|
||
Articles |
| Abstract |
|---|
|
|
|---|
Key Words: syphilis vaccine subpopulation surface antigens antigenic variation
Abbreviations used: msp, major sheath protein; NRS, normal rabbit serum; ORS, opsonized rabbit serum; RT, reverse transcription; tpr, Treponema pallidum repeat.
Outer surface molecules of bacterial organisms play a central role in pathogenesis and immunity because they are involved in adherence to host cells and serve as targets of bactericidal or opsonic antibody. Although Treponema pallidum adheres to host cells and is susceptible to bactericidal and opsonic antibody, the bacterial molecules involved in those functions have not been defined. Unlike the outer membranes of gram-negative bacteria, the outer membrane of T. pallidum is very fragile and easily damaged by physical manipulation (1), which has resulted in the misidentification of several highly immunogenic periplasmic lipoproteins as outer membrane antigens (2). Studies conducted independently in two laboratories (3, 4) have shown by freeze fracture electron microscopy that the surface of T. pallidum is relatively devoid of outer membrane proteins compared with other bacteria, and it is hypothesized that this paucity of surface-exposed antigens is responsible for the chronicity of syphilis infection (3). Attempts to identify the rare outer membrane proteins of T. pallidum have yielded controversial results (5). Two surface-exposed molecules have been proposed to date, Tromp 1 (6) and Tromp 2 (7). Tromp 1 is reported to have porin activity (6) and appears to be part of an ABC transport operon (8), but its location in the outer membrane is not universally accepted (8, 9), and antiserum directed against recombinant Tromp 1 is not opsonic (9). Independent confirmation of the surface location of Tromp 2 has not been reported. Other searches for outer membrane proteins have been inconclusive (10–14).
Surface-exposed antigens in T. pallidum are likely to be important virulence factors, as well as being the molecules that interact with the protective immune response. Several studies have shown that T. pallidum infection induces antibodies that inhibit cell attachment (15, 16) and promote macrophage-mediated phagocytosis (17, 18) and complement-mediated neutralization (19–21). Macrophage-mediated phagocytosis of opsonized T. pallidum is the major mechanism for clearance of treponemes from primary and secondary syphilis lesions (22–24), and opsonic antibody is required for killing of the treponemes by the macrophages (18).
In this report we describe the identification of a multicopy polymorphic gene family of T. pallidum, termed T. pallidum repeat (tpr),1 that is related to the major surface protein (msp) genes of Treponema denticola. The T. denticola msps are surface exposed, mediate binding to host cells and extracellular matrix, and function as porins. We show that one member of the paralogous T. pallidum gene family, tpr K, is preferentially transcribed in the Nichols strain of T. pallidum, serves as a target of opsonic antibody, and induces a protective immune response. These results strongly support the exposure of this protein on the surface of the Nichols strain of T. pallidum.
Subtraction Libraries.
DNA Sequencing of Clones.
Hybridization Analysis.
Expression Library Screening.
![]()
Materials and Methods
Top
Abstract
Materials and Methods
Results
Discussion
References
Treponemal Strains and DNA Extraction.
T. pallidum subspecies pallidum, Nichols strain, originally sent to the University of Washington by Dr. James N. Miller (University of California, Los Angeles, CA) in 1979, was propagated in New Zealand white rabbits as previously described (25). Treponema paraluiscuniculi Cuniculi A strain was isolated from an infected rabbit, provided by Dr. Paul Hardy (Johns Hopkins University, Baltimore, MD), and propagated as above. Treponemes were extracted from infected rabbit testes and DNA isolated as previously described (26).
Subtraction hybridization using PCR technology (representational difference analysis) was performed to enrich for DNA sequences likely to be found in T. pallidum subspecies pallidum, Nichols strain, but not in Treponema paraluiscuniculi. The protocol was followed as described in the manufacturer's instructions (PCR-Select Subtraction Kit; Clontech) except that genomic DNA was substituted for cDNA. All DNA samples were treated with RNAse A before the subtraction experiments. T. pallidum subspecies pallidum DNA was the "tester" DNA; that is, the DNA containing specific sequences that are left behind after subtraction. A mixture of T. paraluiscuniculi DNA plus rabbit genomic DNA was used as the "driver" DNA; that is, the excess DNA used to subtract away the common sequences. Rabbit genomic DNA was included in the driver because treponemes are propagated in rabbits and therefore rabbit DNA contaminates all treponemal samples. After performing the procedure, the resultant PCR products were cloned into the PCR 3.1 T/A cloning vector (Invitrogen).
Double-stranded plasmid DNA was extracted from clones containing inserts using the Qiagen Plasmid Kit (Qiagen). Full automated sequencing of the inserts was performed by the dye terminator method (Perkin Elmer) according to the manufacturer's instructions, except molecular grade dimethylsulfoxide (Sigma Chemical Co.) was added to give a final concentration of 5% vol/vol. The 5' and 3' ends of the plasmid inserts were sequenced with the T7 primer (5' taatacgactcactataggg) and the PCR3.1 reverse primer (5' tagaaggcacagtcgag). When necessary, sequencing was completed in both directions by making primers complementary to internal sequence as it became available. Two clones, designated 3 and 33, were found to have predicted amino acid homology with the msp of T. denticola (27) and were further evaluated as described below. Comparison with the subsequently released T. pallidum genome (28) indicated that they represent tpr F and tpr G, respectively.
3 µg of genomic DNA from T. pallidum subspecies pallidum, Nichols strain, and T. paraluiscuniculi, Cuniculi A strain, were digested with the restriction enzymes EcoRI, PstI, and BamHI (New England Biolabs), separated in 1% TBE agarose gels, denatured with 0.5 M NaOH, transferred to Hybond N membrane (Amersham Labs.) and probed separately with inserts from clones 3 and 33 inserts labeled with 32P using the Random Priming Labeling Kit (Boehringer Mannheim) according to the manufacturer's protocol. Hybridization and washing were carried out using high stringency conditions, and specific hybridization was detected by autoradiography.
A T. pallidum genomic expression library was constructed and differentially screened as previously reported (29). In brief, the library was prepared using the Lambda ZAP® II cloning kit (Stratagene) according to the manufacturer's instructions. Approximately 200,000 plaques (12,500 PFU/plate) were plated and duplicate lifts prepared and screened using established methods (30). Filters were differentially screened with a T. pallidum–specific immune rabbit serum depleted of activity against the major known treponemal antigens but still retaining its opsonic capacity (termed opsonic rabbit serum; ORS), and a nonopsonic antiserum prepared using heat-killed T. pallidum (termed nonopsonic rabbit serum; non-ORS). The ORS was prepared by sequential adsorption of pooled syphilitic rabbit serum with T. phagedenis, biotype Reiter, recombinant T. pallidum 47-, 37-, 34.5-, 33-, 30-, 17-, and 15-kD molecules (as designated in Table III in reference 2) and recombinant Tromp 1 (6). In unpublished studies from our laboratory, antisera raised against electroeluted or recombinant forms of these antigens failed to demonstrate opsonic function. The antiserum was further adsorbed with VDRL antigen, a lipid complex that has been shown to be the target of a minor portion of opsonic antibodies (31). These adsorption steps were performed to reduce the number of irrelevant positive clones identified by this antiserum in the expression library screening. Immunoreactive plaques were detected with 1 µCi of 125I-labeled protein A on nitrocellulose filters using established methods (30). Clones showing reactivity with the opsonic antiserum but no reactivity with the nonopsonic antiserum were converted to pBluescript SK phagemids and sequenced.
|
Transcriptional Analysis of the tpr Genes by Reverse Transcription PCR.
Reverse transcription (RT)-PCR systems were developed for semiquantitative and qualitative detection of mRNA for the 12 tpr genes of T. pallidum subspecies pallidum. The DNA sequences of all members were aligned and used to design primers specific for each gene. These primers (Table I) are located in the central variable regions of tpr genes from subfamilies I and II (defined in Results), and in the large hydrophilic regions of genes from subfamily III.
|
PCR was performed using a 100 µl reaction containing 200 µM dNTPs, 50 mM Tris-HCl (pH 9.0 at 20°C), 200 mM NH4SO4, 1 µM of each primer, and 2.5 U of Taq polymerase (Promega Corp.). 2 µl of cDNA containing 500–1,000 treponeme equivalents were used as template. MgCl2 beads (Invitrogen) were added immediately before amplification, giving a final MgCl2 concentration of 1.5 mM. The cycling conditions were as follows: denaturation at 94°C for 3 min, then 94°C for 1 min, 64°C for 2 min, and 72°C for 1 min for 35 cycles. The PCR products were then separated in 3% NuSieve (FMC Bioproducts) agarose gels.
Recombinant Expression of the Tpr K Variable Domain.
The variable domain of Tpr K was expressed as a recombinant peptide in Escherichia coli. The region of interest (amino acids 37–351) was amplified from Nichols strain DNA using the following primers: sense (5'-atattgaaggctatgcggagctg); antisense (5'-cctcaaggaaagaagtatcagg). The amplicon was cloned directly into the pCR3.1 T/A cloning vector (Invitrogen), sequenced to verify identity and lack of mutations, and subcloned using restriction endonucleases into the pRSET vector (Invitrogen; reference 33). Recombinant expression was induced by 0.4 mM isopropylthiogalactopyranoside during log phase growth at 30°C. Inclusion bodies containing the recombinant protein were isolated and solubilized in 6 M urea, and the recombinant 6-histidine–containing protein was purified by nickel chromatography (33).
Immunization of Rabbits for Antisera and Protection Studies.
Five adult male New Zealand white rabbits were immunized with the purified Tpr K recombinant variable domain using a total of 150 µg of recombinant peptide per rabbit in Ribi Adjuvant (MPL + TDM + CWS; Sigma Chemical Co.), divided among intradermal, subcutaneous, intramuscular, and intraperitoneal injections according to the manufacturer's instructions. Two additional booster immunizations were given at 3-wk intervals, and antisera were collected 1 wk after the final immunization.
Opsonization Experiments.
The opsonic activity of the antisera raised against the recombinant Tpr K variable domain were tested as previously described (34). In brief, 2 x 106 proteose peptone– induced rabbit peritoneal macrophages were incubated for 4 h on coverslips with 107 freshly extracted T. pallidum, Nichols strain, and 10% (final concentration) normal rabbit serum (NRS); additionally, 1% (final concentration) anti-Tpr K variable domain or control antisera was added to separate cultures. Control sera included NRS and pooled immune rabbit serum from rabbits infected with T. pallidum, Nichols strain. Macrophages were washed, fixed with ethanol, stained by indirect immunofluorescence for T. pallidum, and examined by a blinded observer by fluorescence microscopy for the presence of fluorescein-labeled treponemal antigen within typical vacuoles within macrophages. Triplicate specimens were prepared for each condition, and 100 macrophages were counted for each coverslip. The results presented represent four separate experiments, each using a different macrophage donor. Mean values (± SEM) for the percentage of macrophages ingesting T. pallidum were calculated and compared for different antisera by Student's t test.
Protection Experiments.
3 wk after the last immunization, the five rabbits immunized with recombinant Tpr K variable domain were challenged intradermally at eight sites on the back with 105 T. pallidum, Nichols strain, per site. Five unimmunized syphilis-seronegative control rabbits were simultaneously challenged to determine the development and evolution of lesions in the absence of immunity. The rabbits were observed daily for the development and character of the lesions. Aspiration of the lesions for examination by darkfield microscopy was performed, and syphilis serologic tests were used to assess the presence of inapparent infection. Transfer of lymph nodes and testes tissue from challenged rabbits to naive recipients was also used to detect inapparent infection in some challenged rabbits (35).
| Results |
|---|
|
|
|---|
The immunologic screening method designed to identify opsonic antigens in a T. pallidum genomic library (29) also identified a gene encoding a Tpr protein. This clone was distinct from clones 3 and 33, leading us to believe that this was another member of a polymorphic msp-homologue gene family. The sequence of this gene was later shown to correspond to tpr K (28).
T. pallidum Tpr Proteins Have Conserved and Variable Domains.
The clones identified above are completely homologous with 3 of the 12 polymorphic genes identified in the newly released T. pallidum genome (http://utmmg. med.uth.tmc.edu/treponema/tpall.html/; sequence available from EMBL/Genbank/DDBJ under accession No. AE000520; reference 28). Stamm et al. (35a) also submitted the sequence of one of the msp-homologue genes (tpr J) to Genbank (sequence available under accession No. U488957). Three Tpr subfamilies can be identified by their predicted AA homology (Fig. 1), although there is some homology in the AA sequences of the conserved domains in all Tpr proteins. Alignment of the AA sequences of the Tprs of subfamily I (tpr C, D, F, and I) and subfamily II (tpr E, G, and J) shows that the NH2- and COOH-terminal regions of the predicted proteins are conserved, whereas the central domains are variable in terms of sequence and length. Within subfamily I, Tpr C and D are identical, whereas Tpr F lacks a central variable domain and the conserved COOH-terminal domain. Subfamily III (Tpr A, B, H, K, and L) is composed of five members that are comparatively poorly homologous to each other or to the other Tpr proteins, but that still retain small areas of conserved sequences at the NH2 and COOH termini. Potentially cleavable signal peptides were predicted by PSORT analysis (http://psort.nibb.ac.jp:8800/) in all members of subfamily I and Tpr K. Tpr K, F, and I are predicted to be located in the periplasmic space or in the outer membrane (Table II).
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
Several lines of evidence support the hypothesis that at least some of the T. pallidum Tpr proteins are located in the outer membrane with surface-exposed variable domains. First, the paralogous msp protein of T. denticola is surface exposed. Second, structural analysis of the predicted amino acid sequences of the Tpr proteins found in the T. pallidum genome shows central hydrophilic variable domains flanked by amphipathic transmembrane helices, suggesting that the variable domain may be surface-exposed. Further analysis of these molecules identified putative cleavable signal peptides in five of the Tpr molecules, and predicted a possible outer membrane location for Tpr F, I, and K. Finally, and most convincingly, antibodies directed against the variable domain of Tpr K have significant opsonic activity for living T. pallidum, thus demonstrating that these variable domains are accessible at the surface of the intact organism.
The critical role that the Tpr family plays during infection is perhaps best illustrated by the immune protection experiments described in this study. Tpr K induced significant protection against homologous challenge with the Nichols strain. Although lesions developed at every site in every animal, the lesions that appeared in the immunized animals were quite atypical in that they were very flat and nonulcerative, lacked demonstrable treponemes by darkfield examination of aspirates, and healed rapidly compared with control animals. It is also noteworthy that it is the protective Tpr K that is predominantly transcribed in the Nichols strain used for challenge.
It is important to emphasize that none of the immunized animals was completely protected from infection, as they all seroconverted after challenge or had T. pallidum in their lymph nodes and testes detected by microscopy or tissue transfer to another animals. Nonetheless, the degree of alteration of lesion development after immunization is remarkable. It should be noted that the challenge dose used in these studies (nearly 106 treponemes per rabbit) is many logs higher than the rabbit ID50 (51 organisms; reference 35). Experiments are currently underway to examine a challenge dose more analogous to those likely to be encountered in nature.
We also provide evidence for the differential transcription (and probable differential expression) of tpr K in the Nichols strain of T. pallidum. Minor mRNA species were also detected in this strain, and higher levels of amplification reveal mRNA for all tpr genes. These results have several implications. First, there is a predominant Tpr antigen that is expressed in a given population of treponemes, rather than uniform expression of all 12 Tpr proteins. This can be predicted to result in a skewing of the immune response toward the predominant antigen. The "minor" tpr transcripts that are detected by RT-PCR in any strain may reflect less robust expression of those proteins in the same bacterial cells that are also expressing the predominant msp homologue, or they may represent a small subpopulation of organisms in which the minor Tpr is the predominantly expressed antigen ("subpopulation hypothesis"). To date, there are no direct data that favor either of these possibilities over the other.
The subpopulation hypothesis could explain the natural history of syphilis and some intriguing experimental observations. For example, the majority population is responsible for the development of the primary stage of infection. As the immune response develops to the Tpr antigen expressed on the surface of the majority population, those organism are cleared. This provides a selective advantage for a subpopulation of treponemes that express an alternative surface-localized Tpr antigen and the secondary stage ensues. This cycle can continue again to cause recurrent secondary syphilis, and again in some patients to cause tertiary disease. An analogous situation had been demonstrated for Borrelia hermsii, the spirochete causing relapsing fever (36), and may also occur in the Lyme disease spirochete, Borrelia burgdorferi (37). The subpopulation hypothesis could also explain our earlier findings (38) that T. pallidum harvested from infected rabbit testes in which clearance of the majority of the treponemes has naturally occurred (17 d after infection) are resistant to phagocytosis, whereas treponemes harvested before in vivo clearance occurs are readily opsonized and ingested.
The genetic mechanism responsible for regulation of the expression of tpr genes has not yet been defined. The T. pallidum tpr genes have a domain structure that resembles the vsp and vlp gene subfamilies of B. hermsii, with 5' and 3' terminal conserved domains flanking central variable domains (39). As happens in B. hermsii, the conserved domains could serve as sites for recombination for antigenic switch, allowing the expression of previously silent variable domains at transcriptionally active expression sites (40–42). Thus, by analogy to other spirochetes, we propose that the T. pallidum subspecies pallidum Tpr proteins may undergo antigenic variation (concerted switching of antigen expression within a strain) and that this mechanism is responsible for the multi-stage nature of syphilis.
It is also possible that T. pallidum undergoes phase variation (switching gene expression on and off) of the tpr genes. This mechanism would provide an alternative explanation for the development and survival of a subpopulation of treponemes that can resist opsonization and phagocytosis (38) and survive to cause persistent infection. For example, if Tpr molecules are necessary for attachment to host cells, they may be expressed during establishment of infection, but may be unnecessary and turned off during the prolonged latent stage. Appearance of the secondary and tertiary manifestations may be due to renewed Tpr expression (of a different antigenic specificity than during the primary stage) in organisms from latent infection, or alternatively, due to outgrowth of a pre-existing Tpr-expressing subpopulation that has not yet been recognized by the immune system (antigenic variation). Furthermore, expression of specific Tpr molecules may confer tissue tropism on T. pallidum, analogous to the situation in Borrelia turicatae (43) in which a single vsp gene is expressed in neurotropic organisms.
Yet another form of antigenic diversity results from antigenic drift (slower minor changes in epitope composition that occur during strain divergence in evolution and lead to strain-to-strain antigenic differences). This may occur by random mutational events or by recombination within the tpr gene family. There are already data to suggest that antigenic drift of tpr occurs. Restriction fragment length polymorphism analysis of a tpr gene has revealed different restriction patterns between strains of T. pallidum subspecies pallidum (44 and our unpublished results). Furthermore, sequence heterogeneity and the presence of multiple tpr K alleles in other strains has been demonstrated in our laboratory (unpublished results).
In summary, we describe the identification of a polymorphic, multi-membered gene family in T. pallidum subspecies pallidum. Tpr K is preferentially transcribed in the Nichols strain, and its encoded protein serves as a target of opsonic antibody, induces significant protection against infectious challenge, and is likely to be surface exposed. This gene family appears to be central to the pathogenesis of syphilis and may contribute to antigenic diversity of T. pallidum.
| Acknowledgments |
|---|
This study was supported by Public Health Service grants AI42143, AI18988, and AI34616 from the National Institutes of Health (S.A. Lukehart) and a Sexually Transmitted Diseases Cooperative Research Center New Investigator Award AI31448 from the National Institutes of Health (A. Centurion-Lara).
Submitted: 6 July 1998
Revised: 17 November 1998
| References |
|---|
|
|
|---|
1 Cox DL, Chang P, McDowall AW & Radolf JD. The outer membrane, not a coat of host proteins, limits antigenicity of virulent Treponema pallidum. , Infect Immun, 1992, 60, 1076–1083.
2 Norris SJ, Alderete JF, Axelsen NH, Bailey MJ, Baker-Zander SA, Baseman JB, Bassford PJ, Baughn RE, Cockayne A, Hanff PA et al.. Identity of Treponema pallidum subsp. pallidumpolypeptides: correlation of sodium dodecyl sulfate-polyacrylamide gel electrophoresis results from different laboratories, Electrophoresis, 1987, 8, 77–92.
3 Radolf JD, Norgard MV & Schultz WW. Outer membrane ultrastructure explains the limited antigenicity of virulent Treponema pallidum. , Proc Natl Acad Sci USA, 1989, 86, 2051–2055.
4 Walker EM, Zampighi GA, Blanco DR, Miller JN & Lovett MA. Demonstration of rare protein in the outer membrane of Treponema pallidum subsp. pallidumby freeze-fracture analysis, J Bacteriol, 1989, 171, 5005–5011.
5 Radolf JD. Treponema pallidumand the quest for outer membrane proteins, Mol Microbiol, 1995, 16, 1067–1073.[Medline]
6 Blanco DR, Champion CI, Exner MM, Shang ES, Skare JT, Hancock RE, Miller JN & Lovett MA. Recombinant Treponema pallidum rare outer membrane protein 1 (Tromp1) expressed in Escherichia colihas porin activity and surface antigen exposure, J Bacteriol, 1996, 178, 6685–6692.
7 Champion CI, Blanco DR, Exner MM, Erdjument-Bromage H, Hancock REW, Tempst P, Miller JN & Lovett MA. Sequence analysis and recombinant expression of a 28-kilodalton Treponema pallidum subsp. pallidumrare outer membrane protein (Tromp2), J Bacteriol, 1997, 179, 1230–1238.
8 Hardham JM, Stamm LV, Porcella SF, Frye JG, Barnes NY, Howel JK, Muller SL, Radolf JD, Weinstock GM & Norris SJ. Identification and transcriptional analysis of a Treponema pallidumoperon encoding a putative ABC transport system, an iron-activated repressor protein homolog, and a glycolytic pathway enzyme homolog, Gene, 1997, 197, 47–64.[Medline]
9 Akins DR, Robinson E, Shevchenko D, Elkins C, Cox DL & Radolf JD. Tromp1, a putative rare outer membrane protein, is anchored by an uncleaved signal sequence to the Treponema pallidumcytoplasmic membrane, J Bacteriol, 1997, 179, 5076–5086.
10 Shevchenko DV, Akins DR, Robinson EJ, Li M, Shevchenko OV & Radolf JD. Identification of homologs for thioredoxin, peptidyl prolyl cis-trans isomerase, and glycerophosphodieter phosphodiesterase in outer membrane fractions from Treponema pallidum, the syphilis spirochete, Infect Immun, 1997, 65, 4179–4189.[Abstract]
11 Radolf JD, Robinson EJ, Bourell KW, Akins DR, Porcella SF, Weigel LM, Jones JD & Norgard MV. Characterization of outer membranes isolated from Treponema pallidum, the syphilis spirochete, Infect Immun, 1995, 63, 4244–4252.[Abstract]
12 Radolf JD, Chamberlain NR, Clausell A & Norgard MV. Identification and localization of integral membrane proteins of virulent Treponema pallidum subsp. pallidumby phase partitioning with the nonionic detergent Triton X-114, Infect Immun, 1988, 56, 490–498.
13 Blanco DR, Reimann K, Skare J, Champion CI, Foley D, Exner MM, Hancock REW, Miller JM & Lovett MA. Isolation of the outer membranes from Treponema pallidum and Treponema vincentii. , J Bacteriol, 1994, 176, 6088–6099.
14 Blanco DR, Giladi M, Champion CI, Haake DA, Chikami GK, Miller JN & Lovett MA. Identification of Treponema pallidum subspecies pallidumgenes encoding signal peptides and membrane-spanning sequences using a novel alkaline phosphatase expression vector, Mol Microbiol, 1991, 5, 2405–2415.[Medline]
15 Wong GH, Steiner B & Graves S. Effect of syphilitic rabbit sera taken at different periods after infection on treponemal motility, treponemal attachment to mammalian cells in vitro, and treponemal infection in rabbits, Br J Vener Dis, 1983, 59, 220–224.[Medline]
16 Fitzgerald TJ, Replesh LA, Blanco DR & Miller JN. Attachment of Treponema pallidumto fibronectin, laminin, collagen IV, and collagen I, and blockage of attachment by immune rabbit IgG, Br J Vener Dis, 1984, 60, 357–363.[Medline]
17 Lukehart SA & Miller JN. Demonstration of the in vitro phagocytosis of Treponema pallidumby rabbit peritoneal macrophages, J Immunol, 1978, 121, 2014–2024.
18 Baker-Zander SA & Lukehart SA. Macrophage-mediated killing of opsonized Treponema pallidum. , J Infect Dis, 1992, 165, 69–74.[Medline]
19 Bishop NH & Miller JN. Humoral immunity in experimental syphilis. II. The relationship of neutralizing factors in immune serum to acquired resistance, J Immunol, 1976, 117, 197–207.
20 Blanco DR, Miller JN & Hanff PA. Humoral immunity in experimental syphilis: the demonstration of IgG as a treponemicidal factor in immune rabbit serum, J Immunol, 1984, 133, 2693–2697.[Abstract]
21 Blanco DR, Walker EM, Haake DA, Champion CI, Miller JN & Lovett MA. Complement activation limits the rate of in vitro treponemicidal activity and correlates with antibody-mediated aggregation of Treponema pallidumrare outer membrane protein, J Immunol, 1990, 144, 1914–1921.[Abstract]
22 Lukehart SA, Baker-Zander SA, Lloyd RMC & Sell S. Characterization of lymphocyte responsiveness in early experimental syphilis. II. Nature of cellular infiltrations and Treponema pallidumdistribution in testicular infection, J Immunol, 1980, 124, 461–467.[Abstract]
23 Lukehart, S.A. 1992. Immunology and pathogenesis of syphilis. In Advances in Host Defense Mechanisms, vol. 8: Sexually Transmitted Diseases. T.C. Quinn, J.I. Gallin, and A.S. Fauci, editors. Raven Press, New York. 141–163.
24 Van Voorhis WC, Barrett LK, Koelle DM, Nasio JM, Plummer FA & Lukehart SA. Primary and secondary syphilis lesions contain mRNA for Th1 cytokines, J Infect Dis, 1996, 173, 491–495.[Medline]
25 Lukehart SA, Baker-Zander SA & Sell S. Characterization of lymphocyte responsiveness in early experimental syphilis. I. In vitro response to mitogens and Treponema pallidumantigens, J Immunol, 1980, 124, 454–460.[Abstract]
26 Centurion-Lara A, Castro C, Van Voorhis WC & Lukehart SA. Two 16S-23S ribosomal DNA intergenic regions in different Treponema pallidum subspecies contain tRNAgenes, FEMS Microbiol Lett, 1997, 143, 235–240.
27 Fenno, J.C., K.H. Muller, and B.C. McBride. Sequence analysis, expression, and binding activity of recombinant major outer sheath protein (Msp) of Treponema denticola. J. Bacteriol. 178:2489–2497.
28 Fraser CM, Norris SJ, Weinstock GM, White O, Sutto GG, Dodson R, Gwinn M, Hickey EK, Clayton R, Ketchum KA et al.. Complete genome sequence of Treponema pallidum, the syphilis spirochete, Science, 1998, 281, 375–388.
29 Stebeck CE, Shaffer JM, Arrol TW, Lukehart SA & Van Voorhis WC. Identification of the Treponema pallidum subsp. pallidumglycerophosphodiester phosphodiesterase homologue, FEMS Microbiol Lett, 1997, 154, 303–310.[Medline]
30 Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
31 Baker-Zander SA, Shaffer JM & Lukehart SA. VDRL antibodies enhance phagocytosis of Treponema pallidumby macrophages, J Infect Dis, 1993, 167, 1100–1105.[Medline]
32 Thompson JD, Higgins DG & Gibson TJ. Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties, and weight matrix choice, Nucleic Acids Res, 1994, 22, 4673–4680.
33 Kroll DJ, Abdel-Malek H, Abdel-Hafiz, Marcell T, Simpson S, Chen CY, Guiterrez-Hartmann A, Lustbader JW & Hoeffler JP. A multifunctional prokaryotic protein expression system: overproduction, affinity purification, and selective detection, DNA Cell Biol, 1993, 12, 441–453.[Medline]
34 Shaffer JM, Baker-Zander SA & Lukehart SA. Opsonization of Treponema pallidumis mediated by IgG antibodies induced only by pathogenic treponemes, Infect Immun, 1993, 61, 781–784.
35 Turner TB, Hardy PH & Newman B. Infectivity tests in syphilis, Br J Vener Dis, 1969, 45, 183–196.[Medline]
35 Stamm LV, Greene SR, Bergen HL, Hardham JM & Barnes NY. Identification and sequence analysis of Treponema pallidum tprJ, a member of a polymorphic multigene family, FEMS Microbiol Lett, 1998, 169, 155–163.[Medline]
36 Donelson JE. Mechanisms of antigenic variation in Borrelia hermsiiand African trypanosomes, J Biol Chem, 1995, 270, 7783–7786.
37 Zhang J-R, Hardham JM, Barbour AG & Norris SJ. Antigenic variation in Lyme disease Borreliae by promiscuous recombination of VMP-like sequence cassettes, Cell, 1997, 89, 275–285.[Medline]
38 Lukehart SA, Shaffer JM & Baker-Zander SA. A subpopulation of Treponema pallidumis resistant to phagocytosis: possible mechanisms of persistence, J Infect Dis, 1992, 166, 1449–1453.[Medline]
39 Hinnebusch BJ, Barbour AG, Restrepo BI & Schwan TG. Population structure of the relapsing fever spirochete Borrelia hermsiias indicated by polymorphism of two multigene families that encode immunogenic outer surface lipoproteins, Infect Immun, 1998, 66, 432–440.
40 Barbour AG, Burman N, Carter CJ, Kitten T & Bergstrom S. Variable antigen genes of the relapsing fever agent Borrelia hermsiiare activated by promoter addition, Mol Microbiol, 1991, 5, 489–493.[Medline]
41 Meier JT, Simon MI & Barbour AG. Antigenic variation is associated with DNA rearrangements in a relapsing fever Borrelia. , Cell, 1985, 41, 403–409.[Medline]
42 Plasterk RHA, Simon MI & Barbour AG. Transposition of structural genes to an expression sequence on a linear plasmid causes antigenic variation in the bacterium Borrelia hermsii. , Nature, 1985, 318, 257–263.[Medline]
43 Cadavid D, Thomas DD, Crawley R & Barbour AG. Variability of a bacterial surface protein and disease expression in a possible mouse model of systemic Lyme Borreliosis, J Exp Med, 1994, 179, 631–642.
44 Pillay A, Liu H, Chen CY, Holloway B, Sturm AW, Steiner B & Morse SA. Molecular subtyping of T. pallidum subsp. pallidum. , Sex Transm Dis, 1997, 25, 408–414.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|