokine-promoter plasmids, we used pIL-2(-568)-luciferase and pIL-4(-265)-CAT. We found that Txk transfection did not affect activities of pIL-2 promoter-luciferase– and pIL-4 promoter-CAT–transfected Jurkat cells, regardless of the presence or absence of mitogenic stimulation. The results revealed that Txk acts specifically on IFN-
promoter/enhancer (-538) and upregulates IFN-
gene transcription.
Because Txk has a hypothetical nuclear localization signal sequence 161729, we examined nuclear translocation of the Txk protein in response to activation signals. Jurkat cells were stimulated with either PHA or IL-12, and subsequent localization of Txk was assessed by immunocytochemical staining (Fig. 3 a). Unstimulated Jurkat cells showed cytoplasmic localization of Txk. Txk protein accumulated in the nuclei of Jurkat cells after treatment for 1 h with PHA. The nuclear accumulation of Txk was specific for PHA, because Txk protein remained in the cytoplasm of Jurkat cells treated with IL-12. The results suggest that Txk itself translocates into nuclei and enhances IFN-
gene transcription in T cells.
|
We measured IFN-
production of the transfected Jurkat cells in parallel experiments. We found that wild-type Txk did enhance IFN-
production, whereas nuclear localization signal sequence (KRKP)-deleted Txk did not affect IFN-
production by the transfected Jurkat cells. These results indicate that nuclear localization of Txk is obligatory for its effect on cytokine expression (Fig. 3 c).
To confirm the involvement of Txk in IFN-
production by human T cells, we tested inhibition of IFN-
production by Txk antisense ODN. Peripheral blood T lymphocytes were cultured in the presence of sense or antisense ODN corresponding to the original translation start site of Txk 16 for several hours and were then stimulated with PHA. Antisense ODN, but not sense ODN, specifically inhibited cytoplasmic expression of Txk (Fig. 4 a); IFN-
production of T cells was specifically inhibited by the antisense ODN (Fig. 4 b). IL-2 and IL-4 production were not modulated by either the sense or antisense ODNs (Fig. 4 b). To further confirm that Txk antisense ODN inhibits IFN-
production, Ag-specific T cell clones were cultured with ODNs and then stimulated with Ag plus irradiated autologous PBMCs. Again, IFN-
production by the Ag-specific Th1 and Th0 clones (Fig. 4 c), but not IL-4 production by the Ag-specific Th0 (Fig. 4 c) and Th2 clones (data not shown) was inhibited by the Txk antisense ODN.
|
production via Txk.
|
production in T cells.
In summary, Txk expression is restricted to Th1/Th0 cells with IFN-
producing potential and is significantly involved in IFN-
gene transcription and subsequent IFN-
protein production in human T cells.
We believe that this is the first description of Txk involvement in IFN-
production by human Th1 cells. More recently, we have found that Txk is phosphorylated and translocates into nuclei upon activation, and Txk or a protein complex including Txk binds to the IFN-
promoter sequence (Nagafuchi, H., N. Suzuki, and T. Sakane, unpublished observation). Thus, we are currently investigating whether Txk itself or a protein complex including Txk acts as a Th1 cell–specific transcription factor for the IFN-
gene.
| Acknowledgments |
|---|
Submitted: 5 May 1999
Revised: 19 July 1999
Accepted: 20 July 1999
| References |
|---|
|
|
|---|
Mosmann T.R. & Coffman R.L.. TH1 and TH2 cellsdifferent patterns of lymphokine secretion lead to different functional properties, Annu. Rev. Immunol., 7, 1989, 145–173.[Medline]
Seder R.A. & Paul W.E.. Acquisition of lymphokine-producing phenotype by CD4+ T cells, Annu. Rev. Immunol., 12, 1994, 635–673.[Medline]
Gately M.K., Renzetti L.M., Magram J., Stern A.S., Adorini L., Gubler U. & Presky D.H.. The interleukin-12/interleukin-12-receptor systemrole in normal and pathologic immune responses, Annu. Rev. Immunol., 16, 1998, 495–521.[Medline]
Ouyang W., Ranganath S.H., Weindel K., Bhattacharya D., Murphy T.L., Sha W.C. & Murphy K.M.. Inhibition of Th1 development mediated by GATA-3 through an IL-4-independent mechanism, Immunity., 9, 1998, 745–755.[Medline]
Li-Weber M., Salgame P., Hu C., Davydov I.V., Laur O., Klevenz S. & Krammer P.H.. Th2-specific protein/DNA interactions at the proximal nuclear factor-AT site contribute to the functional activity of the human IL-4 promoter, J. Immunol., 161, 1998, 1380–1389.
Scala E., Carbonari M., Del Porto P., Cibati M., Tedesco T., Mazzone A.M., Paganelli R. & Fiorilli M.. Lymphocyte activation gene-3 (LAG-3) expression and IFN-
production are variably coregulated in different human T lymphocyte subpopulations, J. Immunol., 161, 1998, 489–493.
Murray J.S.. How the MHC selects Th1/Th2 immunity, Immunol. Today., 19, 1998, 157–163.[Medline]
Moriggl R., Kristofic C., Kinzel B., Volarevic S., Groner B. & Brinkmann V.. Activation of STAT proteins and cytokine genes in human Th1 and Th2 cells generated in the absence of IL-12 and IL-4, J. Immunol., 160, 1998, 3385–3392.
Gollob J.A., Murphy E.A., Mahajan S., Schnipper C.P., Ritz J. & Frank D.A.. Altered interleukin-12 responsiveness in Th1 and Th2 cells is associated with the differential activation of STAT5 and STAT1, Blood., 91, 1998, 1341–1354.
Hu Q., Davidson D., Schwartzberg P.L., Macchiarini F., Lenardo M.J., Bluestone J.A. & Matis L.A.. Identification of Rlk, a novel protein tyrosine kinase with predominant expression in the T cell lineage, J. Biol. Chem., 270, 1995, 1928–1934.
Haire R.N., Ohta Y., Lewis J.E., Fu S.M., Kroisel P. & Litman G.W.. TXK, a novel human tyrosine kinase expressed in T cells shares sequence identity with Tec family kinases and maps to 4p12, Hum. Mol. Genet., 3, 1994, 897–901.
Sommers C.L., Huang K., Shores E.W., Grinberg A., Charlick D.A., Kozak C.A. & Love P.E.. Murine txka protein tyrosine kinase gene regulated by T cell activation, Oncogene., 11, 1995, 245–251.[Medline]
Ohta Y., Haire R.N., Amemiya C.T., Litman R.T., Trager T., Riess O. & Litman G.W.. Human Txkgenomic organization, structure and contiguous physical linkage with the Tec gene, Oncogene., 12, 1996, 937–942.[Medline]
Ellis J.H., Sutmuller R.P., Sims M.J. & Cooksley S.. Functional analysis of the T-cell-restricted protein tyrosine kinase Txk, Biochem. J., 335, 1998, 277–284.[Medline]
Schneider H., Schwartzberg P.L. & Rudd C.E.. Resting lymphocyte kinase (Rlk/Txk) phosphorylates the YVKM motif and regulates PI 3-kinase binding to T-cell antigen CTLA-4, Biochem. Biophys. Res. Commun., 252, 1998, 14–19.[Medline]
Debnath J., Chamorro M., Czar M.J., Schaeffer E.M., Lenardo M.J., Varmus H.E. & Schwartzberg P.L.. rlk/TXK encodes two forms of a novel cysteine string tyrosine kinase activated by Src family kinases, Mol. Cell. Biol., 19, 1999, 1498–1507.
Mano H.. The Tec family protein-tyrosine kinasesa subset of kinases for a subset of signalings, Int. J. Hematol., 69, 1999, 6–12.[Medline]
Vetrie D., Vorechovsky I., Sideras P., Holland J., Davies A., Flinter F., Hammarstrom L., Kinnon C., Levinsky R. & Bobrow M.. The gene involved in X-linked agammaglobulinaemia is a member of the src family of protein-tyrosine kinases, Nature., 361, 1993, 226–233.[Medline]
Siliciano J.D., Morrow T.A. & Desiderio S.V.. itk, a T-cell-specific tyrosine kinase gene inducible by interleukin 2, Proc. Natl. Acad. Sci. USA., 89, 1992, 11194–11198.
Tamagnone L., Lahtinen I., Mustonen T., Virtaneva K., Francis F., Muscatelli F., Alitalo R., Smith C.I., Larsson C. & Alitalo K.. BMX, a novel nonreceptor tyrosine kinase gene of the BTK/ITK/TEC/TXK family located in chromosome Xp22.2, Oncogene., 9, 1994, 3683–3688.[Medline]
Salim K., Bottomley M.J., Querfurth E., Zvelebil M.J., Gout I., Scaife R., Margolis R.L., Gigg R., Smith C.I. & Driscoll P.C.. Distinct specificity in the recognition of phosphoinositides by the pleckstrin homology domains of dynamin and Bruton's tyrosine kinase, EMBO (Eur. Mol. Biol. Organ.) J., 15, 1996, 6241–6250.[Medline]
August A., Sadra A., Dupont B. & Hanafusa H.. Src-induced activation of inducible T cell kinase (ITK) requires phosphatidylinositol 3-kinase activity and the pleckstrin homology domain of inducible T cell kinase, Proc. Natl. Acad. Sci. USA., 94, 1997, 11227–11232.
Li T., Tsukada S., Satterthwaite A., Havlik M.H., Park H., Takatsu K. & Witte O.N.. Activation of Bruton's tyrosine kinase (BTK) by a point mutation in its pleckstrin homology (PH) domain, Immunity., 2, 1995, 451–460.[Medline]
Andreotti A.H., Bunnell S.C., Feng S., Berg L.J. & Schreiber S.L.. Regulatory intramolecular association in a tyrosine kinase of the Tec family, Nature., 385, 1997, 93–97.[Medline]
Tsukada S., Saffran D.C., Rawlings D.J., Parolini O., Allen R.C., Klisak I., Sparkes R.S., Kubagawa H., Mohandas T. & Quan S.. Deficient expression of a B cell cytoplasmic tyrosine kinase in human X-linked agammaglobulinemia, Cell., 72, 1993, 279–290.[Medline]
Kaneko S., Suzuki N., Koizumi H., Yamamoto S. & Sakane T.. Rescue by cytokines of apoptotic cell death induced by IL-2 deprivation of human antigen specific T cell clones, Clin. Exp. Immunol., 109, 1997, 185–193.[Medline]
Yamashita N., Kaneoka H., Kaneko S., Takeno M., Oneda K., Koizumi H., Kogure M., Inaba G. & Sakane T.. Role of 
T lymphocytes in the development of Behçet's disease, Clin. Exp. Immunol., 107, 1997, 241–247.[Medline]
Suzuki N., Ichino M., Mihara S., Kaneko S. & Sakane T.. Inhibition of Fas/Fas ligand-mediated apoptotic cell death of lymphocytes in vitro by circulating anti-Fas ligand autoantibodies in patients with systemic lupus erythematosus, Arthritis Rheum., 41, 1998, 344–353.[Medline]
Robbins J., Dilworth S.M., Laskey R.A. & Dingwall C.. Two interdependent basic domains in nucleoplasmin nuclear targeting sequenceidentification of a class of bipartite nuclear targeting sequence, Cell., 64, 1991, 615–623.[Medline]
Penix L., Weaver W.M., Pang Y., Young H.A. & Wilson C.B.. Two essential regulatory elements in the human interferon
promoter confer activation specific expression in T cells, J. Exp. Med., 178, 1993, 1483–1496.
Takeba Y., Suzuki N., Takeno M., Asai T., Tsuboi S., Hoshino T. & Sakane T.. Modulation of synovial cell function by somatostatin in patients with rheumatoid arthritis, Arthritis Rheum., 40, 1997, 2128–2138.[Medline]
Sander B., Andersson J. & Andersson U.. Assessment of cytokines by immunofluorescence and the paraformaldehyde-saponin procedure, Immunol. Rev., 119, 1991, 65–93.[Medline]
Brenner C.A., Tam A.W., Nelson P.A., Engleman E.G., Suzuki N., Fry K.E. & Larrick J.W.. Message amplification phenotyping (MAPPing)a technique to simultaneously measure multiple mRNAs from small numbers of cells, Biotechniques., 7, 1989, 1096–1103.[Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|