|
||
Original Article |
lgabriele{at}atlas.niaid.nih.gov
| Abstract |
|---|
|
|
|---|
Key Words: apoptosis caspase chronic myelogenous leukemia interferon interferon consensus sequence–binding protein
Interferon consensus sequence–binding protein (ICSBP)1 is a transcription factor of the IFN regulatory factor (IRF) family 1. Members of the family—IRF-1, -2, -3, -4, -6, -7, IFN-stimulated gene factor (ISGF)3
ICSBP was originally identified as a transcription factor that, similar to IRF-2, acts as a repressor and inhibits IFN-inducible promoter activities 8. Many attempts have been made to establish its contributions to IFN signaling, with recent studies revealing complex roles for this factor in immunity, cell cycle regulation, and hematopoiesis 910. Evidence that IRF family proteins play important roles in the growth of hematopoietic cells is seen in mice with null mutations of IRF-1 and IRF-2 11, which are generally expressed, as well as IRF-4 (also called PIP or LSIRF) and ICSBP, which are almost exclusively expressed in hematopoietic cells 12. IRF-1–/– mice have developmental defects in thymocytes and CD8+ T cell differentiation, whereas IRF-2–/– mice exhibit abnormalities of bone marrow hematopoiesis and B cell development 11. IRF-4–/– mice exhibit profound alterations of the function and homeostasis of both mature B and T cells 12. ICSBP–/– mice are characterized by altered hematopoiesis that manifests as a syndrome similar to human chronic myelogenous leukemia (CML; reference 10). The most prominent early features of this disorder are marked expansions of the granulocytic, monocytic, and, to a lesser extent, lymphoid lineages. Older mice experience a transition from this chronic phase of disease to a clonal, malignant blast crisis 10. A striking clinical counterpart to myeloid malignancies of ICSBP–/– mice comes from the observation that ICSBP transcripts are greatly decreased in cells of patients with CML 13.
Human CML is a complex disorder, with enhanced proliferation of granulocyte precursors and reduced sensitivity of myeloid cells to apoptosis suggested as contributing factors. A role for IRF family members in regulating cell death has precedent in the demonstration that DNA damage–induced apoptosis of peripheral T cells is dependent on IRF-1 14. Here we show that myeloid cells of ICSBP–/– mice have increased resistance to apoptosis, and transfected cells overexpressing ICSBP have increased sensitivity.
Cell Cultures.
For proliferative responses, single-cell preparations from spleen, lymph node, and bone marrow were cultured in 96-well plates at 2 x 105 cells/ml for 24–72 h. Cells were pulsed with [3H]thymidine for the last 18 h of culture and assayed for incorporation.
Induction of Apoptosis.
U937+ and U937– transfectants were washed and cultured for 24 h at a concentration of 3 x 105 cells/ml in serum-free RPMI 1640 medium supplemented with 500 U/liter insulin (Eli Lilly and Co.) and 5 mg/liter transferrin (GIBCO BRL). Cells were treated with 20 µg/ml etoposide or 30 ng/ml TNF-
TUNEL Assay.
Flow Cytometric Analysis and DNA Labeling.
Reverse Transcriptase PCR.
, v-IRF, and ICSBP—are structurally related, bind to the IFN-stimulated response element (ISRE), and regulate expression of genes stimulated by type I IFN (IFN-
/β) 2345. Type II IFN (IFN-
), on the other hand, stimulates transcription of genes through the IFN-
activation site (GAS) element that binds the signal transducer and activator of transcription (STAT)1, a member of the STAT transcription factor family 56. A number of IFN-responsive genes are stimulated by both types of IFN, as there is extensive overlap of the two transcription pathways 7.
![]()
Materials and Methods
Top
Abstract
Materials and Methods
Results
Discussion
References
Mice.
ICSBP mutant mice were generated as described 10. Homozygous mutant (–/–) and wild-type (+/+) mice on a (C57BL/6 x 129/Sv) F2 background were bred and maintained under specific pathogen-free conditions.
Single-cell suspensions from spleens, bone marrow, and thymi of wild-type and knockout mice were prepared and resuspended in RPMI 1640 medium (Quality Biological, Inc.) containing 10% FCS, 15 mM glutamine, 100 U/ml penicillin/streptomycin, nonessential amino acids (GIBCO BRL or Biofluid, Inc.), and 50 µM 2-ME. For studies of apoptosis, cells at a concentration of 106 cells/ml were incubated as 1-ml triplicate aliquots in 24-well plates. U937 human monocytic cells were stably transfected by electroporation with full length ICSBP (U937+) or empty vector (pcxn2; U937–) as previously described 15. Transfectants were maintained in RPMI 1640 medium supplemented with 10% FCS, 2 mM glutamine, 100 U/ml penicillin/streptomycin, and 200 µg/ml G418 (all from GIBCO BRL). Cells were harvested during exponential growth.
Single-cell suspensions from spleens, bone marrow, and thymi of ICSBP–/– mice and ICSBP+/+ littermates were isolated and cultured with 10 µg/ml etoposide (Sigma Chemical Co.) or 30 ng/ml TNF-
(R & D Systems, Inc.) plus 10 µg/ml cycloheximide (CHX; Sigma Chemical Co.). After 18 h, cells were stained and TUNEL (TdT-mediated dUTP-biotin nick-end labeling) assay and flow cytometric analyses were performed.
plus 10 µg/ml CHX, incubated for 18 h, and then harvested and assayed for apoptosis. In some experiments, transfectants were treated with 1 µg/ml LPS (Sigma Chemical Co.) for 4 h and then with 2 mg/ml ATP (Sigma Chemical Co.) for 30 min, incubated for 6 h, and then harvested and assayed for apoptosis. For protease inhibition experiments, cysteine protease inhibitors ZVAD-fluoromethyl ketone (FMK), BD-FMK, and the control ZFA-FMK reagent (provided by Dr. P.A. Henkart, National Cancer Institute, Bethesda, MD) were added at a concentration of 50 µM 1 h before induction of apoptosis.
The presence of DNA nicking in apoptotic cells was assayed, with minor modifications, according to Gorczyca et al. 16. In brief, cell samples were collected and fixed in 1% formaldehyde in PBS on ice, washed once with PBS, resuspended in cold 70% ethanol in PBS, and stored at –20°C. After rehydration, cells were resuspended in cacodylate buffer, 25 mM CoCl2, and 0.5 nM biotin-dUTP in the presence or absence of 10 U TdT enzyme (Boehringer Mannheim Biochemicals) and incubated at 37°C. After washing in PBS, cells were resuspended in saline citrate buffer containing 4x SSC, 2.5 µg/ml FITC–avidin (Boehringer Mannheim Biochemicals), 0.1% Triton X-100 (Sigma Chemical Co.), and 5% nonfat dry milk. After a 30-min incubation in the dark, cells were washed in PBS with 0.1% Triton X-100 and 0.5% BSA and resuspended in Sorter medium (Quality Biological, Inc.). dUTP incorporation by individual cells was measured by green fluorescence on a FACScanTM flow cytometer using CellquestTM data software (Becton Dickinson).
Cells were stained with FITC-labeled Abs, including those to CD4, CD8, B220, Mac-1, and 8C5 (GR-1; all from PharMingen). In brief, cells were resuspended in 100 µl PBS containing 2% FCS and incubated with various mAbs (1 µg/ml) for 20 min. After one wash with PBS, cells were stained for TUNEL assay. Analysis was performed on a FACScanTM flow cytometer.
mRNA was isolated using RNAzol (Tel-Test) followed by extraction with chloroform and isopropanol. 1 µg of RNA was transcribed using MMLV-H(–) reverse transcriptase (RT; Promega Corp.) and then amplified by PCR using primers described in Table under the following conditions: 1x reaction buffer (Promega Corp.), 2.5 mM MgCl2, 2.5 mM dNTP, 5 µM of each primer, and 1 U of Taq DNA polymerase (Promega Corp.) in a total volume of 40 µl. Amplification was carried out through 30 cycles. PCR products were separated on 1.2% agarose gels and analyzed by Southern blot hybridization with FITC-labeled probes using an ECL-3' oligolabeling and detection system and Hyperfilm-ECL (Amersham International).
|
Transient Transfection and Luciferase Assay.
Primers corresponding to the human Bcl-XL promoter at positions 77–101 (AAGTCAGATTGCAGATCTGAGGCAG) and positions 745–769 (GAATTCACTTCATAGAACCTTGGAT) as previously reported (17; sequence available from EMBL/GenBank/DDBJ under accession number D30746) were used in a genomic PCR reaction to obtain the Bcl-XL promoter region. The PCR product was cloned into a basic pGL3 luciferase vector (Promega Corp.) cut with SacI and HindIII. The resulting plasmid was prepared by the CsCl gradient method as previously reported 18 and used for transient transfection assays. RAW cells, a mouse macrophage tumor line, were transfected by electroporation using the Cell-Porator (GIBCO BRL). In brief, up to 30 µg of plasmid DNA was mixed with 1.0 x 107 cells/ml and resuspended in 0.4 ml of fresh complete RPMI 1640 medium containing 10% FCS. The cell/DNA mixture was then incubated on ice for 10 min before electrical shock at 300 mV and 800 µF. Cells were then transferred into 10 ml of fresh medium and left at room temperature for 10 min before incubation at 37°C. 24 h after transfection, luciferase assays were performed as reported 19.
| Results |
|---|
|
|
|---|
|
|
plus CHX. No differences in responsiveness were noted for cells of any phenotype for either genotype (Fig. 2). These findings indicate that ICSBP selectively affects distinct pathways leading to apoptosis of myeloid cells: induction by etoposide is clearly modulated by ICSBP, whereas the pathway activated by TNF-
plus CHX is not.
Apoptosis Is Enhanced in U937 Cells Overexpressing ICSBP.
A full length ICSBP construct was stably transfected into U937 human monocytic cells (U937+), resulting in levels of ICSBP proteins that were
10–30-fold higher than endogenous ICSBP 15. Transfectants containing the vector without insert (U937–) were used as controls. For these studies, three clones of each transfectant were selected and pooled. Using the TUNEL assay for detection of DNA strand breaks, we examined apoptosis of both cell populations cultured in serum-free medium supplemented with insulin and transferrin. During the first 18 h of culture, neither U937+ nor U937– cells showed clear evidence of apoptosis, but prominent differences were seen at 38 and 68 h (Fig. 3), indicating a proapoptotic role for ICSBP in myeloid cells.
|
plus CHX at the same levels in U937– and U937+ cells (data not shown), suggesting again that ICSBP is involved only in specific pathways of programmed cell death. A moderately enhanced sensitivity to apoptosis was also observed in U937+ cells after treatment with LPS plus ATP. It was shown previously that ATP treatment leads to apoptosis via a caspase-1–independent pathway 29. We found that treatment with LPS for 4 h and then with ATP for 30 min induced apoptosis in 60% of U937+ cells but only 45% of U937– cells (Fig. 4). Moreover, U937+ cells were significantly more sensitive to rapamycin, a potent immunosuppressive drug that has been shown to interfere with growth factor–induced cell proliferation and induce apoptosis in a murine B cell line 30 (data not shown). Although to date there is no direct evidence for the involvement of ICSBP in cell growth pathways, our results clearly show that ICSBP plays a role in the apoptotic response of U937 cells to specific death-inducing signals and confirm that ICSBP itself might contribute to spontaneous and DNA damage–induced apoptosis in this system.
|
|
|
We next examined the expression of caspase-3 precursor protein. The most striking finding was markedly increased levels of the precursor in U937+ cells. After treatment with etoposide, the precursor was processed to generate a lower-molecular-mass fragment, reflecting induction of apoptosis. Although our previous results showed that expression of caspase-3 mRNA was not altered in ICSBP clones, Western blot analysis revealed a markedly enhanced expression of caspase-3 protein. These data suggest that ICSBP might control caspase-3 activity through modulation of translation or protein stability rather than transcription. In light of enhanced caspase-1 mRNA expression in U937+ cells, it was of interest to determine whether caspase-1 protein expression was also affected. We found the 45-kD precursor of caspase-1 was slightly overexpressed in U937+ cells. Because U937+ cells show enhanced sensitivity to apoptosis induced by ATP via a caspase-1–independent pathway 29, these new findings suggest that increased expression of caspase-1 is unlikely to be the basis for this phenotype. It thus seems that caspase-3 plays a major role in cell death signaling pathways controlled by ICSBP.
Bcl-XL Expression Is Reduced in U937+ Cells.
We next asked whether ISRE-binding activities could control expression of antiapoptotic genes. Using semiquantitative RT-PCR analysis, we examined expression of members of the Bcl-2 family, including Bcl-XL, Bcl-2, and Mcl-1 37, as well as the proapoptotic gene, Bax 38. Bcl-XL transcripts were decreased by
50% in U937+ cells (Fig. 7 A), whereas the levels of Bcl-2, Mcl-1, and Bax transcripts were comparable (data not shown). Treatment with etoposide resulted in downregulation of Bcl-XL expression in both cell types. Because U937+ and U937– cells were equally sensitive to TNF plus CHX and U937+ cells were much more sensitive to etoposide, the importance of changes in Bcl-XL expression induced by ICSBP may contribute to changes in only some pathways of programmed cell death. The reduced levels of Bcl-XL transcripts observed in U937+ cells suggested that IFN might have a previously unappreciated role in regulating expression of this gene. We therefore examined levels of Bcl-XL protein in U937– cells stimulated with IFN-
or IFN-
. Both cytokines induced significant increases in Bcl-XL expression that were maximal at 12 h of treatment (Fig. 7 B).
|
Finally, we examined the expression of the antioncogenic transcription factor p53, which has been shown to be required to induce cell death in oncogene-expressing cells that have suffered DNA damage 39. p53 protein levels were significantly increased in U937+ cells (Fig. 8), suggesting another mechanism by which ICSBP might be involved in the induction of spontaneous apoptosis and the DNA damage response pathway.
|
| Discussion |
|---|
|
|
|---|
ICSBP has been identified as a negative transcription factor that binds to ISREs found in the promoters of type I IFNs and IFN-inducible genes 4344. Unlike IRF-1, IRF-3, and ISGF3
, ICSBP exhibits a tissue-restricted pattern of expression largely limited to cells of the immune system, particularly the monocytic and lymphoid lineages. Expression of ICSBP is constitutive and can be dramatically enhanced by IFN-
. The intrinsically weak DNA binding affinity of ICSBP 45 is dramatically increased after heterodimerization with IRF-1 or IRF-2 346. ICSBP/IRF-2 binding to DNA is constitutive, whereas ICSBP/IRF-1 DNA binding is only induced by IFN-
. Several studies implicate IRF-1 as a critical tumor suppressor, regulating oncogene-induced cell transformation or apoptosis 3947. It has been reported that IRF-1 regulates DNA damage–induced apoptosis in mitogen-activated peripheral T cells 14. IRF-1 is also required for the induction of apoptosis in fibroblasts carrying an activated c-Ha-ras gene after DNA damage or culture in low serum 39. Moreover, IRF-1 has been implicated in IFN-
–induced apoptosis of hematopoietic progenitor cells 48. Our data provide evidence that ICSBP, another member of the IRF family, can regulate apoptosis of myeloid cells.
ICSBP–/– mice exhibit expanded populations of granulocytic, monocytic, lymphoid, and perhaps megakaryocytic lineages 10, suggesting that the decisive alteration occurs in an early common progenitor cell. Our studies revealed that the sensitivity to apoptosis of Mac-1+ and GR-1+ cells from spleen and bone marrow of ICSBP–/– mice was significantly reduced. Expression of these markers is different in myeloid subpopulations; granulocytes are GR-1+Mac-1+ or GR-1+Mac-1–, and macrophages are GR-1–Mac-1+ 49, indicating that both macrophages and granulocytes from ICSBP–/– mice exhibited impaired programmed cell death. In contrast, the rate of apoptosis was comparable in T and B cells from +/+ or –/– mice, suggesting a specific role for ICSBP in apoptosis in the myeloid lineage. Analysis of apoptosis induced by etoposide confirmed the specific proapoptotic role of ICSBP in myeloid cells. GR-1+ and Mac-1+ cells from spleen and bone marrow of ICSBP–/– mice showed a significantly reduced sensitivity to apoptosis induced by this DNA-damaging agent. In contrast, etoposide-induced apoptosis of B and T cells from ICSBP–/– and wild-type mice was similar.
We also found that the proliferation index of bone marrow, spleen, and lymph node cells of ICSBP–/– mice was increased over normal. This suggests that the early accumulation of hematopoietic cells that characterizes these animals is mediated by enhanced proliferation as well as by reduced apoptosis. Studies of U937 cells overexpressing ICSBP provided strong support for the proposed role of ICSBP in regulating apoptosis in myeloid cells. ICSBP expressed at levels 10–30-fold higher than endogenous levels sensitized cells to spontaneous apoptosis and selective pathways of response to exogenous stimuli. U937+ cells exhibited greater sensitivity to apoptosis induced by DNA damage, treatment with LPS plus ATP, and inhibition of TOR/FRAP kinase by rapamycin (reference 50; data not shown), but not to treatment with TNF-
plus CHX. This suggests that apoptotic pathways initiated by engagement of death receptors leading to rapid activation of caspase cascades are insensitive to effects mediated by ICSBP, whereas other pathways are sensitive. This pattern of sensitivity and resistance to the effects of ICSBP is similar to that suggested for Bcl-2 and Bcl-XL: little or no effect on apoptosis induced by death receptor engagement but prominent regulation of apoptosis induced by growth factor withdrawal or DNA damage 515253. It is unclear whether these selective effects on apoptosis are mediated by ICSBP alone or in combination with other IRF family members. IRF-1 is an important requirement of DNA damage–induced apoptosis of peripheral T cells 14 but not myeloid cells, at least on its own, because it is expressed at normal levels in ICSBP–/– mice.
Inhibition of TOR/FRAP by rapamycin 53 leads to G1 arrest in some systems 54 and acceleration of apoptosis in others 55. The results of TOR activation—either growth arrest or apoptosis—resemble the pattern of responses to p53 activation 56. Because p53 expression is enhanced in U937+ cells, ICSBP may regulate apoptosis by acting as a rheostat to balance the activities of these bifunctional genes. Induction of apoptosis by p53 in some systems is thought to involve transcriptional induction of Bax 57. This activity is unlikely to be relevant to our system, because Bax transcripts were similar in control and U937+ cells. The importance of TOR to apoptosis could reflect its regulation by Akt, which functions in the phosphatidylinositol-3 kinase pathway to inhibit apoptosis 58. Inhibition of TOR may induce apoptosis by inactivating downstream signaling pathways that involve p70S6K kinase or 4E-BP-1 59.
Further analysis of U937+ cells revealed that ICSBP may affect expression of caspases involved in the central control and execution stages of cell death 60616263. Our results revealed that transcripts for caspase-2 and -3 were expressed at the same level in U937– and U937+ cells before and after induction of apoptosis with etoposide. In contrast, caspase-7 and, to a lesser extent, caspase-1 transcripts were increased before and after induction of apoptosis of U937+ cells with etoposide. These data show that expression of caspases belonging to distinct subfamilies is differentially regulated by ICSBP.
Our studies also revealed that caspase protein expression is specifically modulated in U937+ cells. First, activation of caspase-2 was enhanced in U937+ cells. Second, although caspase-3 transcripts were not increased in cells overexpressing ICSBP, levels of the caspase-3 precursor protein were significantly increased. Finally, caspase-1 precursor levels were higher in U937+ than in control cells before and after induction of apoptosis with etoposide. These results clearly show that increased expression of caspase-1, -3, and -7 occurred in U937+ cells in association with enhanced sensitivity to spontaneous and induced apoptosis. Although we have no direct evidence at present for the transcriptional or translational control of caspases by ICSBP, the enhanced levels of one or more could account for the priming of a cascade that leads to the effector phases of apoptosis.
Cell death is regulated by a number of genes that influence cell survival in either a positive or negative fashion. The Bcl-2 family consists of molecules that can either promote survival or augment programmed cell death 6465. The capability of type I and type II IFNs to modulate the expression of genes belonging to the Bcl-2 family is a controversial issue 6667. Recent reports revealed that IFN-
significantly inhibits eosinophil apoptosis but does not upregulate Bcl-2 expression 68. In addition, IFN-
2 is reported to inhibit the growth of myeloma cells in a manner independent of Bcl-2 and Bcl-XL expression 69. On the other hand, a recent report has shown that leukemia inhibitory factor induces Bcl-XL mRNA via a STAT1-binding cis-element in cardiac myocytes, preventing a cytoprotective effect 70. We found that U937+ cells exhibited a specific decrease in Bcl-XL transcripts. Moreover, our data show that Bcl-XL can be strongly induced by IFN-
and IFN-
. Finally, our results clearly demonstrate that a consensus ISRE present in the promoter region of Bcl-XL is sufficient to confer efficient IFN-
inducibility. Surprisingly, Bcl-2 expression was not affected in U937+ cells. These results argue for a Bcl-2–independent but Bcl-XL–dependent mechanism of apoptosis regulation by ICSBP. In our model, downregulation of Bcl-XL could promote caspase-1–dependent disruption of the mitochondrial inner transmembrane potential and the subsequent activation of caspase-3 and -7. Recently, posttranscriptional modifications of some Bcl-2 family members have been shown to regulate cell death 7172. Because Bcl-XL by itself is able to form ion channels in membranes 73 and is present in both soluble and membrane-bound forms, it would be interesting to determine whether mRNA expression, posttranscriptional modifications, and/or subcellular localization of this antiapoptotic protein represent important steps in the pathway by which IRF family members regulate cell death. Furthermore, because the functional relationship between the Bcl-2 family of apoptotic modulators and the caspases remains unresolved, our model might be useful for elucidating specific interactions between these families of proteins.
Although the precise mechanism by which ICSBP modulates expression of genes involved in apoptosis remains to be elucidated, our data argue for a specific proapoptotic activity elicited in U937 cells overexpressing ICSBP. In addition, studies of ICSBP-deficient mice strongly support the involvement of this factor as a regulator in the apoptotic pathway of myeloid cells whose leukemic transformation might follow escape from normal apoptotic controls; however, the possible relations between the myeloid disease of ICSBP mice and human CML remain to be clearly defined. We also found that the proliferative rate of bone marrow cells from ICSBP–/– mice was increased, suggesting that enhanced proliferation as well as prolonged survival may contribute to this myeloid disorder.
| Acknowledgments |
|---|
Submitted: 18 March 1999
Revised: 27 May 1999
Accepted: 7 June 1999
| References |
|---|
|
|
|---|
Nguyen H., Hiscott J. & Pitha P.M.. The growing family of interferon regulatory factors, Cytokine Growth Factor Rev, 8, 1997, 293–312.[Medline]
Moore P.S., Boshoff C., Weiss R.A. & Chang Y.. Molecular mimicry of human cytokine and cytokine response pathway genes by KSHV, Science., 274, 1996, 1739–1744.
Sharf R., Meraro D., Azriel A., Thornton A.M., Ozato K., Petricoin E.F., Larner A.C., Schaper F., Hauser H. & Levi B.Z.. Phosphorylation events modulate the ability of interferon consensus sequence binding protein to interact with interferon regulatory factors and to bind DNA, J. Biol. Chem., 272, 1997, 9785–9792.
Zhang L. & Pagano J.S.. IRF-7, a new interferon regulatory factor associated with Epstein-Barr virus latency, Mol. Cell. Biol., 17, 1997, 5748–5757.
Darnell J.E. Jr., Kerr I.M. & Stark G.R.. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins, Science., 264, 1994, 1415–1421.
Shuai K., Schindler C., Prezioso V.R. & Darnell J.E. Jr.. Activation of transcription by IFN-
tyrosine phosphorylation of a 91-kD DNA binding protein, Science., 258, 1992, 1808–1812.
Kalvakolanu D.V. & Borden E.C.. An overview of the interferon systemsignal transduction and mechanisms of action, Cancer Invest., 14, 1996, 25–53.[Medline]
Nelson N., Marks M.S., Driggers P.H. & Ozato K.. Interferon consensus sequence-binding protein, a member of the interferon regulatory factor family, suppresses interferon-induced gene transcription, Mol. Cell. Biol., 13, 1993, 588–599.
Bovolenta C., Lou J., Kanno Y., Park B.K., Thornton A.M., Coligan J.E., Scubert M. & Ozato K.. Vesicular stomatitis virus infection induces a nuclear DNA binding factor specific for the interferon-stimulated response element, J. Virol., 69, 1995, 4173–4181.
Holtschke T., Lohler J., Kanno Y., Fehr T., Giese N., Rosenbauer F., Lou J., Knobeloch K.P., Gabriele L. & Waring J.F.. Immunodeficiency and chronic myelogenous leukemia-like syndrome in mice with a targeted mutation of the ICSBP gene, Cell., 87, 1996, 307–317.[Medline]
Matsuyama T., Kimura T., Kitagawa M., Pfeffer K., Kawakami T., Watanabe N., Kundig T.M., Amakawa R., Kishihara K. & Wakeham A.. Targeted disruption of IRF-1 or IRF-2 results in abnormal type I IFN gene induction and aberrant lymphocyte development, Cell., 75, 1993, 83–97.[Medline]
Mittrucker H.W., Matsuyama T., Grossman A., Kundig T.M., Potter J., Shahinian A., Wakeham A., Patterson B., Ohashi P.S. & Mak T.W.. Requirement for the transcription factor LSIRF/IRF4 for mature B and T lymphocyte function, Science., 275, 1997, 540–543.
Schmidt M., Nagel S., Proba J., Thiede C., Ritter M., Waring J.F., Rosenbauer F., Huhn D., Wittig B. & Horak I.. Lack of interferon consensus sequence binding protein (ICSBP) transcripts in human myeloid leukemias, Blood., 91, 1998, 22–29.
Tamura T., Ishihara M., Lamphier M.S., Tanaka N., Oishi I., Aizawa S., Matsuyama T., Mak T.W., Taki S. & Taniguchi T.. An IRF-1-dependent pathway of DNA damage-induced apoptosis in mitogen-activated T lymphocytes, Nature., 376, 1995, 596–599.[Medline]
Thornton A.M., Ogryzko V.V., Dent A., Sharf R., Levi B.Z., Kanno Y., Staudt L.M., Howard B.H. & Ozato K.. A dominant negative mutant of an IFN regulatory factor family protein inhibits both type I and type II IFN-stimulated gene expression and antiproliferative activity of IFNs, J. Immunol., 157, 1996, 5145–5154.[Abstract]
Gorczyca W., Gong J. & Darzynkiewicz Z.. Detection of DNA strand breaks in individual apoptotic cells by the in situ terminal deoxynucleotidyl transferase and nick translation assays, Cancer Res., 53, 1993, 1945–1951.
Grillot D.A., Gonzalez-Garcia M., Ekhterae D., Duan L., Inohara N., Ohta S., Seldin M.F. & Nunez G.. Genomic organization, promoter region analysis, and chromosome localization of the mouse bcl-x gene, J. Immunol., 158, 1997, 4750–4757.[Abstract]
Sambrook J., Frisch E.F. & Maniatis T., Molecular Cloning, 1989, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Wang I.M., Blanco J.C., Tsai S.Y., Tsai M.J. & Ozato K.. Interferon regulatory factors and TFIIB cooperatively regulate interferon-responsive promoter activity in vivo and in vitro, Mol. Cell. Biol., 16, 1996, 6313–6324.
Bedi A., Zehnbauer B.A., Collector M.I., Barber J.P., Zicha M.S., Sharkis S.J. & Jones R.J.. BCR-ABL gene rearrangement and expression of primitive hematopoietic progenitors in chronic myeloid leukemia, Blood., 81, 1993, 2898–2902.
Emanuel P.D., Bates L.J., Castlebery R.P., Gualtieri R.J. & Zukerman K.S.. Selective hypersensitivity to granulocyte-macrophage colony-stimulating factor by juvenile chronic myeloid leukemia hematopoietic progenitors, Blood., 77, 1991, 925–929.
Bedi A., Zehnbauer B.A., Barber J.P., Sharkis S.J. & Jones R.J.. Inhibition of apoptosis by BCR-ABL in chronic myeloid leukemia, Blood., 83, 1994, 2038–2044.
Fernandes R.S., Gorman A.M., McGahon A., Lawler M., McCann S. & Cotter T.G.. The repression of apoptosis by activated abl oncogenes in chronic myelogenous leukemia, Leukemia., 2, 1996, S17–S21.
Rowan S. & Fisher D.E.. Mechanisms of apoptotic cell death, Leukemia., 11, 1997, 457–465.[Medline]
Yuan J.. Transducing signals of life and death, Curr. Opin. Cell Biol., 9, 1997, 247–251.[Medline]
Henkart P.A.. ICE family proteasesmediators of all apoptotic cell death?, Immunity., 4, 1996, 195–201.[Medline]
Noguchi K., Naito M., Kataoka S., Yonehara S. & Tsuruo T.. A recessive mutant of the U937 cell line acquired resistance to anti-Fas and anti-p55 tumor necrosis factor receptor antibody-induced apoptosis, Cell Growth Differ., 6, 1995, 1271–1277.[Abstract]
Kikuchi H., Iizuka R., Sugiyama S., Gon G., Mori H., Arai M., Mizumoto K. & Imajoh-Ohmi S.. Monocytic differentiation modulates apoptotic response to cytotoxic anti-Fas antibody and tumor necrosis factor
in human monoblast U937 cells, J. Leukoc. Biol., 60, 1996, 778–783.[Abstract]
Li P., Allen H., Banerjee S., Franklin S., Herzog L., Johnston C., McDowell J., Paskind M., Rodman L. & Salfeld J.. Mice deficient in IL-1 β-converting enzyme are defective in production of mature IL-1 β and resistant to endotoxic shock, Cell., 80, 1995, 401–411.[Medline]
Muthukkumar S., Ramesh T.M. & Bondada S.. Rapamycin, a potent immunosuppressive drug, causes programmed cell death in B lymphoma cells, Transplantation., 60, 1995, 264–270.[Medline]
Green D.R.. Apoptotic pathwaysthe roads to ruin, Cell., 94, 1998, 695–698.[Medline]
Thornberry N.A. & Lazebnik Y.. Caspasesenemies within, Science., 281, 1998, 1312–1316.
Sarin A., Wu M.L. & Henkart P.A.. Different interleukin-1β converting enzyme (ICE) family protease requirements for the apoptotic death of T lymphocytes triggered by diverse stimuli, J. Exp. Med., 184, 1996, 2445–2450.
Cerretti D.P., Kozlosky C.J., Mosley B., Nelson N., Van Ness K., Greenstreet T.A., March C.J., Kronheim S.R., Druck T. & Cannizzaro L.A.. Molecular cloning of the interleukin-1β converting enzyme, Science., 256, 1992, 97–100.
Duan H., Chinnaiyan A.M., Hudson P.L., Wing J.P., He W.W. & Dixit V.M.. ICE-LAP3, a novel mammalian homologue of the Caenorhabditis elegans cell death protein Ced-3, is activated during Fas- and tumor necrosis factor-induced apoptosis, J. Biol. Chem., 271, 1996, 1621–1625.
Wang L., Miura M., Bergeron L., Zhu H. & Yuan J.. Ich-1, an Ice/ced-3-related gene, encodes both positive and negative regulators of programmed cell death, Cell., 78, 1994, 739–750.[Medline]
Adams J.M. & Cory S.. The Bcl-2 protein familyarbiters of cell survival, Science., 281, 1998, 1322–1326.
Oltvai Z.N., Milliman C.L. & Korsmeyer S.J.. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death, Cell., 74, 1993, 609–619.[Medline]
Tanaka N., Ishihara M., Kitagawa M., Harada H., Kimura T., Matsuyama T., Lamphier M.S., Aizawa S., Mak T.W. & Taniguchi T.. Cellular commitment to oncogene-induced transformation or apoptosis is dependent on the transcription factor IRF-1, Cell., 77, 1994, 829–839.[Medline]
Cotter T.G., Fernandes R.S., Verhaegen S. & McCarthy J.V.. Cell death in the myeloid lineage, Immunol. Rev., 142, 1994, 93–112.[Medline]
Lotem J. & Sachs L.. Control of apoptosis in hematopoiesis and leukemia by cytokines, tumor suppressor and oncogenes, Leukemia., 10, 1996, 925–931.[Medline]
Ruchaud S. & Lanotte M.. cAMP and death signals in a myeloid leukaemia cellfrom membrane receptors to nuclear responses: a review, Biochem. Soc. Trans., 25, 1997, 410–415.[Medline]
Weisz A., Marx P., Sharf R., Appella E., Driggers P.H., Ozato K. & Levi B.Z.. Human interferon consensus sequence binding protein is a negative regulator of enhancer elements common to interferon-inducible genes, J. Biol. Chem., 267, 1992, 25589–25596.
Weisz A., Kirchhoff S. & Levi B.Z.. IFN consensus sequence binding protein (ICSBP) is a conditional repressor of IFN inducible promoters, Int. Immunol., 6, 1994, 1125–1131.
Driggers P.H., Ennist D.L., Gleason S.L., Mak W.H., Marks M.S., Levi B.Z., Flanagan J.R., Appella E. & Ozato K.. An interferon
-regulated protein that binds the interferon-inducible enhancer element of major histocompatibility complex class I genes, Proc. Natl. Acad. Sci. USA., 87, 1990, 3743–3747.
Bovolenta C., Driggers P.H., Marks M.S., Medin J.A., Politis A.D., Vogel S.N., Levy D.E., Sakaguchi K., Appella E. & Coligan J.E.. Molecular interactions between interferon consensus sequence binding protein and members of the interferon regulatory factor family, Proc. Natl. Acad. Sci. USA., 91, 1994, 5046–5050.
Harada H., Kitagawa M., Tanaka N., Yamamoto H., Harada K., Ishihara M. & Taniguchi T.. Anti-oncogenic and oncogenic potentials of interferon regulatory factors-1 and -2, Science., 259, 1993, 971–974.[Abstract]
Sato T., Selleri C., Young N.S. & Maciejewski J.P.. Inhibition of interferon regulatory factor-1 expression results in predominance of cell growth stimulatory effects of interferon-
due to phosphorylation of Stat1 and Stat3, Blood., 90, 1997, 4749–4758.
Hestdal K., Ruscetti F.W., Ihle J.N., Jacobsen S.E., Dubois C.M., Kopp W.C., Longo D.L. & Keller J.R.. Characterization and regulation of RB6-8C5 antigen expression on murine bone marrow cells, J. Immunol., 147, 1991, 22–28.[Abstract]
Brown E.J., Albers M.W., Shin T.B., Ichikawa K., Keith C.T., Lane W.S. & Schreiber S.L.. A mammalian protein targeted by G1-arresting rapamycin-receptor complex, Nature., 369, 1994, 756–758.[Medline]
Strasser A., Harris A.W., Huang D.C., Krammer P.H. & Cory S.. Bcl-2 and Fas/APO-1 regulate distinct pathways to lymphocyte apoptosis, EMBO (Eur. Mol. Biol. Organ.) J., 14, 1995, 6136–6147.[Medline]
Newton K., Harris A.W., Bath M.L., Smith K.G. & Strasser A.. A dominant interfering mutant of FADD/MORT1 enhances deletion of autoreactive thymocytes and inhibits proliferation of mature T lymphocytes, EMBO (Eur. Mol. Biol. Organ.) J., 17, 1998, 706–718.[Medline]
Smith K.G., Strasser A. & Vaux D.L.. Crm A expression in T lymphocytes of transgenic mice inhibits CD95(Fas/APO-1)-transduced apoptosis, but does not cause lymphadenopathy or autoimmune disease, EMBO (Eur. Mol. Biol. Organ.) J., 15, 1996, 5167–5176.[Medline]
Morice W.G., Brunn G.J., Wiederrecht G., Siekierka J.J. & Abraham R.T.. Rapamycin-induced inhibition of p34cdc2 kinase activation is associated with G1/S-phase growth arrest in T lymphocytes, J. Biol. Chem., 268, 1993, 3734–3738.
Shi Y., Frankel A., Radvanyi L.G., Penn L.Z., Miller R.G. & Mills G.B.. Rapamycin enhances apoptosis and increases sensitivity to cisplatin in vitro, Cancer Res., 55, 1995, 1982–1988.
Levine A.. p53, the cellular gatekeeper for growth and division, Cell., 88, 1997, 323–331.[Medline]
Miyashita T. & Reed J.C.. Tumor-suppressor p53 is a direct transcriptional activator of the human BAX gene, Cell., 80, 1995, 293–299.[Medline]
Kauffmann-Zeh A., Rodriguez-Viciana P., Ulrich E., Gilbert C., Coffer P., Downward J. & Evan G.. Suppression of c-Myc-induced apoptosis by ras signalling through PI(3)K and PKB, Nature., 385, 1997, 544–548.[Medline]
Brown E.J. & Schrieber S.L.. A signaling pathway to translational control, Cell., 86, 1996, 517–520.[Medline]
Rao L. & White E.. Bcl-2 and the ICE family of apoptotic regulatorsmaking a connection, Curr. Opin. Genet. Dev., 7, 1997, 52–58.[Medline]
Thornberry N.A., Rano T.A., Peterson E.P., Rasper D.M., Timkey T., Garcia-Calvo M., Houtzager V.M., Nordstrom P.A., Roy S. & Vaillancourt J.P.. A combinatorial approach defines specificities of members of the caspase family and granzyme B. Functional relationships established for key mediators of apoptosis, J. Biol. Chem., 272, 1997, 17907–17911.
Fraser A. & Evan G.. A license to kill, Cell., 85, 1996, 781–784.[Medline]
Enari M., Talanian R.V., Wong W.W. & Nagata S.. Sequential activation of ICE-like and CPP32-like proteases during Fas-mediated apoptosis, Nature., 380, 1996, 723–726.[Medline]
Jacobson M.D.. ApoptosisBcl-2-related proteins get connected, Curr. Biol., 7, 1997, R277–R281.[Medline]
Reed J.C.. Double identity for proteins of the Bcl-2 family, Nature., 387, 1997, 773–776.[Medline]
Chaouchi N., Wallon C., Taieb J., Auffredou M.T., Tertian G., Lemoine F.M., Delfraissy J.F. & Vazquez A.. Interferon-
-mediated prevention of in vitro apoptosis of chronic lymphocytic leukemia B cellsrole of bcl-2 and c-myc, Clin. Immunol. Immunopathol., 73, 1994, 197–204.[Medline]
Jewell A.P., Worman C.P., Lydyard P.M., Yong K.L., Giles F.J. & Goldstone A.H.. Interferon-
up-regulates bcl-2 expression and protects B-CLL cells from apoptosis in vitro and in vivo, Br. J. Haematol., 88, 1994, 268–274.[Medline]
Ochiai K., Kagami M., Matsumura R. & Tomioka H.. IL-5 but not interferon-
(IFN-
) inhibits eosinophil apoptosis by up-regulation of bcl-2 expression, Clin. Exp. Immunol., 107, 1997, 198–204.[Medline]
Egle A., Villunger A., Kos M., Bock G., Gruber J., Auer B. & Greil R.. Modulation of Apo-1/Fas (CD95)-induced programmed cell death in myeloma cells by interferon-
2, Eur. J. Immunol., 26, 1996, 3119–3126.[Medline]
Fujio Y., Kunisada K., Hirota H., Yamauchi-Takihara K. & Kishimoto T.. Signals through gp130 upregulate bcl-x gene expression via STAT1-binding cis-element in cardiac myocytes, J. Clin. Invest., 99, 1997, 2898–2905.[Medline]
Wang H.G., Rapp U.R. & Reed J.C.. Bcl-2 targets the protein kinase Raf-1 to mitochondria, Cell., 87, 1996, 629–638.[Medline]
Golstein P.. Controlling cell death, Science., 275, 1997, 1081–1082.
Hsu Y.T., Wolter K.G. & Youle R.J.. Cytosol-to-membrane redistribution of Bax and Bcl-X(L) during apoptosis, Proc. Natl. Acad. Sci. USA., 94, 1997, 3668–3672.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|