|
||
By
From the Institute for Cancer Research, Fox Chase Cancer Center, Philadelphia, Pennsylvania 19111
| |
Abstract |
|---|
|
|
|---|
Lineage commitment in B lymphopoiesis remains poorly understood due to the inability to
clearly define newly committed B lineage progenitors and their multipotential descendants. We
examined the potential of three recently described progenitor populations in adult mouse bone
marrow to differentiate into each hematopoietic lineage. The earliest of these, termed fraction
(Fr.) A0, exhibited myeloid, erythroid, and B and T lymphoid progenitor activity and included
individual cells with myeloid/B lymphoid potential. In sharp contrast, two later populations,
termed Frs. A1 and A2 and characterized by surface B220 expression and transcription of the
germline immunoglobulin heavy chain (IgH) locus, lacked progenitor activity for all hematopoietic lineages except B lymphocytes. These observations, together with single cell polymerase chain reaction analysis showing a lack of DHJH rearrangements in each population and
experiments showing identical precursor potentials when these populations were derived from
recombination activating gene (Rag)-1
/
and JH
/
mice, demonstrate that commitment to
the B lymphoid lineage occurs before and independently of VHDHJH recombination.
| |
Introduction |
|---|
|
|
|---|
In adult mice, B lymphocytes ultimately arise from pluripotent stem cells in the bone marrow (BM). Current models predict that the differentiation of multipotential BM progenitor cells into B lineage-committed precursors, incapable of giving rise to alternative hematopoietic lineages, requires the stage-specific activity of key gene products (1). However, despite intensive interest in early B cell development, elucidation of the molecular mechanisms underlying B lineage commitment has been hampered by the inability to clearly define the earliest B lineage-restricted progenitor cells and their immediate unrestricted precursors.
A large body of work has been devoted to defining multipotent hematopoietic progenitor populations. Pluripotent
stem cells have been identified in BM (2) and fetal liver (3,
4), bipotential myeloid/B lymphoid progenitors have been
identified in fetal liver (5), and lymphoid-restricted progenitors have been identified in adult thymus (6) and BM (7).
Recently we described three novel cell populations in adult
BM, termed fractions (Frs.) A0, A1, and A2 (8). Among
these, Frs. A1 and A2 exhibit numerous characteristics consistent with their designation as precursors for pro-B cells
or pre-pro-B cells (9). Thus, whereas expression of
5 and
recombination activating gene (Rag)-1/2 is restricted to Fr.
A2 and more mature subsets, Frs. A1 and A2 each exhibit
surface B220 expression, express transcripts for the germline IgH locus (µ0), and proliferate in short-term stromal cultures supplemented with IL-7 (8).
The developmental potential of pre-pro-B cells and the
role VHDHJH recombination plays in the restriction of multipotential progenitor cells to the B lymphoid lineage have
not been explored. Although cells containing IgH recombination events are often referred to as B lineage committed, the existence of natural and induced myelogenous tumor cells containing IgH rearrangements suggests that B
lineage commitment can occur after such events (10). However, here we report that whereas the precursors of
pre-pro-B cells in Fr. A0 exhibit progenitor activity for
multiple hematopoietic lineages, pre-pro-B cells in Frs. A1
and A2 are B lineage restricted but lack DHJH rearrangements. This finding demonstrates that B lineage commitment occurs very early in B cell development, before
5
expression and initiation of DHJH recombination and coincident with µ0 and surface B220 expression. Furthermore,
identical results were obtained with the equivalent cell
populations from mice incapable of initiating VHDHJH recombination, indicating that mechanisms controlling the
differentiation of multipotential progenitors into B lineage-
committed cells function independently of VHDHJH recombination.
| |
Materials and Methods |
|---|
|
|
|---|
Preparation of BM Cell Suspensions from Mice.
2-4-mo-old female BALB/c and C57BL/6 mice were obtained from the Institute for Cancer Research Laboratory Animal Facility. Female B6.Ly5.2 congenics were obtained from the National Cancer Institute animal facility in Frederick, MD. Rag-1
/
and JH
/
mice are maintained in our breeding colony. BM cell suspensions were made as described previously (9).
Flow Cytometric Analysis and Cell Sorting.
Four-color FACS® analysis and cell sorting of each B lineage cell population were described previously (8, 9, 14). Five-color FACS® analyses were performed by staining adult BM cells with Oregon Green (OG)- coupled anti-CD4 (GK1.5), biotin anti-B220 (RA3-6B2), allophycocyanin (APC) anti-AA4.1, and PE-Cy5 anti-heat-stable antigen (anti-HSA) (30F1). PE-coupled antibodies were anti- Sca-1, anti-IL-7R
(A7R34), anti-CD3 (500-A2), anti-CD11b
(Mac-1), anti-GR-1 (8C5), anti-CD19 (1D3), and anti-NK1.1
(PK136). APC anti-CD117 (c-kit, clone 2B8) was used in conjunction with OG-anti-CD4, PE anti-AA4.1, PE-Cy5 anti-HSA, and biotin anti-B220. Biotinylated antibodies were revealed with Texas Red Avidin, and HSA+ propidium iodide
(PI)+ cells were excluded during data collection. Reagents were
prepared in our laboratory except for FL anti-Ly5.1 (104) and
APC anti-c-kit (2B8), which were purchased from .
Stromal Cell Cultures.
Bulk cultures were established by sorting 104 cells onto S17 (5) stromal cells in 24-well flat-bottomed plates as described (9). Numbers of B220+ HSAint and CD11b+ HSAint cells were determined 4 or 8 d later by flow cytometry. Limiting dilution cultures were established by sorting 1-100 cells per well with an automated cell deposition unit directly into 96-well plates with preestablished S17 stromal cells in standard medium and 100 U/ml rIL-7. Wells containing cell growth were scored 14 d later, and the presence of B and myeloid lineage cells was assessed by staining cells with APC-B220, PE-CD11b, and FL-HSA.Methylcellulose Cultures.
Methylcellulose medium containing IL-3, IL-6, stem cell factor (SCF), and erythropoietin was purchased from Stem Cell Technologies. Triplicate cultures were established by plating sorted cells according to the manufacturer's instructions. Each culture was scored for the number of granulocytic/macrophage (CFU-GM), erythroid (CFU-BFE), and mixed (CFU-GEMM) colonies 12 d later.Reverse Transcription PCR.
RNA and cDNA from 105 sorted cells were prepared and amplified with gene-specific primers as described previously (14). Primers for
-actin and µ0 have been
described (8, 14). Primers for myeloid-specific genes were as follows: lysozyme, 5'-CTCTGAAAAGGAATGGAATGGCTG, 3'-AAATCGAGGGAATGTGACCTCTCTC; c-fms, GAACGTGTTCATCTGTTCCCGTCC, 3'-TCCCCTTACCATGCCAAACTGTGG.
PCR, blotting, and hybridization with gene-specific riboprobes were performed as described (14). 10 µl aliquots were
withdrawn at 18, 22, and 26 cycles (
-actin) or 22, 26, and 30 cycles for separate analysis to ensure that amplification was in the
linear range.
Single-cell PCR for Detection of DHJH Rearrangements.
Detec tion of DHJH rearrangements and/or an IgH germline fragment from individual cells was accomplished by seminested PCR as described by Ehlich et al. (15). Cloning and nucleotide sequencing confirmed the identity of every PCR product.Intrathymic Transfer.
Intrathymic transfers were performed as described by Wu et al. (6). 104 sorted cells from female C57BL/6 or JH
/
(both H-2b and Ly5.1+) mice were injected into the
thymus of anesthetized female B6.Ly5.2 mice given 500 rads
18-24 h previously. Enumeration and characterization of donor-derived thymocytes were accomplished 14-28 d later by staining
recipient thymocytes with FL anti-Ly5.1 (104) and combinations of PE or APC anti-CD3 (500-A2), PE anti-CD8 (Lyt2), and
APC anti-CD4 (GK1.5).
| |
Results |
|---|
|
|
|---|
We previously described a flow cytometric system for the
isolation of three early B lineage progenitor populations,
termed Frs. A0, A1, and A2 (8). Each population constitutes
0.1% of all cells in adult BM, bears the surface phenotype
AA4.1+ HSA
, and is further defined as B220
CD4low
(A0), B220+ CD4+ (A1), or B220+ CD4
(A2) (Fig. 1 A).
Each fraction contains cells with the capacity to differentiate into B220+ HSAint pro-B cells in stromal cultures (Fig.
1 B). Interestingly, these cultures also routinely contained
CD11b+ B220
myeloid lineage cells (not shown), suggesting that these populations might also contain myeloid
progenitors. However, because these bulk cultures often
contain contaminating stem cells, we adopted a series of
quantitative culture and adoptive transfer systems in conjunction with semiquantitative reverse transcription (RT)- PCR and five-color flow cytometry to more precisely define the ability of these populations to give rise to cell types
other than B lymphocytes.
|
Five-color FACS® data for surface molecules associated with multilineage and lineage-restricted progenitor
cells are presented in Fig. 2. Bimodal expression of surface
molecules associated with multipotential progenitors such
as Sca-1/Ly6C and CD117/c-kit and the CD11b surface
antigen associated with the myeloid lineage was observed
in Fr. A0, implying cellular heterogeneity within this population. In subsequent experiments, we determined that Fr.
A0 can be further subdivided into two discrete Sca-1+
c-kit+ CD11b
and Sca-1
c-kit
CD11b+ populations
(not shown).
|
In contrast to Fr. A0, Frs. A1 and A2 each exhibited a
uniform Sca-1low c-kit
CD11blow phenotype, whereas
B220+ CD43+ HSAint pro-B cells, previously referred to as
Frs. B and C (9), were Sca-1low CD11b
and bimodal for
c-kit. Since Rolink and colleagues have used a CD19+
c-kit+ surface phenotype to define pro-B cells (16), we
were surprised to find undetectable levels of c-kit among
Frs. A1 and A2 and bimodal expression within Frs. B and C. Although this might be attributed to differences between
particular antibodies, the c-kit antibody used (2B4) gave
brighter staining among CD19+ BM cells compared with
the alternative available clone, ACK4 (data not shown).
That Frs. A1 and A2 are unique and separate B lineage
progenitor populations relative to pro-B cells defined as
CD19+ c-kit+ or B220 low CD43low HSAint is also evident
from their lack of expression of CD19 (8). Frs. A0-A2 also
exhibited low to undetectable staining for IL-7R
relative
to pro-B cells in Frs. B/C (Fig. 2). Finally, surface molecules associated with lineage-restricted progenitors such as
CD3, TER-119, and Gr-1 were undetectable on all populations (data not shown).
Previous experiments examining the degree of recombination at the IgH locus in various B lineage subsets suggest that DH-JH recombination occurs largely within the pro-B cell compartment (9, 14, 15). However, since these experiments were performed with a pre-pro-B cell population subsequently shown to be heterogeneous (8, 17), we adopted a PCR assay previously shown to detect DHJH rearrangements among individual cells (15) to rule out the possibility that DH-JH rearrangement initiates in Frs. A1/A2. Only cells with germline configuration of the IgH locus were detected in 68 and 71 cells from Frs. A0 and A1, respectively. Similarly, only 2 out of 49 cells from Fr. A2 in which a PCR product was detected contained a D-J rearrangement. By comparison, 25 out of 44 pro-B cells (Fr. B) in which a PCR product was detected displayed D-J rearrangements on at least 1 allele (not shown). Thus, these data confirm previous conclusions that DHJH rearrangements are initiated among pro-B cells.
Loss of Monocyte/Macrophage Progenitor Activity Occurs before and Independently of VDJ Recombination.To examine the myeloid lineage potential in each subset, we first used semiquantitative RT-PCR for myeloid-specific genes. As shown in Fig. 3 A, low level expression of c-fms was observed in Frs. A0-A2 relative to the macrophage cell line P388D1. In contrast, relatively strong expression of lysozyme was observed in P388D1 and Fr. A0 but not Fr. A1 or A2. This expression pattern was the reverse of that observed for µ0, suggesting an absence of myeloid progenitor activity in Frs. A1 and A2.
|
To directly assess myeloid progenitor activity, cells from
each fraction were cultured at limiting dilution on S17
stromal cells under conditions previously shown to support
the growth of monocyte/macrophage and B lymphoid
progenitors (5). Interestingly, each fraction exhibited markedly different cloning potentials under these conditions:
whereas limiting dilution was easily achieved by plating 1 cell/well for Fr. A0, 100- and 10-fold greater numbers of
cells were necessary for Frs. A1 and A2, respectively (not shown). Regardless, 65% of wells seeded with single cells
from Fr. A0 contained both B lineage and myeloid lineage
progenitors as determined by the outgrowth of both B220+
CD11b
HSAint and B220
CD11b+ HSAint cells, demonstrating the presence of bipotential myeloid/B lymphoid progenitor cells within Fr. A0 (Fig. 3 B). In contrast, at limiting dilution 100% of cultures seeded with Fr. A1 or A2
contained only B lineage B220+ CD11b
HSAint cells, indicating an absence of myeloid progenitor activity within these populations. Likewise, when introduced into methylcellulose cultures optimized for myeloid and erythroid progenitors, Fr. A0 but not Fr. A1 or A2 gave rise to both macrophage/granulocyte and erythroid colonies, with greater
numbers of macrophage/granulocyte colonies and fewer
erythroid colonies relative to Lin
Sca-1+ pluripotent stem
cells (Table I; reference 2). These data, together with the
stromal cell cultures described in Fig. 3 B, indicate that loss
of myeloid and erythroid precursor potential occurs before
DH-JH rearrangements. Finally, we tested whether this process is independent of VHDHJH recombination using methylcellulose cultures initiated with cells from Rag-1
/
mice. The inability of cells within Frs. A1 and A2 to give
rise to the myeloid and erythroid lineage was unaffected by
the Rag-1 mutation, showing that loss of myeloid/erythroid precursor potential occurs independent of VHDHJH recombination (Table I).
|
Since low surface
expression of CD4 has been associated with a thymocyte
precursor population in adult BM (18, 19) and with the
earliest T lineage precursor cell in adult thymus (6), we reasoned that Frs. A0 and/or A1 might also contain T lineage progenitors. To determine T lineage progenitor activity
within Frs. A0-A2 and to test whether IgH recombination
influences B-T lymphoid lineage commitment, we performed intrathymic transfers with cells from C57BL/6 or
JH
/
mice (both H-2b, Ly5.1) into B6.Ly5.2 recipients. As
shown in Fig. 4, Fr. A0 exhibited clear thymic precursor
activity whether taken from C57BL/6 or JH
/
mice. Separate experiments demonstrated similar thymic reconstitution potentials between Fr. A0 and early thymocyte pro-T
cells (6), and thymi repopulated with Fr. A0 contained
conventional CD4+CD8+CD3low double positives and
CD3high single-positive thymocytes (not shown). In sharp
contrast, no T lineage progenitor activity was observed
when thymi were injected with equivalent numbers of cells
from Fr. A1 or A2, regardless of whether these populations
were taken from C57BL/6 or JH
/
mice (Fig. 4). Moreover, we were unable to amplify T lineage genes such as
pre-T
and C
using cDNA from Frs. A0-A2 (not shown). Finally, consistent with a lack of NK cell progenitors in Frs. A0-A2, these populations failed to proliferate in cultures
supplemented with IL-2 compared with the BM NK cell
progenitors described by Rolink et al. (17). Together, these
data indicate that pre-pro-B cells, defined as Frs. A1 and
A2, lack NK and T lymphoid as well as myeloid and erythroid lineage precursor cells, demonstrating that lineage restriction in developing B lineage progenitors occurs before
and independently of VHDHJH recombination.
|
| |
Discussion |
|---|
|
|
|---|
Although previous studies have defined multipotent progenitor populations in BM (2, 20), fetal liver (3, 23), and the thymus (6), until now the lineage potential of developing B lymphocyte progenitors has not been addressed. Here we show that the earliest B lineage progenitor populations, termed Frs. A1 and A2 and defined in part by µ0 expression but lack of DH-JH rearrangements, are composed largely if not entirely of B lineage-restricted precursors. This conclusion is supported by their homogeneous expression of multiple cell surface molecules (Fig. 2), their lack of expression of myeloid and T lymphoid-specific genes (Fig. 3 A, and data not shown), their inability to give rise to myeloid, erythroid, and non-B lymphoid lineage cells (Figs. 3 and 4), and their near 100% expression of an IgH transgene (8). Finally, we show that mechanisms controlling B lineage restriction do not require VHDHJH rearrangements, since commitment was unaffected in early B lineage progenitors taken from mice incapable of initiating this process.
Significantly, although others have shown that pro-B cells incapable of VHDHJH recombination can be driven to mature in vitro (24), such experiments did not test whether pro-B cells can give rise to alternative lineages or whether IgH rearrangements play a role in this process. Similarly, although mutations in transcription factors such as E12/E47 that result in impairment of DH-JH rearrangements have been said to affect B lineage commitment per se (25), whether these mutations affect B lineage commitment versus differentiation or survival of early B lineage progenitors remains to be determined. However, our data do not exclude a connection between mechanisms controlling B lineage commitment and other events associated with very early B lymphopoiesis such as alteration of chromatin structure at the IgH locus and initiation of µ0 expression.
The definition of B lineage progenitor populations lacking both DH-JH rearrangements and myeloid lineage potential also has implications for the origins of natural and
induced myelogenous leukemias containing IgH rearrangements (10). While one interpretation of these observations was that these cells arose from bipotential myeloid/B
lymphoid precursors after DH-JH rearrangement, an alternative explanation supported by our data is that such cells are
the result of oncogene-induced lineage instability among
pro-B cells. Similarly, cells within Fr. A1 share many characteristics with a novel lymphoid tumor derived from Eµ-myc × Eµ-bcl-2 transgenic mice (26). These tumor cells,
like Fr. A1, are B220+ CD4+ HSA
, and express µ0 but
lack IgH rearrangements. However, unlike Fr. A1, these
tumors exhibit myeloid and B lymphoid progenitor activity. These observations, together with our data, suggest that
coordinated expression of myc and bcl-2 within Fr. A1 disrupts lineage commitment in otherwise lineage-restricted
pre-pro-B cells.
In conclusion, the differentiation of pluripotent stem cells into lineage-restricted progenitors for each hematopoietic lineage is a complex and highly controlled process. This complexity is reflected in part by the presence of multiple discrete cell populations with varying levels of multilineage progenitor activity, the existence of key transcriptional regulatory proteins such as Pax-5/BSAP, EBF, E12/47, and Ikaros, important for the differentiation or survival of unique progenitor populations (27), and potential differences in soluble factors important for multilineage and lineage-restricted cells (28). A reassessment of those studies vis a vis the data presented here, together with a description of the developmental relationship between pre-pro-B cells and the recently described common lymphoid progenitor population in adult BM (7), should eventually yield an understanding of the cellular and molecular interactions responsible for B lineage commitment.
| |
Footnotes |
|---|
Address correspondence to David Allman, Institute for Cancer Research, Fox Chase Cancer Center, 7701 Burholme Ave., Philadelphia, PA 19111. Phone: 215-728-2463; Fax: 215-728-2412; E-mail: DM_Allman{at}fccc.edu
Received for publication 17 September 1998 and in revised form 4 December 1998.
The authors wish to acknowledge the expert technical assistance of Ms. Susan Shinton, and thank Dr. Avinash Bhandoola for instruction in intrathymic transfers. We also thank Drs. Michael Cancro, Dietmar Kappes, Jennifer Punt, and David Wiest for critical review of this manuscript.This work was supported by grants from the National Institutes of Health (AI-26782, AI-40946, and CA-06972). D. Allman is supported by an award from the Arthritis Foundation.
| |
References |
|---|
|
|
|---|
| 1. | Kee, B.L., and C.J. Paige. 1995. Murine B cell development: commitment and progression from multipotential progenitors to mature B lymphocytes. Int. Rev. Cytol. 157: 129-179 [Medline]. |
| 2. |
Spangrude, G.J.,
S. Heimfeld, and
I.L. Weissman.
1988.
Purification and characterization of mouse hematopoietic stem
cells [published erratum in 244(4908):1030].
Science.
241:
58-62
|
| 3. |
McKearn, J.P.,
J. McCubrey, and
B. Fagg.
1985.
Enrichment
of hematopoietic precursor cells and cloning of multipotential B-lymphocyte precursors.
Proc. Natl. Acad. Sci. USA.
82:
7414-7418
|
| 4. | Jordan, C.T., J.P. McKearn, and I.R. Lemischka. 1990. Cellular and developmental properties of fetal hematopoietic stem cells. Cell. 61: 953-963 [Medline]. |
| 5. | Cumano, A., C.J. Paige, N.N. Iscove, and G. Brady. 1992. Bipotential precursors of B cells and macrophages in murine fetal liver. Nature. 356: 612-615 [Medline]. |
| 6. |
Wu, L.,
M. Antica,
G.R. Johnson,
R. Scollay, and
K. Shortman.
1991.
Developmental potential of the earliest precursor
cells from the adult mouse thymus.
J. Exp. Med.
174:
1617-1627
|
| 7. | Kondo, M., I.L. Weissman, and K. Akashi. 1997. Identification of clonogenic common lymphoid progenitors in mouse bone marrow. Cell. 91: 661-672 [Medline]. |
| 8. | Li, Y.S., R. Wasserman, K. Hayakawa, and R.R. Hardy. 1996. Identification of the earliest B lineage stage in mouse bone marrow. Immunity. 5: 527-535 [Medline]. |
| 9. |
Hardy, R.R.,
C.E. Carmack,
S.A. Shinton,
J.D. Kemp, and
K. Hayakawa.
1991.
Resolution and characterization of
pro-B and pre-pro-B cell stages in normal mouse bone marrow.
J. Exp. Med.
173:
1213-1225
|
| 10. |
Principato, M.,
J.L. Cleveland,
U.R. Rapp,
K.L. Holmes,
J.H. Pierce,
H.C. Morse III, and
S.P. Klinken.
1990.
Transformation of murine bone marrow cells with combined v-raf-v-myc oncogenes yields clonally related mature B cells and
macrophages.
Mol. Cell. Biol.
10:
3562-3568
|
| 11. |
Seremetis, S.V.,
P.G. Pelicci,
A. Tabilio,
A. Ubriaco,
F. Grignani,
J. Cuttner,
R.J. Winchester,
D.M. Knowles II, and
R. Dalla-Favera.
1987.
High frequency of clonal immunoglobulin or T cell receptor gene rearrangements in acute myelogenous leukemia expressing terminal deoxyribonucleotidyltransferase.
J. Exp. Med.
165:
1703-1712
|
| 12. | Klinken, S.P., W.S. Alexander, and J.M. Adams. 1988. Hemopoietic lineage switch: v-raf oncogene converts Eµ-myc transgenic B cells into macrophages. Cell. 53: 857-867 [Medline]. |
| 13. |
Holmes, K.L.,
J.H. Pierce,
W.F. Davidson, and
H.C. Morse III..
1986.
Murine hematopoietic cells with pre-B or pre-B/
myeloid characteristics are generated by in vitro transformation with retroviruses containing fes, ras, abl, and src oncogenes.
J. Exp. Med.
164:
443-457
|
| 14. |
Li, Y.S.,
K. Hayakawa, and
R.R. Hardy.
1993.
The regulated expression of B lineage associated genes during B cell
differentiation in bone marrow and fetal liver.
J. Exp. Med.
178:
951-960
|
| 15. | Ehlich, A., V. Martin, W. Muller, and K. Rajewsky. 1994. Analysis of the B-cell progenitor compartment at the level of single cells. Curr. Biol. 4: 573-583 [Medline]. |
| 16. | ten Boekel, E., F. Melchers, and A.G. Rolink. 1997. Changes in the V(H) gene repertoire of developing precursor B lymphocytes in mouse bone marrow mediated by the pre-B cell receptor. Immunity. 7: 357-368 [Medline]. |
| 17. |
Rolink, A.,
E. ten Boekel,
F. Melchers,
D.T. Fearon,
I. Krop, and
J. Andersson.
1996.
A subpopulation of B220+
cells in murine bone marrow does not express CD19 and
contains natural killer cell progenitors.
J. Exp. Med.
183:
187-194
|
| 18. |
Antica, M.,
L. Wu,
K. Shortman, and
R. Scollay.
1994.
Thymic stem cells in mouse bone marrow.
Blood.
84:
111-117
|
| 19. | Chervenak, R., D. Dempsey, R. Soloff, R.M. Wolcott, and S.R. Jennings. 1993. The expression of CD4 by T cell precursors resident in both the thymus and the bone marrow. J. Immunol. 151: 4486-4493 [Abstract]. |
| 20. |
Wineman, J.P.,
G.L. Gilmore,
C. Gritzmacher,
B.E. Torbett, and
C.E. Muller-Sieburg.
1992.
CD4 is expressed on murine
pluripotent hematopoietic stem cells.
Blood.
80:
1717-1724
|
| 21. |
Onishi, M.,
K. Nagayoshi,
K. Kitamura,
H. Hirai,
F. Takaku, and
H. Nakauchi.
1993.
CD4dull+ hematopoietic progenitor
cells in murine bone marrow.
Blood.
81:
3217-3225
|
| 22. |
Ogawa, M.,
Y. Matsuzaki,
S. Nishikawa,
S. Hayashi,
T. Kunisada,
T. Sudo,
T. Kina, and
H. Nakauchi.
1991.
Expression and function of c-kit in hemopoietic progenitor cells.
J.
Exp. Med.
174:
63-71
|
| 23. | Cumano, A., and C.J. Paige. 1992. Enrichment and characterization of uncommitted B-cell precursors from fetal liver at day 12 of gestation. EMBO (Eur. Mol. Biol. Organ.) J. 11: 593-601 [Medline]. |
| 24. | Rolink, A., F. Melchers, and J. Andersson. 1996. The SCID but not the RAG-2 gene product is required for S mu-S epsilon heavy chain class switching. Immunity. 5: 319-330 [Medline]. |
| 25. | Bain, G., E.C. Robanus, Maandag, H.P. te Riele, A.J. Feeney, A. Sheehy, M. Schlissel, S.A. Shinton, R.R. Hardy, and C. Murre. 1997. Both E12 and E47 allow commitment to the B cell lineage. Immunity. 6: 145-154 [Medline]. |
| 26. | Strasser, A., A.G. Elefanty, A.W. Harris, and S. Cory. 1996. Progenitor tumours from Eµ-bcl-2-myc transgenic mice have lymphomyeloid differentiation potential and reveal developmental differences in cell survival. EMBO (Eur. Mol. Biol. Organ.) J. 15: 3823-3834 [Medline]. |
| 27. | Reya, T., and R. Grosschedl. 1998. Transcriptional regulation of B-cell differentiation. Curr. Opin. Immunol. 10: 158-165 [Medline]. |
| 28. | Kee, B.L., and C.J. Paige. 1996. In vitro tracking of IL-7 responsiveness and gene expression during commitment of bipotent B-cell/macrophage progenitors. Curr. Biol. 6: 1159-1169 [Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|