|
||
By



§
¶
From the Division of Developmental and Clinical Immunology, * Department of Pathology,
Department of Microbiology, § Department of Pediatrics, and
Department of Medicine, University of
Alabama at Birmingham, and the ¶ Howard Hughes Medical Institute, Birmingham, Alabama
35294; and the ** Laboratory of Molecular Genetics and Immunology, The Rockefeller University,
New York 10021
| |
Abstract |
|---|
|
|
|---|
PIR-A and PIR-B, paired immunoglobulin-like receptors encoded, respectively, by multiple
Pira genes and a single Pirb gene in mice, are relatives of the human natural killer (NK) and Fc receptors. Monoclonal and polyclonal antibodies produced against a recombinant PIR protein
identified cell surface glycoproteins of ~85 and ~120 kD on B cells, granulocytes, and macrophages. A disulfide-linked homodimer associated with the cell surface PIR molecules was
identified as the Fc receptor common
(FcR
c) chain. Whereas PIR-B fibroblast transfectants
expressed cell surface molecules of ~120 kD, PIR-A transfectants expressed the ~85-kD molecules exclusively intracellularly; PIR-A and FcR
c cotransfectants expressed the PIR-A/
FcR
c complex on their cell surface. Correspondingly, PIR-B was normally expressed on the
cell surface of splenocytes from FcR
c
/
mice whereas PIR-A was not. Cell surface levels of
PIR molecules on myeloid and B lineage cells increased with cellular differentiation and activation. Dendritic cells, monocytes/macrophages, and mast cells expressed the PIR molecules in
varying levels, but T cells and NK cells did not. These experiments define the coordinate cellular expression of PIR-B, an inhibitory receptor, and PIR-A, an activating receptor; demonstrate the requirement of FcR
c chain association for cell surface PIR-A expression; and suggest that the level of FcR
c chain expression could differentially affect the PIR-A/PIR-B
equilibrium in different cell lineages.
chain;
activating receptor;
inhibitory receptor;
dendritic cells;
innate immunity
| |
Introduction |
|---|
|
|
|---|
The paired immunoglobulin-like receptors (PIR)1-A
and -B have been identified recently in mice on the
basis of their homology with the human Fc
receptor
(Fc
R) (1, 2). PIR-A and PIR-B share sequence similarity
with a gene family that includes human Fc
R and killer inhibitory receptors (KIR), mouse gp49, bovine Fc receptor
for IgG (Fc
R), and the recently identified human Ig-like
transcripts (ILT)/leukocyte Ig-like receptors (LIR)/monocyte/macrophage Ig-like receptors (MIR) (3). The Pira
and Pirb genes are located on mouse chromosome 7 in a region syntenic with the human chromosome 19q13 region
that contains the Fc
R, KIR, and ILT/LIR/MIR genes (1,
4, 5, 9, 11). DNA sequences for PIR-A and PIR-B predict type I transmembrane proteins with similar ectodomains (>92% homology) each containing six Ig-like
domains. However, PIR-A and PIR-B have distinctive
membrane proximal, transmembrane, and cytoplasmic regions. The PIR-B protein, encoded by the Pirb gene (1,
13, 15), has a typical uncharged transmembrane region and
a long cytoplasmic tail with multiple candidate immunoreceptor tyrosine-based inhibitory motifs (ITIMs). Recent
studies have demonstrated the inhibitory function of the
two most membrane-distal ITIM units in the PIR-B cytoplasmic region (16, 17). The PIR-B inhibitory function is
mediated through ITIM recruitment of the protein tyrosine phosphatase SHP-1 (16, 17). Conversely, the predicted PIR-A protein has a short cytoplasmic tail and a
charged arginine residue in its transmembrane region, suggesting possible association with transmembrane proteins
containing immunoreceptor tyrosine-based activation motifs (ITAMs) to form a signal-transducing unit. In addition,
the PIR-A receptors, which are encoded by multiple Pira
genes, display sequence diversity in their extracellular regions.
In this study, monoclonal and polyclonal antibodies specific for common epitopes on PIR-A and PIR-B molecules were used to characterize these cell surface receptors
and the cellular distribution of their expression in normal
and Fc receptor common
chain (FcR
c)-deficient mice.
The results indicate an essential role for PIR-A association with the FcR
c for cell surface expression on B lineage,
myeloid, and dendritic cells.
| |
Materials and Methods |
|---|
|
|
|---|
Cell Preparation.
Bone marrow cells were isolated from the femur by flushing with media, and the erythrocytes lysed in a 0.1 M ammonium chloride buffer solution at pH 7.4. Splenocytes were prepared by splenic disruption, gentle teasing, and density gradient centrifugation over Lympholyte®-M (Accurate Chemistry & Science Corp.). Splenic B cells were enriched by depletion of Mac-1+ macrophages and granulocytes and of CD3+ T cells by a panning method (18). Granulocytes were isolated from peritoneal exudates induced by prior injection of 0.4% (wt/vol) calcium caseinate (Spectrum Quality Products, Inc.).Preparation of Recombinant PIR Protein.
The PIR extracellular domains EC1 and EC2 were amplified by PCR using Taq DNA polymerase and the PIR-A1 cDNA as the template. The forward primer, 5'-GCACGGATCCCTCCCTAAGCCTATCCTCAGA-3', corresponds with the 5' side of the EC1 (the BamHI site is underlined), and the reverse primer 5'-TATCGATAAGCTTGAGACCAGGAGCTCCA-3', with the 3' side of the EC2 (the HindIII site being underlined). The ~570-bp products were purified by agarose gel electrophoresis, digested with BamHI and HindIII, and ligated into the pQE30 expression vector (Qiagen) which was used to transform Escherichia coli, strain M15. The His-tagged PIR-A1 EC1/EC2 protein produced by transformed M15 cells after induction with 1 mM isopropyl-
-D-thiogalactopyranoside was purified on an affinity column
(Ni-nitrilo-tri-acetic acid resin; Qiagen), eluted with 8 M urea/0.1
M acetate buffer, pH 4.5, and renatured by dialysis against PBS.
Production of Monoclonal and Polyclonal Antibodies.
Lewis rats were immunized five times at weekly intervals with 50 µg of purified PIR-A1 EC1/EC2 protein. The rats were then boosted with the WEHI3 myeloid cell line (107 cells), which expresses PIR-A and PIR-B transcripts (1), a day before fusion of regional lymph node cells with the Ig nonproducing murine plasmacytoma cell line (Ag8.653) (19). Hybridoma culture supernatants were screened for reactivity with the recombinant protein by ELISA using alkaline phosphatase-labeled goat antibodies specific for rat Ig (Southern Biotechnology Associates). ELISA reactive supernatants were examined for immunofluorescence cell surface reactivity with the PIR+ WEHI3 and PIR
M1 cell lines using
PE-labeled goat antibodies specific for rat Ig. Selected hybridoma
clones were subcloned by limiting dilution in the presence of
rIL-6 (1 U/ml; GIBCO BRL). Ig isotypes of the mAbs were determined with a rat mAb ELISA kit (Zymed Co.). Anti-PIR mAbs purified from culture supernatants by protein-G affinity columns were labeled with PE or biotin. A New Zealand White
rabbit was hyperimmunized with the recombinant PIR-A1 EC1/
EC2 protein (50 µg, six times) over a 2-mo period, and the antiserum collected 10 d after the final immunization.
Transfection.
Expression vectors were constructed by digesting the original PIR-A1 and PIR-B cDNAs in the Bluescript phagemid vector with XbaI, filling the recessed 3' termini with Klenow fragment, redigesting with XhoI, and separation by agarose gel electrophoresis. The separated XbaI (blunt ended)/XhoI fragments, ~3.4 kb for PIR-A1 and ~2.7 kb for PIR-B, were excised, purified, and ligated into the pcDNA3 expression vector that was predigested with EcoRV and XhoI and dephosphorylated with calf intestinal alkaline phosphatase to construct pcDNA3-PIR-A1 and pcDNA3-PIR-B. Since both PIR-A1 and PIR-B cDNAs contained additional ATG sites located upstream of the initiation codon, the 5' untranslated regions were removed and replaced by Kozak sequence (20). This was accomplished by 67mer complementary oligonucleotides: the forward 5'-AGCT T GCCGCCACCATGTCCTGCACCTTCACAGCCCTGCTCCGTCTTGGACTGACTCTGAGCCTCTG-3' and the reverse 5'-GATCCAGAGGCTCAGAGTCAGTCCAAGACGGAGCAGGGCTGTGAAGGTGC AGGACAT- GGTGGCGGCA-3'; italic, underlined, and bold letters correspond with the cohesive ends of HindIII or BamHI, the Kozak sequence, and the signal sequence of both PIR-A1 and PIR-B cDNAs, respectively. The 5'-hydroxyl termini of both oligonucleotides were phosphorylated by T4 polynucleotide kinase, annealed, and ligated into the pcDNA3-PIR-A1 and pcDNA3-PIR-B expression vectors, from which the 100-200-bp HindIII/ BamHI fragments corresponding with the 5' untranslated region and a part of the signal sequence of PIR-A1 and PIR-B cDNAs had been excised. After confirming the nucleotide sequences of the resultant PIR-A1 and PIR-B expression vectors, the plasmid DNAs were linearized by digesting with PvuI, transfected into LTK fibroblasts with the aid of lipofectin, and stable transfectants selected by Geneticin (G418) exposure. For cotransfection of a murine FcR
c into the PIR-A1-transfected fibroblasts, the FcR
c expression vector was constructed by ligating the ~400-bp FcR
c coding sequence from the original pcEXV-3 vector (21) into EcoRI-digested pBluescript II
cloning vector. The pBlue-FcR
c construct with a correct orientation was digested with BamHI and XhoI to remove the
FcR
c fragment, before ligation into the pcDNA3.1/Hygro(+)
expression vector. The resulting expression vector pcDNA3.1/
Hygro-FcR
c was then linearized with AviII and transfected
with the aid of Superfect into LTK fibroblasts which had been already transfected with PIR-A1. Stable cotransfectants were selected by Geneticin (G418) and Hygromycin B.
Western Blot Analysis.
B cells and myeloid cells (5 × 107 cells/sample) and PIR-A or PIR-B transfected LTK cells (106) were lysed in 500 µl of lysis buffer (1% NP-40 in 150 mM NaCl/ 50 mM Tris-HCl, pH 7.5, containing 5 mM EDTA, 20 mM iodoacetamide, 0.1% sodium azide, 20 mM
-amino-caproic acid,
antipain [2 µg/ml], leupeptin [1 µg/ml], soybean trypsin inhibitor [100 µg/ml], aprotinin [2 µg/ml], 1 mM 4-(2-aminoethyl)-
benzenesulfonyl fluoride hydrochloride, chymostatin [2.5 µg/ml],
and pepstatin [1 µg/ml]). A solid-phase immunoisolation technique (SPIT) (22) was used to identify anti-PIR reactive molecules in cell lysates precleared by centrifugation. In brief, 96-well
plates were coated with goat antibodies to rat Ig and then with rat
anti-PIR or isotype-matched control mAbs before incubation
with cell lysates overnight at 4°C. After extensive washing,
bound molecules were dissociated by addition of 2% SDS, resolved by SDS-PAGE, transferred onto nitrocellulose membranes by electroblotting, incubated sequentially with rabbit anti-PIR antiserum (1:2,000 dilution) and horseradish peroxidase-labeled goat anti-rabbit Ig antibody (0.25 µg/ml; Southern Biotechnology Associates), and visualized by enhanced chemiluminescence
(Amersham Life Science). In other experiments, blotted membranes were incubated with rabbit antibodies against FcR
c (gift
of Drs. Robert P. Kimberly and Jeffery C. Edberg, University of
Alabama at Birmingham, Birmingham, AL).
Immunoprecipitation of Cell Surface Proteins.
Viable cells (~3 × 107) were surface labeled with 1 mCi of Na125I by the lactoperoxidase method (23) and solubilized in ~500 µl of 1% NP-40 or 1% digitonin lysis buffers. After centrifugation, iodinated PIR molecules were isolated by SPIT, separated on SDS-PAGE (8-15% acrylamide) under reducing and nonreducing conditions, and the dried gels exposed to x-ray films (24). Alternatively, isolated PIR molecules were analyzed by nonreducing/reducing diagonal SDS-PAGE (25). In other experiments, cell surface PIR molecules were digested with N-glycanase (Oxford Glycosciences) before SDS-PAGE analysis (24).Immunofluorescence Analysis.
Cells were incubated with aggregated human IgG to block Fc
Rs, then stained with PE-labeled
anti-PIR mAbs and a combination of FITC-, cychrome (CY)-,
allophycocyanin, or biotin-labeled mAbs specific for B220
(CD45R), CD19, CD21, CD23, CD43, or CD5 for B-lineage
cells; CD3, CD4, or CD8 for T-lineage cells; Mac-1 (CD11b) or
Gr-1 for myeloid lineage cells; DX5 antigen for pan NK cells; CD11c for dendritic cells; and Ter-119 for erythroid lineage cells (PharMingen). Other reagents included FITC-labeled goat anti- mouse µ chain antibody and isotype-matched control mAbs labeled with PE, FITC, CY, or biotin (Southern Biotechnological
Associates). Stained cells were analyzed with a FACScan® flow
cytometry instrument (Becton Dickinson).
| |
Results |
|---|
|
|
|---|
Recombinant PIR protein containing the two NH2-terminal Ig-like extracellular domains, EC1 and EC2, in
the PIR-A1 molecule was produced in E. coli. The PIR-A1 EC1/EC2 recombinant protein was selected to immunize rats because of its sequence identity with PIR-B (1). 1 d
before fusion of regional lymph node cells to produce
hybridomas, the immunized rats were boosted with viable WEHI3 myeloid cells to enhance the possibility of obtaining
antibodies that recognize epitopes on native PIR molecules.
33 hybridoma clones produced antibodies that reacted by
ELISA with the recombinant PIR-A1 EC1/EC2 protein.
Cell surface immunofluorescence analysis indicated that one
of the antibodies, 6C1 (
1
), was reactive with PIR-B-transfected LTK fibroblasts and the WEHI3 myeloid cell line
(Fig. 1). This mAb was unreactive with mock-transfected
LTK fibroblasts and the M1 myeloblastoid cell line that lack
PIR-A and PIR-B transcripts. Binding of the 6C1 antibody to the WEHI3 cells was inhibited by the recombinant
PIR-A1 EC1/EC2 protein in a dose-dependent manner.
The recombinant PIR-A1 EC1/EC2 protein was also used
to produce a rabbit antiserum, the specificity of which was
indicated by ELISA and by Western blot assays of the native
PIR-A and PIR-B proteins described below.
|
When iodinated cell surface proteins on splenocytes, B cell lines, and macrophage cell lines were examined by SDS-PAGE, the anti-PIR antibodies identified two major species of ~85 and ~120 kD with minor bands of slightly lower molecular masses (Fig. 2 A). Slightly higher molecular masses were evident under reducing conditions, ~90 and ~125 kD, respectively, consistent with predicted intradisulfide linkages of the six Ig-like extracellular domains. N-glycanase treatment reduced their apparent molecular masses by 10-15 kD in keeping with the presence of five to six potential N-linked glycosylation sites in the PIR-A and PIR-B molecules (Fig. 2 B). Two- dimensional electrophoretic analysis under nonreducing and reducing conditions confirmed that the ~85 and ~120-kD proteins identified on splenocytes by the anti-PIR antibodies did not exist as covalently linked molecules (not shown). B cells purified from the spleen and granulocytes purified from peritoneal exudates also expressed ~85 and ~125-kD molecules (Fig. 2 C). These findings indicate that cell surface PIR molecules are glycoproteins of ~85 and ~120 kD, and that both molecular species are expressed by clonal B and myeloid cells.
|
Since the monoclonal and polyclonal antibodies recognize epitopes present on both PIR-A and PIR-B molecules, mouse LTK cells transfected either with PIR-A1 or PIR-B cDNAs were used for discrimination of the PIR molecules. A major band of ~120 kD, together with a faint band of ~97 kD, was immunoprecipitated by the 6C1 anti-PIR mAb from lysates of the PIR-B transfectants, and not from lysates of mock transfectants probed by immunoblotting with the rabbit anti-PIR antibodies (Fig. 2 C). Conversely, the anti-PIR mAb precipitated a major band of ~85 kD and a minor band of ~70 kD from cell lysates of the PIR-A1 transfectants. The two major bands of 85 and 120 kD were also identified by the 6C1 mAbs and the rabbit anti-PIR antibodies in normal splenocytes, B cell, and myeloid cell lines, all of which express Pira and Pirb transcripts (1). The 6C1 anti-PIR mAb and the rabbit antiserum against recombinant PIR EC1/EC2 protein thus recognize native PIR-A and PIR-B molecules, the major species of which have relative molecular masses of ~85 and ~120 kD, respectively.
PIR-A Association with FcR
c.
The PIR-A protein has
a short cytoplasmic tail without recognizable functional
motifs, but the presence of a charged amino acid, arginine,
in the transmembrane region suggested its potential association with another transmembrane protein (1). Inferential evidence in support of this possibility was provided by
studies of the cell surface proteins expressed by PIR-A and
PIR-B fibroblast transfectants. A major band of ~120 kD
was identified on the cell surface of PIR-B transfected LTK
cells by the 6C1 antibodies (not shown), whereas the ~85
and ~70-kD molecules expressed by PIR-A1 transfectants
(see Fig. 2 C) were identified only intracellularly. Cell surface PIR-A molecules were not identified by the anti-PIR mAb on PIR-A transfectants, thereby implying that PIR-A
requires companion molecules, not present in fibroblasts, to
reach the cell surface. Accordingly, two-dimensional analysis of the proteins precipitated with the 6C1 anti-PIR antibody from iodinated cell surface proteins on splenocytes
revealed an associated homodimer composed of relatively
small disulfide-linked subunits (~10 kD, not shown). Immunoblots of the cell surface PIR complex separated under
reducing conditions by SDS-PAGE identified these associated proteins as FcR
c (Fig. 3 B).
|
The requirement of FcR
c association for the cell surface expression of PIR-A was examined by fibroblast
cotransfection experiments. While PIR-A producing transfectants failed to express this product on the cell surface, fibroblasts cotransfected with the PIR-A and FcR
c constructs expressed readily detectable PIR-A on the cell
surface (Fig. 3 A). The apparent requirement of FcR
c for cell surface expression of PIR-A molecules was examined
further by the analysis of FcR
c chain-deficient (FcR
c
/
)
mice. While splenocytes from the wild-type mice expressed both PIR-A and PIR-B on the cell surface, only
the PIR-B was identified on the cell surface of splenocytes
in FcR
c
/
mice (Fig. 3 B). This selective impairment of
PIR-A cell surface expression in FcR
c
/
mice was not
attributable to a lack of PIR-A production, since the 6C1
mAb identified both the 85-kD PIR-A and the 120-kD
PIR-B molecules within FcR
c
/
splenocytes. Therefore, these findings indicate that FcR
c chains are required
for the cell surface expression of PIR-A molecules.
When bone marrow cells from adult
mice were incubated with the fluorochrome-labeled 6C1
anti-PIR mAb, ~80% of the nucleated cells were stained.
Morphological analysis of isolated PIR+ cells indicated that
most were myeloid cells, ranging from immature myeloblasts to mature granulocytes, whereas lymphocytes represented a minor constituent. When differential immunofluorescence analysis for other cell surface differentiation
antigens was conducted to further characterize the PIR+
cells, bone marrow cells bearing the Gr-1 and Mac-1
(CD11b, CR3) myelomonocytoid antigens were found to
express the PIR antigen at variable levels that correlated with
Gr-1 expression levels (Fig. 4, first row). Examination of the
morphological features of isolated PIRlo/Gr-1lo and PIRhi/
Gr-1hi fractions confirmed the increase in PIR and Gr-1 expression with progression of granulocyte differentiation. The
B-lineage cells in bone marrow expressed PIR at lower levels relative to the myeloid cells, and most of the PIR+ B-lineage cells (CD19+) were IgM+ B cells; pro-B were PIR
negative while pre-B cells were found to express PIR at low
levels (Fig. 4, second and third rows), indicating a gradual increase in PIR expression as a function of B-lineage differentiation. Bone marrow-derived, IL-3-induced mast cells
(c-kit+) also expressed PIR on their cell surface. PIR proteins were not detected on erythroid lineage cells (Ter119+)
in the bone marrow. CD3+ thymocytes from newborn and
adult BALB/c mice were PIR negative. In striking contrast,
thymic dendritic cells (MHC class II+, CD11c+, CD8+,
CD3
, CD4
, CD19
, Mac-1
, Fc
RII/III
) expressed PIR
from relatively low to high levels (Fig. 5).
|
|
Splenic B cells and macrophages expressed the PIR antigen on their cell surface, whereas NK cells and T cells did
not (Fig. 4, fourth row), results consistent with the expression patterns noted for PIR-A and PIR-B transcripts in
these cell types (1). PIR expression was higher on myeloid
lineage cells than on splenic B cells, the latter bearing the
6C1-identified PIR molecules in highly variable levels.
When subpopulations of splenic B cells were evaluated, the
marginal zone B cells (B220+, CD21high, CD23low/
) were
found to express higher PIR levels than newly formed
(B220+, CD21
, CD23
) and follicular B cells (B220+,
CD21med, CD23+) (Fig. 4, fifth row). Moreover, the B1
subpopulations of B cells in peritoneal lavage expressed
higher levels of PIR than did the B2 cells (Fig. 4, sixth
row). Consistent with this suggestive evidence that B cell
activation may enhance PIR expression, cell surface levels
of PIR were upregulated by ~33% after LPS stimulation of splenic B cells, and macrophage PIR expression was
similarly enhanced by LPS stimulation. Splenic dendritic
cells (MHC class II+, CD11c+, CD19
, Mac-1
, CD8+/
,
Fc
RII/III
), like thymic dendritic cells, were found to express relatively low to relatively high levels of PIR (Fig. 5).
c
/
mice.
Since cell surface expression of PIR-A was selectively impaired in FcR
c-deficient mice, PIR-B expression relative to total PIR-A/PIR-B expression could be estimated by immunofluorescence comparison of the cells
from FcR
c-deficient and wild-type mice. Cell surface
PIR-B expression alone was thereby found to increase in
the FcR
c-deficient mice as a function of both myeloid
and B lineage differentiation (Fig. 6).
|
| |
Discussion |
|---|
|
|
|---|
The monoclonal and polyclonal anti-PIR-A/PIR-B antibodies described here define the cell surface PIR-A and PIR-B receptors as glycoproteins of ~85 and ~120 kD, respectively. The ~120-kD estimate for PIR-B agrees with that obtained using a rabbit antiserum against a p91/ PIR-B cytoplasmic peptide (2). In the present studies, the coordinate or paired expression of PIR-A and PIR-B by B and myeloid cells suggested by transcriptional analysis (1) was confirmed by demonstration of both molecules on representative clonal cell lines. Given the finding of splice variants among PIR-A cDNAs (1), we anticipated considerable size heterogeneity of the PIR-A proteins. Contrary to this expectation, the cell surface PIR-A and PIR-B receptors were relatively homogeneous in size, and the predominant protein species were physically indistinguishable in different cell types (B cells versus macrophages) and cell sources (cell lines versus splenocytes). The products of splice variant PIR-A cDNAs thus appear to comprise only a minor fraction of the total PIR-A pool. The PIR-A and PIR-B cDNA sequences indicate an additional free Cys residue in their ectodomains (1), thus suggesting the possible existence of disulfide-linked dimers of the PIR-A and PIR-B molecules. However, disulfide linkage of these molecules was not evident in either one- or two-dimensional gel electrophoresis analyses. It is still theoretically possible that cell surface PIR-A and PIR-B molecules could form noncovalent associations with functional consequence.
Intriguingly, the anti-PIR mAb recognized the PIR-B
cell surface receptor on PIR-B transfectants, whereas PIR-A
cell surface molecules could not be detected on PIR-A1
producing transfectants. This finding implied the requirement for additional membrane-bound protein(s) for PIR-A
cell surface expression, a possibility that was also suggested
by the presence of a charged Arg residue in the transmembrane region of the predicted PIR-A1 protein (1). There
are well documented precedents for the noncovalent association of Ig-like receptor chains containing such charged
transmembrane regions with another membrane-bound
protein for cell surface expression and/or function. These
include (a) the association of ligand-binding
chain of several Fc receptors (Fc
R, Fc
RI, Fc
RIII, Fc
R) with signal transducing subunits (
,
, or
); (b) the TCR/CD3
complexes; and (c) the killer activating receptor/dendritic
associated protein-12 or killer activating receptor associating protein complexes (20, 26). In these examples, the
associated proteins typically contain ITAMs in their cytoplasmic domains (31, 39). Our immunoprecipitation analysis indicated that the ITAM-containing FcR
c is associated with PIR molecules present on the cell surface. The
implication that the FcR
c is essential for PIR-A cell surface expression was confirmed in fibroblast cotransfection
studies and by the selective expression of PIR-B molecules
on B cells and myeloid cells in FcR
c-deficient mice. In
studies reported since submission of this manuscript, a cell
activation for the PIR-A/FcR
c complex has been demonstrated in rat mast cell line and chicken B cell line transfected with constructs for chimeric proteins containing the
PIR-A transmembrane and cytoplasmic regions (43, 44).
The restricted expression of PIR molecules by B and myeloid lineage cells indicated by our immunofluorescence analysis is consistent with previous analyses of PIR-A and PIR-B transcripts (1, 2). Cell surface PIR expression was found to increase as a function of cellular differentiation in both cell lineages, indicating that the PIR family is primarily involved in mature cell function. The levels of PIR-A/ PIR-B expression by splenic B cells were remarkably variable. Examination of the different splenic subpopulations indicated that the expression levels were highest on marginal zone B cells, which appear to be primed cells (45). Correspondingly, the B1 subpopulations of B cells expressed higher PIR levels than did the B2 subpopulation. The suggestion that activated B cells may express higher PIR levels was supported by the observation that LPS stimulation enhanced B cell and myeloid cell expression of the PIR molecules, in keeping with the presence of potential binding sites for the LPS- or IL-6-dependent DNA-binding protein in the promoter region of the Pirb gene (15).
In addition to B cells and myeloid lineage cells, the dendritic cells in the thymus and spleen, defined as MHC class
II+ CD11c+ CD8+/
CD4
CD19
Mac-1
, were also
found to express the PIR molecules on their surface. This
finding suggests that the variable PIR-A molecules and invariant PIR-B molecules could be involved in self/non-self
discrimination or antigen presentation. The human Ig-like
ILT/LIR/MIR receptors, which share 50-60% sequence
similarity with mouse PIR, are also expressed by B cells,
monocyte/macrophages, and dendritic cells, but, unlike the
murine PIR molecules, these human relatives may also be
expressed by NK cells and a subpopulation of T cells (9, 11,
46). Some members of the human ILT/LIR/MIR family
have been shown to bind classical or nonclassical MHC
class I alleles (10, 46). Although the ligand or ligands for
the PIR molecules are presently unknown, their pattern of
expression on myeloid, lymphoid, and dendritic cells suggests that, like other Ig-like cell surface receptors, they may
coligate with other activation/inhibitory systems to modulate inflammatory and immune responses. In this regard,
these results suggest that the PIR-A requirement for FcR
c association could result in differential regulation of the
PIR-A/PIR-B equilibrium as a function of cellular activation or differentiation pathway.
| |
Footnotes |
|---|
Address correspondence to Hiromi Kubagawa, 378 WTI, Department of Pathology, University of Alabama at Birmingham, Birmingham, AL 35294-3300; Phone: 205-934-3370; Fax: 205-975-7218; E-mail: hkubagawa{at}ccc.uab.edu
Received for publication 31 August 1998 and in revised form 2 November 1998.
H. Kubagawa and C.-C. Chen contributed equally to this work.We thank Drs. Peter D. Burrows and Chen-lo Chen for helpful discussion and suggestions, Dr. Suzanne M. Michalek for providing rats, and Marsha Flurry and E. Ann Brookshire for editorial assistance.
This work was supported in part by National Institute of Allergy and Infectious Diseases grants AI42127 (H. Kubagawa), AI39816 (M.D. Cooper) and AI34662 (J.V. Ravetch). M.D. Cooper is an investigator of the Howard Hughes Medical Institute.
Abbreviations used in this paper
CY, cychrome;
EC, extracellular domain;
Fc
R, Fc receptor for IgA;
Fc
R, Fc receptor for IgG;
FcR
c, Fc receptor common
chain;
ILT, Ig-like transcript;
ITAM, immunoreceptor tyrosine-based activation motif;
ITIM, immunoreceptor tyrosine-based inhibitory motif;
KIR, killer inhibitory receptor;
LIR, leukocyte Ig-like
receptor;
MIR, monocyte/macrophage Ig-like receptor;
PIR, paired Ig-like receptor;
SPIT, solid-phase immunoisolation technique.
| |
References |
|---|
|
|
|---|
| 1. |
Kubagawa, H.,
P.D. Burrows, and
M.D. Cooper.
1997.
A
novel pair of immunoglobulin-like receptors expressed by B
cells and myeloid cells.
Proc. Natl. Acad. Sci. USA.
94:
5261-5266
|
| 2. |
Hayami, K.,
D. Fukuta,
Y. Nishikawa,
Y. Yamashita,
M. Inui,
Y. Ohyama,
M. Hikida,
H. Ohmori, and
T. Takai.
1997.
Molecular cloning of a novel murine cell-surface glycoprotein homologous to killer cell inhibitory receptors.
J.
Biol. Chem.
272:
7320-7327
|
| 3. | Maliszewski, C.R., C.J. March, M.A. Shoenborn, S. Gimpel, and L. Shen. 1990. Expression cloning of a human Fc receptor for IgA. J. Exp. Med. 190: 1665-1672 . |
| 4. |
Colonna, M., and
J. Samaridis.
1995.
Cloning of immunoglobulin-superfamily members associated with HLA-C and
HLA-B recognition by human natural killer cells.
Science.
268:
405-408
|
| 5. | Wagtmann, N., R. Biassoni, C. Cantoni, S. Verdiani, M.S. Malnati, M. Vitale, C. Bottino, L. Moretta, A. Moretta, and E.O. Long. 1995. Molecular clones of the p58 NK cell receptor reveal immunoglobulin-related molecules with diversity in both the extra- and intracellular domains. Immunity. 2: 439-449 [Medline]. |
| 6. | D'Andrea, A., C. Chang, K. Franz-Bacon, T. McClanahan, J.H. Phillips, and L.L. Lanier. 1995. Molecular cloning of NKB1: a natural killer cell receptor for HLA-B allotypes. J. Immunol. 155: 2306-2310 [Abstract]. |
| 7. |
Arm, J.P.,
M.F. Gurish,
D.S. Reynolds,
H.C. Scott,
C.S. Gartner,
K.F. Austen, and
H.R. Katz.
1991.
Molecular cloning of gp49, a cell-surface antigen that is preferentially expressed by mouse mast cell progenitors and is a new member
of the immunoglobulin superfamily.
J. Biol. Chem.
266:
15966-15973
|
| 8. |
Zhang, G.,
J.R. Young,
C.A. Tregaskes,
P. Sopp, and
C.J. Howard.
1995.
Identification of a novel class of mammalian
Fc receptor.
J. Immunol.
155:
1534-1541
[Abstract].
|
| 9. | Samaridis, J., and M. Colonna. 1997. Cloning of novel immunoglobulin superfamily expressed on human myeloid and lymphoid cells: structural evidence for new stimulatory and inhibitory pathways. Eur. J. Immunol. 27: 660-665 [Medline]. |
| 10. | Cosman, D., N. Fanger, L. Borges, M. Kubin, W. Chin, L. Peterson, and M. Hsu. 1997. A novel immunoglobulin superfamily receptor for cellular and viral MHC class I molecules. Immunity. 7: 273-282 [Medline]. |
| 11. | Wagtmann, N., S. Rojo, E. Eichler, H. Mohrenweiser, and E.O. Long. 1997. A new human gene complex encoding the killer cell inhibitory receptors and related monocyte/macrophage receptors. Curr. Biol. 7: 615-618 [Medline]. |
| 12. |
Arm, J.P.,
C. Nwankwo, and
K.F. Austin.
1997.
Molecular
identification of a novel family of human Ig superfamily
members that possess immunoreceptor tyrosine-based inhibition motifs and homology to the mouse gp49B1 inhibitory
receptor.
J. Immunol.
159:
2342-2349
|
| 13. |
Yamashita, Y.,
D. Fukuta,
A. Tsuji,
A. Nagabukuro,
Y. Matsuda,
Y. Nishikawa,
Y. Ohyama,
H. Ohmori,
M. Ono, and
T. Takai.
1998.
Genomic structures and chromosomal location of p91, a novel murine regulatory receptor family.
J.
Biochem.
123:
358-368
|
| 14. | Kremer, E.J., V. Kalatzis, E. Baker, D.F. Callen, G.R. Sutherland, and C.R. Maliszewski. 1992. The gene for the human IgA Fc receptor maps to 19q13. Hum. Genet. 89: 107-108 [Medline]. |
| 15. | Alley, T.L., M.D. Cooper, M. Chen, and H. Kubagawa. 1998. Genomic structure of PIR-B, the inhibitory member of the paired immunoglobulin-like receptor genes in mice. Tissue Antigens. 51: 224-231 [Medline]. |
| 16. |
Bléry, M.,
H. Kubagawa,
C. Chen,
F. Vély,
M.D. Cooper, and
E. Vivier.
1998.
The paired Ig-like receptor PIR-B is an
inhibitory receptor that recruits the protein-tyrosine phosphatase SHP-1.
Proc. Natl. Acad. Sci. USA.
95:
2446-2451
|
| 17. |
Maeda, A.,
M. Kurosaki,
M. Ono,
T. Takai, and
T. Kurosaki.
1998.
Requirement of SH2-containing protein tyrosine
phosphatases SHP-1 and SHP-2 for paired immunoglobulin-like receptor B (PIR-B)-mediated inhibitory signal.
J. Exp.
Med.
187:
1355-1360
|
| 18. | Mage, M.G., L.L. McHugh, and T.L. Rothstein. 1997. Mouse lymphocytes with and without surface immunoglobulin: preparative scale separation in polysytrene tissue culture dishes coated with specifically purified anti-immunoglobulin. J. Immunol. Methods. 15: 47-51 . |
| 19. |
Kearney, J.F.,
A. Radbruch,
B. Liesegang, and
K. Rajewsky.
1979.
A new mouse myeloma cell line that has lost immunoglobulin expression but permits the construction of antibody-secreting hybrid cell line.
J. Immunol.
123:
1548-1550
|
| 20. | Kozak, M.. 1996. Interpreting cDNA sequences: some insights from studies on translation. Mamm. Genome. 7: 563-574 [Medline]. |
| 21. |
Kurosaki, T.,
I. Gander, and
J.V. Ravetch.
1991.
A subunit
common to an IgG Fc receptor and the T cell receptor mediates assembly through different interactions.
Proc. Natl. Acad.
Sci. USA.
88:
3837-3841
|
| 22. | Kiyotaki, M., M.D. Cooper, L.F. Bertoli, J.F. Kearney, and H. Kubagawa. 1987. Monoclonal anti-Id antibodies react with varying proportions of human B lineage cells. J. Immunol. 138: 4150-4158 [Abstract]. |
| 23. | Goding, J.W.. 1980. Structural studies of murine lymphocyte surface IgD. J. Immunol. 124: 2082-2088 [Medline]. |
| 24. |
Monteiro, R.C.,
M.D. Cooper, and
H. Kubagawa.
1992.
Molecular heterogeneity of Fc receptors detected by receptor-specific monoclonal antibodies.
J. Immunol.
148:
1764-1770
[Abstract].
|
| 25. | Lassoued, K., C.A. Nuñez, L. Billips, H. Kubagawa, R.C. Monteiro, T.W. LeBien, and M.D. Cooper. 1993. Expression of surrogate light chain receptors is restricted to a late stage in pre-B cell differentiation. Cell. 73: 73-86 [Medline]. |
| 26. | Blank, U., C. Ra, L. Miller, K. White, H. Metzger, and J.-P. Kinet. 1989. Complete structure and expression in transfected cells of high affinity IgE receptor. Nature. 337: 187-189 [Medline]. |
| 27. |
Ra, C.,
M.-H. Jouvin,
U. Blank, and
J.-P. Kinet.
1989.
A macrophage Fc receptor and the mast cell receptor for immunoglobulin E share an identical subunit.
Nature.
341:
752-754
[Medline].
|
| 28. |
Lanier, L.L.,
G. Yu, and
J.H. Phillips.
1989.
Co-association
of CD3 with a receptor (CD16) for IgG on human natural
killer cells.
Nature.
342:
803-806
[Medline].
|
| 29. |
Anderson, P.,
M. Caligiuri,
C. O'Brian,
T. Manley,
J. Ritz, and
S. Schlossman.
1990.
Fc RIII (CD16) is included in the
NK receptor complex expressed by human natural killer
cells.
Proc. Natl. Acad. Sci. USA.
87:
2274-2278
|
| 30. |
Ernst, L.K.,
A.-M. Duchemin, and
C.L. Anderson.
1993.
Association of the high affinity receptor for IgG (Fc RI) with
the subunit of the IgE receptor.
Proc. Natl. Acad. Sci. USA.
90:
6023-6027
|
| 31. | Ravetch, J.V.. 1994. Fc receptors: rubor redux. Cell. 78: 553-560 [Medline]. |
| 32. | Clevers, H., B. Alarcon, T. Wileman, and C. Terhorst. 1988. The T cell receptor/CD3 complex: a dynamic protein ensemble. Annu. Rev. Immunol. 6: 629-662 [Medline]. |
| 33. |
Pfefferkorn, L.C., and
G.R. Yeaman.
1994.
Association of
IgA-Fc receptors (Fc R) with Fc RI 2 subunits in U937
cells.
J. Immunol.
153:
3228-3236
[Abstract].
|
| 34. |
Morton, H.C.,
I.E. van den Herik-Oudijk,
P. Vossebeld,
A. Snijders,
A.J. Verhoeven,
P.J.A. Capel, and
J.G.J. van de
Winkel.
1995.
Functional association between the human
myeloid IgA Fc receptor (CD89) and FcR chain. Molecular basis for CD89/FcR chain association.
J. Biol. Chem.
270:
29781-29787
|
| 35. |
Saito, K.,
K. Suzuki,
H. Matsuda,
K. Okumura, and
C. Ra.
1995.
Physical association of Fc receptor homodimer with
IgA receptor.
J. Allergy Clin. Immunol.
96:
1152-1160
[Medline].
|
| 36. | Olcese, L., A. Cambiaggi, G. Semenzato, C. Bottino, A. Moretta, and E. Vivier. 1997. Human killer cell activatory receptors for MHC class I molecules are included in a multimeric complex expressed by natural killer cells. J. Immunol. 158: 5083-5086 [Abstract]. |
| 37. | Lanier, L.L, B.C. Corliss, J. Wu, C. Leong, and J.H. Phillips. 1998. Immunoreceptor DAP12 bearing a tyrosine-based activation motif is involved in activating NK cells. Nature. 391: 703-707 [Medline]. |
| 38. |
Mason, L.H.,
J. Willette-Brown,
S.K. Anderson,
P. Gosselin,
E.W. Shores,
P.E. Love,
J.R. Ortaldo, and
D.W. McVicar.
1998.
Characterization of an associated 16-kDa tyrosine
phosphoprotein required for Ly-49D signal transduction.
J.
Immunol.
160:
4148-4152
|
| 39. | Reth, M.. 1989. Antigen receptor tail clue. Nature. 338: 383-384 [Medline]. |
| 40. | Reth, M.. 1992. Antigen receptors on B lymphocytes. Annu. Rev. Immunol. 10: 97-121 [Medline]. |
| 41. | Weiss, A., and D.R. Littman. 1994. Signal transduction by lymphocyte antigen receptors. Cell. 76: 263-274 [Medline]. |
| 42. | Cambier, J.C.. 1995. Antigen and Fc receptor signaling: the awesome power of the immunoreceptor tyrosine-based activation motif (ITAM). J. Immunol. 155: 3281-3285 [Medline]. |
| 43. |
Maeda, A.,
M. Kurosaki, and
T. Kurosaki.
1998.
Paired immunoglobulin-like receptor (PIR)-A is involved in activating
mast cells through its association with Fc receptor chain.
J.
Exp. Med.
188:
991-995
|
| 44. |
Yamashita, Y.,
M. Ono, and
T. Takai.
1998.
Inhibitory and
stimulatory functions of paired Ig-like receptor (PIR) family
in RBL-2H3 cells.
J. Immunol.
161:
4042-4047
|
| 45. | Oliver, A.M., F. Martin, G.L. Gartland, R.H. Carter, and J.F. Kearney. 1997. Marginal zone B cells exhibit unique activation, proliferative and immunoglobulin secretory responses. Eur. J. Immunol. 27: 2366-2374 [Medline]. |
| 46. |
Colonna, M.,
F. Navarro,
T. Bellón,
M. Llano,
P. García,
J. Samaridis,
L. Angman,
M. Cella, and
M. López-Botet.
1997.
A common inhibitory receptor for major histocompatibility
complex class I molecules on human lymphoid and myelomonocytic cells.
J. Exp. Med.
186:
1809-1818
|
| 47. | Borges, L., M. Hsu, N. Fanger, M. Kubin, and D. Cosman. 1997. A family of human lymphoid and myeloid Ig-like receptors, some of which binds to MHC class I molecules. J. Immunol. 159: 5192-5196 [Abstract]. |
| 48. |
Colonna, M.,
J. Samaridis,
M. Cella,
L. Angman,
R.L. Allen,
C.A. O'Callaghan,
R. Dunbar,
G.S. Ogg,
V. Cerundolo, and
A. Rolink.
1998.
Human myelomonocytic cells express
an inhibitory receptor for classical and nonclassical MHC
class I molecules.
J. Immunol.
160:
3096-3100
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|