Transfection and Homologous Recombination in Embryonic Stem and 103/4 Cells.
E14.1 enbryonic stem (ES) cells were cultured, transfected, and selected as previously described (10). The analysis of recombinant clones before and after Cre-mediated deletion of the neo^R gene and/or of the 4-kb DNA fragment was performed by Southern blot analysis similarly for ES and 103-derived cells. The transfection protocol of the 103/4 cell line was as follows: 10⁷ cells were electroporated with 30 µg linearized DNA in 800 µl RPMI, 10 mM Hepes, pH 7.4 (300 V, 900 µF). The cells were immediately resuspended in 50 ml RPMI, 10% FCS, 0.05 mM β-ME, and subcloned in 96-well plates at 20,000 cells/well. Selection with 1.5 mg/ml hygromycin B (Boehringer Mannheim) or G418 (GIBCO BRL) was applied 48 h later. The resistant clones were then subcloned at 0.5 cells/well, grown in culture for 3 wk, and analyzed by Southern blot after expansion. Approximately 10% of each of the transfectants were targeted to the locus, but only in a fraction of them did the recombination extend over the 10 kb containing the three loxP sites and the EcoRI restriction site. In a typical experiment, 66 clones were obtained from 10⁷ cells, of which 6 were targeted to the locus and 1 contained the three loxP modifications.

Generation of Chimeric Mice.
Chimeric mice were obtained after aggregation of gene-targeted ES cells (see below) with CD-1 morulas. Analysis of ES-derived lymphoid cells took advantage of a polymorphism that frequently occurs between the CD-1 and 129 cells at the Ly5 locus.

Spleen Cell Sorting.
The anti–mouse Ly5.2-PE and Ly5.1-PE antibodies were provided by B. Rocha (INSERM, Faculté de Médicine Necker, Paris, France). Anti–mouse CD19-FITC was purchased from PharMingen. Spleen cells from chimeric mice were prepared and labeled as previously described (10), and Ly5.2⁺, CD19⁺, and CD19^– cells (50% chimerism in the spleen) were purified using a FACSVantage^® cell sorter (Becton Dickinson).

Germline Retention Analysis of DNA in Mouse Spleen Cells and in 103/bcl2-hygro^R Cells.
Genomic DNA preparation was performed as described (10). Alkaline Southern blots after digestion of genomic DNA with BamHI and hybridization with a 1.8-kb SphI-PstI random-labeled DNA fragment (probe C) encompassing the mouse J cluster were performed as previously described (10). Germline retention in control mice was carried out by PCR with the primers used in the reverse transcription (RT)-PCR detection of the long germline transcript from the wild-type allele (see below).

Quantitative PCR Analysis of Rearrangement in 103/bcl2-hygro^R Cells.
V to J₁ rearrangement products were amplified with the primers described in references 16 and 17 (our PCR parameters: 1 min at 94°C; 1.5 min at 66°C; 1.5 min at 72°C; 24 cycles). StyI and EcoRI digestions were carried out for 4 h in separate reactions to assess the percentage of rearrangement corresponding to the wild-type and mutated alleles, respectively.

RT-PCR Analysis of Germline Transcripts in 103/bcl2-hygro^R– derived Cells.
Total RNA was extracted with Trizol (GIBCO BRL) from 10⁶ cells cultured at the permissive (34°C) and the nonpermissive (40°C) temperatures for 6 and 12 h. After reverse transcription with an equimolar mixture of oligo-dT and random primers (Stratagene), cDNA was resuspended in 50 µl of water. For each sample, four different amounts of cDNA (2, 1, 0.5, and 0.25 µl) were amplified in separate reactions for each primer set described below to avoid plateau effects. For the long germline transcript, the 3' primer was AGCAATTCCCTTCACTCAAACCCCCATAC for both alleles; the 5' primers were GTCTGAAAGAGGAGTTTACGTCCAGC (hereafter referred to as loxP-5'-primer) for the mutated allele containing a loxP site (1 min 94°C; 1 min 66°C; 1.5 min 72°C; 30 cycles) and CCTATGGAAGAGCAGCGAGTGCC (hereafter referred to as wt-5'-primer) for the wild-type allele (same PCR parameters, but 27 cycles). Normalization was performed with respect to β-actin (mouse β-actin amplimer set; Clontech). The PCR products were blotted onto nylon membranes and hybridized with the oligonucleotide DAR25 (17) for the long transcript, and with AACATGGCATTGTTAC for β-actin.

Quantitation.
Southern blots and PCR hybridizations were exposed to phosphor screens, scanned with a Storm 480 machine (Molecular Dynamics), and analyzed with the public domain NIH Image program (developed at NIH and available at http://rsb.info.nih.gov/nih-image).

	Results

Top Abstract Materials and Methods Results Discussion References

 
Deletion of the 4-kb Fragment on One Allele in Mouse B Cells Results in a Strong Decrease in Rearrangement when Compared with the Wild-type Allele.
Gene-targeted Ly5.2⁺ B and non-B cells were sorted from spleens of chimeric mice obtained by aggregation of mutated ES cells with Ly5.1⁺ morulas. In a first series of mice (D5, D6, D7) the sorted cells carried the 4-kb deletion on one allele (construct depicted in Fig. 1 e). Analysis by Southern blot (Fig. 2 and Table I) of the percentage of wild-type over mutated allele germline retention in B cells of three different mice (14/86, 15/85, and 23/77) versus non-B cells (47/53, 44/56, and 49/51) showed a strong decrease in rearrangement levels for the mutated allele, indicating that a positive regulatory element of rearrangement had been inactivated upon deletion. Germline retention analysis of B cells from a chimera bearing only the two loxP sites (control mice) indicated that these two elements had no effect on rearrangement (Fig. 2 d).

View larger version (78K): [in this window] [in a new window] [Download PPT slide]   Figure 2 Effect of the 4-kb deletion and the KI-KII mutation on light chain gene rearrangement in mutant B cells from chimeric mice. (a) Scheme of wild-type and mutant alleles analyzed in mouse chimeras obtained from heterozygous, gene-targeted ES cells, with sizes of BamHI fragments analyzed in b by Southern blot. The position of the probe C used in b and of the PCR primers used in d is indicated. (b) Southern blot analysis of BamHI-digested DNA from Ly5.2+, CD19+, or CD19– splenic cells (see panel c). Germline retention at the locus is analyzed for the mutant allele (8 kb) and the wild-type allele (12.7 kb) in ES-derived splenic cells bearing the 4-kb deletion alone (D#) or the 4-kb deletion together with the KI-KII mutation (DM#), and compared with the original ES clone. Germline retention of wild-type versus mutant alleles is quantified in Table I. (c) Gene-targeted splenic B (Ly5.2+CD19+) and non-B (Ly5.2+CD19–) cells are purified from mouse chimeras by an allelic difference at the Ly5 locus between the ES cell and the recipient blastocyst. (d) For loxP control mice (LP#), germline retention of both alleles in splenic CD19+ and CD19– cells is analyzed by PCR, with the primers indicated in a.

Deletion of the 4-kb Fragment Reduces Rearrangement of the Mutated Allele in the 103/bcl2-hygro^R Pre-B Cell Line.
The 103/bcl2-hygro^R cell line, transformed with a temperature-sensitive mutant Abelson virus, rearranges the light chain locus when shifted to the nonpermissive temperature (34°C 39°C). It was shown that this rearrangement process follows a kinetics where 20–30% of loci are rearranged in 48 h; to a lesser degree, the loci of these cells also rearrange during this time course. After 4 d most of the cells have rearranged both alleles (13). Upon subcloning after 24 h of induction, we have observed that among 17 clones, 6 had rearranged one allele, 2 had rearranged both alleles, and 9 had their alleles in germline configuration (data not shown).

Rearrangement of the wild-type over mutated alleles was assessed in the 103/bcl2-hygro^R–derived clones carrying the following mutations, introduced by homologous recombination on one allele: the 4-kb deletion alone, the KI-KII mutation alone with the two loxP sites, the two mutations together, or the control loxP sites only (Fig. 3 and Table II). We have chosen clones where the rearrangement status of the loci was close to germline at the permissive temperature, since it has been reported previously that a small percentage of these cells can rearrange spontaneously (13).

View larger version (48K): [in this window] [in a new window] [Download PPT slide]   Figure 3 Effect of the 4-kb deletion and the KI-KII mutation on light chain gene rearrangement in targeted 103/bcl2-hygro–derived cells. (a) Configuration of the wild-type and mutated alleles in four different targeted subclones of the rearrangement-inducible 103/bcl2-hygro cell line. Primers used for analysis of rearrangement are indicated. (b) Rearrangement is assessed by quantitative PCR performed at different time points after shifting to the nonpermissive temperature, followed by restriction enzyme digestion of allele-specific sites: StyI for the wild-type allele and EcoRI for the mutant allele. StyI- and EcoRI-digested products are quantified in Table II.

The KI-KII mutation alone in clone 19.3.9.10 showed no significant effect on rearrangement of the modified allele 48–96 h after induction. A small difference favoring the KI-KII mutation–bearing allele was seen in this clone 12– 24 h after induction (see Table II), but these differences did not stay consistent at later points of the assay. Accordingly, in the cell line carrying both the deletion and the KI-KII mutation, the reduction in rearrangement was identical to the one obtained with the sole 4-kb deletion (clone 19.3.9.14, 24:76 at 48 h). Altogether, these results suggest that in this particular in vitro model the 4-kb deletion mimics the effect obtained with the corresponding mutated mice. On the other hand, the regulatory mechanism involving the KI-KII motif could be nonoperative in these conditions.

Germline Transcription in the 103/bcl2-hygro^R Pre-B Cell Line Clones.
Overall expression levels of long germline transcripts increased upon induction at the nonpermissive temperature at 6 h in the 103/bcl2-hygro^R pre-B cell line (Fig. 4) and started to decrease at 12 h when rearrangement levels start to increase (see Fig. 3).

View larger version (32K): [in this window] [in a new window] [Download PPT slide]   Figure 4 Effect of the 4-kb deletion on induction of germline transcription in targeted 103/4 subclones. Germline transcription is analyzed by RT-PCR at several time points after shifting to the nonpermissive temperature and intensity of PCR products (arbitrary units), after normalization for β-actin expression level, plotted against time in h. (a) Control clone bearing the two loxP sites on one allele. (b) Deletion clone carrying the 4-kb deletion. , mutated allele; •, wild-type allele. Mean values were calculated from two different experiments with error bars. (c) Raw RT-PCR results for a typical experiment performed before and 6 h after induction. Two bands are obtained for the control clone with the wt-5'-primer as both alleles are amplified, whereas only the wild-type allele can be amplified with this primer in the deletion clone. In both clones only the mutated allele can be amplified with the loxP-5'-primer.

	Discussion

Top Abstract Materials and Methods Results Discussion References

 
Here we show that a deletion of 4 kb immediately upstream of the KI-KII sites in the V-J intervening sequence results in a dramatic reduction of rearrangement in cis in mouse spleen B lymphocytes heterozygous for the mutation. When added to the 4-kb deletion, mutations of the KI-KII sites, which had been previously characterized as enhancers of rearrangement, further decreased rearrangement, leading to the almost exclusive use of the unmutated allele. These results clearly demonstrate that a second positive regulatory element of rearrangement is located in the 4-kb fragment adjacent to KI-KII and that both elements must act in concert to enhance rearrangement of the locus.

The same mutations were introduced by homologous recombination of one allele in the rearrangement-inducible 103/bcl2-hygro^R cell line. This pre-B cell line, which has been transformed with a temperature-sensitive Abelson virus mutant, has both heavy chain alleles rearranged nonproductively and initiates rearrangement of the light chain loci when put at a nonpermissive temperature. As in normal pre-B cells, rearrangement initiates in the 103 cell line on one allele, but in the absence of a feedback inhibition of the recombinase it then proceeds to the other allele and to the locus if the cell is maintained at the nonpermissive temperature for 48 h (13). A reduction of rearrangement was obtained for the allele carrying the 4-kb deletion in the 103/bcl2-hygro^R cell line, quantitatively similar to the reduction observed in mutant mice. Several results have been obtained that imply germline transcription as a prerequisite event to rearrangement. When tested in the 103/bcl2-hygro^R cell line, transcription of the long germline transcript could only be induced from the unmutated allele upon induction of rearrangement. Therefore, it is highly probable that the effect we have observed with the 4-kb mutation is due to the deletion of the promoter of the long germline transcript, but one cannot exclude that this segment may contain additional regulatory elements. On the other hand, the KI-KII mutation did not alter the efficiency of rearrangement in the 103 cell line, contrary to the result obtained in vivo. It has been shown that the KI-KII motifs can bind the transcription factor Pax-5 (18). This factor also binds a locus control region located at the 3' end of the IgH locus (19, 20), and seems to be involved in V_H gene accessibility before the V_H-DJ_H rearrangement step. We have found Pax-5 expression in the 103 cell line (data not shown), but specific cofactors (21) necessary for the KI-KII enhancement effect may nevertheless be absent from this cell line.

In the context of the regulation of allelic exclusion that starts by initiating rearrangement on one chromosome, one can envision that a limited balanced set of positive and negative factors present during a short window of development may control accessibility to one allele only. These factors will bind at the promoter and the enhancer regions but also at some specific sites in the V-(D)-J intervening segments (4, 22–24) or upstream of the V regions (25, 26). Alternatively, only one allele per progenitor could be accessible to the recombinase if it is marked by a modification enzyme as recently proposed (27) or by a specific anatomical location in the nucleus. It has been shown recently that in double positive thymic cells the excluded β allele was mostly hypomethylated and transcriptionally active (28). This result would fit better with a repression of the silent allele in the second phase of the allelic exclusion process than with a regulation operating via methylation. The 103/bcl2-hygro^R cell line may be a valuable tool to address such issues.