|
||
Chain Defines a Novel
TAP-independent Major Histocompatibility Complex
Class Ib-restricted
/
T Cell Subpopulation in Mammals
By




From * Institut National de la Santé et de la Recherche Médicale (INSERM) U25 and
INSERM
U373, Hôpital Necker, 75015 Paris, France; the § Department of Molecular Biology, Princeton
University, Princeton, New Jersey 08540;
Département SIDA-Rétrovirus, Unité d'Immunité
Cellulaire Antivirale, Institut Pasteur, 75724 Paris, France; ¶ CJF-93-42, Établissement de
Transfusion Sanguine, 67065 Strasbourg, France; ** INSERM U463, Institut de Biologie, 44035 Nantes, France; and 
University Paris XI, 94276 Le Kremlin-Bicêtre, France
| |
Abstract |
|---|
|
|
|---|
We describe here a new subset of T cells, found in humans, mice, and cattle. These cells bear a
canonical T cell receptor (TCR)
chain containing hAV7S2 and AJ33 in humans and the homologous AV19-AJ33 in mice and cattle with a CDR3 of constant length. These T cells are
CD4
CD8
double-negative (DN) T cells in the three species and also CD8
in humans. In
humans, their frequency was ~1/10 in DN, 1/50 in CD8
+, and 1/6,000 in CD4+ lymphocytes, and they display an activated/memory phenotype (CD45RAloCD45RO+). They preferentially use hBV2S1 and hBV13 segments and have an oligoclonal V
repertoire suggesting
peripheral expansions. These cells were present in major histocompatibility complex (MHC) class II- and transporter associated with antigen processing (TAP)-deficient humans and mice
and also in classical MHC class I- and CD1-deficient mice but were absent from
2-microglobulin-deficient mice, indicating their probable selection by a nonclassical MHC class Ib molecule distinct from CD1. The conservation between mammalian species, the abundance, and
the unique selection pattern suggest an important role for cells using this novel canonical TCR
chain.
chain;
CD4
CD8
T cells;
humans;
cattle;
mice
| |
Introduction |
|---|
|
|
|---|
Band T lymphocytes display a wide repertoire of antigen
receptors, made by random recombination of V, (D),
and J segments and trimming/addition of nucleotides at the
junctions between these rearranged segments (1). Besides the
mainstream lymphocytes, three different types of cell subpopulations have been described that have a limited repertoire diversity: the B1 B cell subset (2, 3), some
/
T cell
subpopulations (4), and the TCR
/
+ NK1 T cells (5).
Restricted repertoires seem to define discrete lymphocyte
subpopulations at the frontier between innate and adaptive immunity, as these selected repertoires may allow the presence of a high frequency of preexisting cells reactive against
phylogenetically conserved antigens (6, 7). Alternatively,
cells with such a restricted repertoire may play an immunoregulatory role or another physiologic function, such as the
wound healing, that results from the secretion of keratinocyte growth factor (8) by
/
dendritic epithelial cells
(DECs)1 recognizing self-ligands (9).
B1 cells, which appear early during embryonic life, use
recurrent VDJ combinations with few "N" additions (10),
and seem to be selected by endogenous ligands (11). Similarly, some
/
T cell subsets appear early during ontogeny
and use peculiar V-J combinations without N additions
(12). These recurrent sequences seem to be favored by enzymatic constraints linked to the recombination process,
such as homologous region-guided recombination (4). Cells bearing these invariant
/
TCRs seem to be also selected by endogenous ligands as, in mice deficient for these
segments, they are replaced by cells expressing other V
V
combinations but similar clonotypic motifs (13).
NK1 T cells use an "invariant"
chain (mAV14AJ18 in
mice [14], hAV24AJ18 in humans [14, 15]) with a CDR3
of constant length paired with a limited number of V
segments (BV2S1, 7S1, and 8S2 in mice, BV11S1 in humans).
NK1 T cells display peculiar phenotypic characteristics:
they are CD3int, CD4+, or CD4
CD8
(DN), and have
both activation (CD44hi and 3G11lo) and NK markers
(NKRP1, Ly49) (5). In vivo development of NK1 T cells
requires the MHC class Ib CD1d molecule (16), whose expression is
2-microglobulin (
2m) dependent but transporter associated with antigen processing (TAP) independent (17). In both humans and rodents, mature NK1 T
cells recognize some glycolipids (such as
-galactosylceramide) in a CD1d-restricted fashion (18, 19) as well as some
exogenous protozoan glycosylphosphatidylinositol (GPI
[20]), but the exact endogenous ligand(s) presented physiologically by CD1d have not yet been identified. The most
salient feature of NK1 T cells is their ability to secrete very
rapidly large amounts of IL-4 in a primary response (21).
They can also secrete large amounts of IFN-
, especially
when triggered through their NKRP1 receptor (22). However, their true in vivo functions are still enigmatic, though
there is evidence that they may be involved in Th1/Th2
class polarization (23), in IL-12-induced tumor rejection (24), and in autoimmunity (25).
Mainstream
/
T lymphocytes express either CD8 or
CD4 accessory molecules and respond to peptidic antigens
presented in low amounts by either MHC class I or class II
molecules. The absence of accessory molecules in the DN
T cell subpopulation suggests that these cells may recognize
high-density ligands (such as
-galactosylceramide or glycosylphosphatidylinositol presented by CD1 for NK1 T cells) and/or display TCRs with high affinity. Indeed, most
/
T cells are DN or CD8
, and the NK1 T cells comprise
both DN (and CD8
+ in humans [28]) and CD4+ cells,
though the CD4 molecule in these latter does not seem to
play a role in the binding affinity (14, 29). DN
/
+ T cells
represent between 0.5 and 2% of PBLs in normal individuals and comprise the aforementioned NK1 T cells and other
cells of unclear specificity or functions. Some of these also
recognize CD1d, while others are specific for glycolipids
presented by CD1a, b, or c (30).
NK1 T cells thus far represent the only known T cell
subset that has conserved its TCR, its specificity, and its
functional features between rodents and primates, suggesting that they may play an ancient and important physiological role (18). Here, we report on the existence of another
phylogenetically conserved population of T cells in mammals, defined by the expression of a novel canonical TCR
chain comprising the hAV7S2 and AJ33 elements in humans and the homologous AV19 and AJ33 elements in
mice and cattle. V
7/19-J
33+ T cells show an oligoclonal
TCR
chain repertoire and are selected by a
2m-dependent but TAP-independent molecule that is neither a classical MHC class I molecule nor CD1d. The conservation
between species of T cells displaying this limited repertoire
and their unusual restriction pattern suggest that this population may serve a function complementary to that played
by NK1 T cells.
| |
Materials and Methods |
|---|
|
|
|---|
Antibodies.
In humans, the following antibodies, anti-CD28- PE, anti-CD45RA-PE, anti-CD45RO-PE, anti-CD57-FITC, anti-CD56-PE, anti-
/
TCR-allophycocyanin (APC), anti-
/
TCR-PE, anti-CD8
-PE, biotinylated anti-CD4, and anti-CD8
, were obtained from Immunotech; anti-CD27-FITC and
anti-
/
TCR-FITC were purchased from PharMingen. Anti-CD8
-FITC and -Tricolor (TC), anti-CD4-FITC and -PE,
and anti-CD3-TC were obtained from Caltag Laboratories. An
anti-CD4-FITC (Diaclone) recognizing an epitope distinct from
the anti-CD4 magnetic beads was also used. Streptavidin-Red
613 was purchased from GIBCO BRL. Streptavidin-PE and -TC
were obtained from Caltag Laboratories.
In mice, anti-CD4 (RM4-5 or RM4-4)-PE, anti-CD8
- or
anti-CD8
-FITC, biotinylated or Cychrome-conjugated anti-
/
TCR and streptavidin-APC were obtained from PharMingen. Anti-
/
TCR-TC was obtained from Caltag Laboratories.
Bovine anti-CD4 and anti-CD8
antibodies were provided by J. Naessens, International Laboratory for Research on Animal Diseases (ILRAD, Nairobi, Kenya).
Human Cell Preparations.
Heparinized blood was obtained from healthy donors or from MHC-deficient patients, and PBMCs were purified by Ficoll-Hypaque (Amersham Pharmacia Biotech) gradient centrifugation. Cells were frozen in liquid nitrogen until use.Bovine Cell Separations.
Bovine blood was provided by Mr. Noé from the GENA Laboratory, Institut National de la Recherche Agronomique (INRA, Jouy en Josas, France). After Ficoll-Hypaque separation, PBLs were labeled with anti-CD4 and/or anti-CD8 (both Ig2a), which were revealed with an FITC-conjugated goat anti-Ig2a serum. Cells were FACS® sorted into CD4 or CD4/CD8 positive or negative fractions as indicated, and the relative amounts of boC
- or boAV19-boAJ33 transcripts were
estimated by kinetic PCR (see below).
Mice.
C57BL/6 (H-2b) (B6), BALB/c (H-2d), 129 (H-2b), DBA/2 (H-2d), and CBA (H-2k) mice were bred in our own specific pathogen-free animal facility.
2m
/
and I-Ab
/
mice,
backcrossed nine times to B6, were obtained from the Centre National de la Recherche Scientifique central animal facility (CNRS, Orleans, France). TAP
/
B6/129 and CD8
/
deficient mice were obtained from The Jackson Laboratory. Kb
/
Db
/
mice have been described (33). CD1
/
mice were generated by S.-H. Park and A. Bendelac (unpublished results).
Immunofluorescence Studies.
Surface phenotyping was carried out on a FACSCaliburTM cytometer (Becton Dickinson). Three-color sorting (CD4, CD8
, and
/
TCR staining) was carried
out on a FACS VantageTM (Becton Dickinson) to obtain
/
+
DN, -CD8
+, or -CD4+ cells. Reanalyzed fractions were >99%
pure. In some experiments, DN cells were seeded into 96-well
PCR microplates at the indicated cell concentrations using a single cell deposition unit (Becton Dickinson). DN/CD8+ fractions,
enriched or depleted for a given marker, were obtained by
FACS® sorting negative and positive fractions for this marker after quadruple staining with anti-CD4, anti-CD8
, anti-
/
TCR,
and the relevant marker (either CD8
, CD45RA, CD45R0,
CD56, CD57, CD28, or CD27).
In some experiments, DN and CD8
+ enriched fractions were
obtained using paramagnetic beads and the VarioMacs system
(Miltenyi Biotec). In brief, cells at 107/100 µl were resuspended
in PBS, 0.5% BSA, 5 mM EDTA and incubated with anti-CD4
paramagnetic microbeads, washed once, resuspended in 500 µl of
the same buffer, and passed through an RS column. Effluent was
collected as the DN+CD8+ fraction. After thorough washes of
the column, the eluate was collected as CD4+ fraction. In these
conditions, the CD4+ fraction was >95% pure.
Oligonucleotides.
All primers and probes were obtained from Genosys Biotechnologies and used without further purification. Probes were FITC conjugated. The following primers have been described previously (14): mAV14, mAJ18, mAC-5', mACV, mAC-3', hACV, hAC-5', and hAC-3'. The following primers were used (m, bo, and h stand for murine, bovine, and human; p is for probe; in and out are for the inner and outer primer, respectively, in the case of nested PCR): mAV19, CACTTTCCTGAGCCGCTCGAA; mAJ33, biotin-TTAGCTTGGTCCCAGAGCCCC; pmAV19, GCTTCTGACAGAGCTCCAG-FITC. The mouse-specific V
and V
primers were slightly modified
from Casanova et al. (34). The human V
primers were derived
from Puisieux et al. (35) as modified by Martinon et al. (36). The
other human primers were as follows: hAV7S2, biotin-CCTTAGTCGGTCTAAAGGGTACAG; hAJ33, CCCAGCGCCCCAGATTAA; hBJ1S2, GTCTCCCTCAGTCTGGCTCCG;
hBJ1S3in, GGTGGTAAGGTCAGAGGCTCTTTTATC; hBJ1S3-
out, TCTGTGTGAGGGAGAGAAACG; hBJ1S5, CAAGACACACCAAAGGGAACGC; hBJ2S2, CTCTCCCAGCACCCAGAACCA; hBJ2S4, CGCACAAAAACCCGAGCGCAG; hBJ1S6in,
CCAGGCACCCCCGAGTCAAGA; hBJ1S6out, GGCAACACAGCAGAGCAACAA; hBJ2S7out, TCGTCCTCTCCAGTCTCGCCT; hBJ2S7in, CGCCCTCTGCTCAGCTTTCCG; and hAJ33in, CAAAAGCTGACTTGCAGGCATCG. In cattle,
the following primers were used: boAV19, biotin-CATTCCTTAGACGCTCTGATGCACA; boAJ33, GCCCCAGATCCACTGATAGTTGC; pboAV19, FITC-GTGGAGTTCCTTCAGAAGGAG; bo5'CA, biotin-AGGACCCCAACCCCACTGTGT;
bo3'CA, CTTCAGGAGGAGGATGCGGAAC; and pboCA,
FITC-CACTGGATTGGGGGCTTC.
Nucleic Acid Preparation.
Genomic DNA was obtained as crude cell lysate by adding to the cell pellets (1-106 cells) a solution containing 200 µg/ml proteinase K (Promega Corp.), 0.5% Tween 20 (Sigma-Aldrich), 10 mM Tris-HCl, pH 9, 50 mM KCl, 2.5 mM MgCl2. After resuspension, this solution was incubated for 2 h at 56°C, and the proteinase K was denatured by incubation at 95°C for 20 min. Total RNA was extracted from 1-5 × 105 cells with the RNAble solution (Eurobio), ethanol precipitated with addition of 2 µl Pellet Paint coprecipitant (Novagen), and resuspended in 20 µl sterile water. Reverse transcription was carried out as described with random hexamers and oligo-dT priming (37).Quantitative Kinetic PCR.
Quantitative kinetic ELISA PCR was carried out as described (37). Polyclonal samples were divided into two aliquots before RNA extraction except in a few instances in which the amount of sorted cells was too low (<2 × 104). Average values are shown. In the most recent experiments, an ABI prism 7700 (Perkin-Elmer) apparatus was used instead of the ELISA assay to monitor the amount of amplicon during the PCRs. This apparatus is based on the 5' to 3' nuclease activity of Taq polymerase (38), which allows the release of a fluorescent reporter during the PCR. A probe labeled with both a reporter and a quencher dye is spiked into the PCR mix at the beginning of the reaction. The sequences of the Taqman probes used in this study are the following: hCA, mGCATGTGCAAACGCCTTCAACAACAqp; hAV7.2, mTGAAAGACTCTGCCTCTTACCTCTGTGCqp; mAC, mCTCCCAAATCAATGTGCCGAAAACCAqp; mAV19, mTCCAGATCAAAGACTCTGCCTCATACCTCTGqp; and mAV14, mCACCCTGCTGGATGACACTGCCACqp; where m preceding each sequence stands for FAM and qp following for TAMRA blocked with a phosphate. When using the ABI prism 7700 apparatus, the following primers were also used: hAV7S2, TCCTTAGTCGGTCTAAAGGGTACAG; hAJ33, CCAGCGCCCCAGATTAA; hAC-5', ACCCTGACCCTGCCGTGT; hAC-3', GGCTGGGGAAGAAGGTGTCTT; mAV14, TGGGAGATACTCAGCAACTCTGG; mAJ18, CCAGCTCCAAAATGCAGCC; mAV19, CTTTCCTGAGCCGCTCGAA; mAJ33, CTTGGTCCCAGAGCCCC; mAC-5', CCTCTGCCTGTTCACCGACTT; and mAC-3', CGGTCAACGTGGCATCACA. In these quantitative kinetic PCR methods, for two samples containing the same amount of C
, a shift of n cycles
along the x-axis of the two amplification curves represents an
~1.8n-fold difference in the two samples studied.
Single Cell Repertoire Analysis.
Single human DN
/
T cells
were sorted into 84 wells of PCR plate. 11 of the remaining wells
were used as negative controls and 1 as positive. After cell lysis,
PCR amplification was carried out for 25 cycles using the following primers: 29 V
, 7 J
, AV7S2out, AJ33out, and as positive
control AV24 and AJ18out. The resulting reaction mix was diluted fivefold, and aliquots were amplified in a second PCR reaction with an AV7S2/AJ33 primer pair for 40 cycles. The specific
AV7S2-AJ33 amplicons were detected by ELISA or using the
Taqman assay. Aliquots of the AV7S2-AJ33-positive wells from
the first PCR reaction were then PCR amplified in 24 individual
PCR reactions with 1 (or 2) specific V
primer(s) and a mixture
of 7 J
primers for 45 cycles. The positive reactions were detected by agarose gel electrophoresis, and the amplicons were sequenced as described below.
Sequencing.
Polyclonal sequencing was performed after amplification for 42 cycles with hAV7S2, boAV19, or mAV19 and either AJ33 or C
primer pairs. The amplicons were purified using the Wizard PCR clean-up system (Promega Corp.) and sequenced using either a nested primer in the C
constant region
(in mouse) or the same AV19 or AV7S2 primer as used for amplification, as appropriate. Sequences were performed with the
Thermosequenase radiolabeled terminator cycle sequencing kit
(Amersham Pharmacia Biotech) with 33P-ddNTP.
T-T Hybridoma Generation.
DN and CD8+ T cells were obtained from TAP
/
mice after depleting CD4+ T cells with
anti-CD4 antibody (GK1.5 and 172.4) plus rabbit complement
(Behring AG) followed by centrifugation over a density gradient
(Lympholyte M; Cedarlane Laboratories). 2 × 106 cells were stimulated, in the presence of 4 × 106
-irradiated (2,500 cGy) splenic
cells, for 2 d with soluble anti-
/
TCR (H57) at 7.5 µg/ml
which had been precoated for 1 h at 37°C in flat-bottomed
96-well plates. Cells were cultured for an additional 2 d with
IL-2 (100 U/ml) in complete culture medium: RPMI 1640, 15%
FCS, 2 mM L-glutamine (GIBCO BRL), penicillin 100 U/ml,
streptomycin 100 µg/ml, 50 µM
-ME. At day 4, 8 × 106 cells
were fused with 2.5 × 107 TCR
/
BW5147 thymoma cells
using standard procedures, plated at 4 × 104 cells per well in
96-well microplates, and selected in HAT medium. Resulting
clones were screened for expression of AV19-AJ33 rearrangement on genomic DNA followed by sequencing. V
were characterized by 17 V
-specific PCR reactions, and the resulting
amplicons were then sequenced. Results were verified by immunofluorescence with specific anti-V
antibodies.
| |
Results |
|---|
|
|
|---|
A previous analysis of TCR
chain repertoire of human
DN T cells indicated that besides the invariant hAV24AJ18
TCR
chain, another TCR
chain was frequently expressed that also had a restricted AVAJ usage and recurrent
junctional features (39). This
chain, which was encoded by
rearranged hAV7S2AJ33 elements, had a CDR3 of constant
length but some variability in the two junctional codons. A
GenBank search showed that among the 20 TCR
chains sequenced in cattle, one chain (BOTCRA14) used the homologous V
and J
segments with a CDR3 of the same
length (40). In mice, no homologous invariant
chain had
been described, but the corresponding V
(mAV19) and J
(mAJ33) segments display high homology with their human counterparts, as there is only one amino acid difference between the murine AJ33 and its human counterpart
(41, 42). Based on these observations, which suggested the
existence of another conserved T cell population in mammals, we undertook an extensive analysis of the frequency
and repertoire of the T cells bearing this particular combination of AVAJ elements in these three species.
Canonical hAV7S2AJ33 TCR
Chains, as well as Their
Murine and Bovine Homologues, Are Abundantly Expressed in
DN T Cells
To determine the frequency and coreceptor phenotype of
T cells bearing hAV7S2AJ33 TCR
chains, PBLs were
separated into highly purified
/
DN, CD4+, or CD8
+
(i.e., CD8
+ and CD8
+) subsets, and the amount of
hAV7S2AJ33-encoded transcripts in duplicate fractions was
quantified by kinetic PCR. Although the amounts of C
chain were similar in all samples (Fig. 1 A), there was a
large shift to the left of the hAV7S2AJ33 amplification curves for the DN (8.5 cycles) and the CD8
+ fractions
(5 cycles) (Fig. 1 B) compared with the CD4+ fractions, indicating that DN and CD8
+ cells contained ~150-360-
and 19-32-fold more hAV7S2AJ33 transcripts, respectively, than CD4+ lymphocytes. hAV7S2AJ33 transcripts
were enriched in DN and CD8
+ T cell preparations from
all individuals tested, and on average the enrichment levels
of hAV7S2AJ33 transcripts in DN T cells were much
higher than those observed for the NK1 T cell-specific invariant
chain hAV24AJ18 (data not shown).
|
Because a similar invariant
chain had been sequenced
once in cattle (40), we examined its distribution within
CD4+, CD8+, DN, or (CD4+ plus CD8
+) sorted cells obtained from bovine blood. As shown in Fig. 1, C and D, the
levels of boAV19AJ33 transcripts in the DN fractions were as
high as those observed in humans. No boAV19AJ33 amplification could be obtained with the CD8
+ fraction, and
the comparison of CD4+ and CD4+ plus CD8
+ amplification curves suggested that bovine CD8
+ cells did not
express high amounts of boAV19AJ33 transcripts.
In mice, no canonical TCR
chain rearrangement involving mAV19 and mAJ33, the murine elements that are homologous to hAV7S2 and hAJ33, respectively, had been described. However, quantitative PCR analysis of mAV19AJ33
transcripts within highly purified murine
/
DN, CD4+,
and CD8
+ lymphocytes indicated that, as in human and
bovine blood, increased mAV19AJ33 expression was observed in the DN fraction from lymph nodes (Fig. 1, E and
F). The shift of the amplification curves between DN and
CD4+ cell preparations was lower than in humans and cattle,
suggesting that mAV19AJ33-bearing cells were less abundant
in mice.
To examine the length of the CDR3 regions of the hAV7S2AJ33
transcripts and their homologues in mice and cattle, we
carried out polyclonal sequencing of V
-C
or V
-J
amplicons obtained from the various lymphocyte subpopulations in these species. As shown in Fig. 2 A, a readable
hAV7S2AJ33 sequence was obtained from hAV7S2-C
amplicons derived from DN and CD8
+ samples but not
from CD4+ samples. Therefore, this indicated that in the
former but not the latter cells, the hAV7S2 segment was predominantly rearranged to the hAJ33 segment and comprised
a CDR3 of constant length. The polyclonal hAV7S2AJ33
sequence displayed some heterogeneity at the VJ junction,
in agreement with previous results from Porcelli et al.
showing some variability of the two N-encoded amino acids (39).
|
In cattle, the picture was slightly different, as polyclonal
sequencing of boAV19-C
amplicons demonstrated the
predominant presence of the invariant boAV19AJ33 chain
in DN cells, but not in CD4+ or CD8+ cells (data not
shown). At the VJ junction, the polyclonal sequence derived from DN cells displayed some junctional heterogeneity, indicating also some variability of the two amino acids
encoded by N additions. In mice, polyclonal sequencing of
the mAV19-C
amplicons showed a fully readable sequence for the DN but not for the CD8
+ fraction (data
not shown). Moreover, the VJ sequence displayed no heterogeneity and corresponded to a "germline" junction
without nucleotide trimming or N addition (see also Table
II below). Altogether, these results demonstrated that in the
three species, DN
/
+ T cells were enriched for cells bearing TCR
chains with highly homologous AVAJ elements
(hAV7S2AJ33, mAV19AJ33, and boAV19AJ33) and constant
CDR3 length as shown in the multiple alignment displayed in Fig. 3. This novel canonical TCR
chain will be referred
to hereafter as the "invariant" V
7/19-J
33 TCR
chain.
|
|
7/19-J
33
Chains.
A large amount of invariant
chain transcripts
does not formally demonstrate the existence of a large
number of invariant TCR
chain-bearing cells, as this
transcript could have been expressed at very high levels in a
few cells. To more directly estimate the number of cells using the invariant V
7-J
33 chain, single
/
+ DN cells
from three different subjects were sorted into PCR plates using a single cell deposition unit. FACS®-sorted
/
+
TCR CD8
+ or CD4+ cell suspensions were also serially
diluted into PCR plates to get 12 replicates of the indicated
cell concentrations. After cell lysis, hAV7S2AJ33 PCR amplification was carried out on genomic DNA with luminometry detection of the amplicons. As shown in Fig. 4 A,
the assay was sensitive enough to detect a single cell harboring the relevant rearrangement and yielded a frequency
of V
7-J
33+ DN cells of ~1/7.4. Using limiting dilution
analysis (LDA), the frequency observed for CD8
+ cells
was 1/36 (confidence interval: 1/25-1/70; Fig. 4 B). Sequence analysis of amplicons from single cell preparations
obtained with DN and CD8
+ cells demonstrated the presence of invariant V
7-J
33 transcripts in all cases. A similar
analysis on CD4+ cells yielded a frequency of V
7-J
33+
cells of 1/1,093 (1/751-1/2,003; Fig. 4 C). Importantly,
sequencing of the positive wells at concentrations where
the V
7-J
33 amplicons were derived from one cell showed
that out of six positive wells, two corresponded to a rearrangement of the hAV7S2 to hAJ34 (which were amplified
because of the short genomic distance [~700 bp] separating
hAJ34 from hAJ33), three corresponded to a rearranged V
7-J
33 chain with a different CDR3 length, and only
one corresponded to the invariant V
7-J
33 chain. Thus,
the actual frequency of CD4+ cells harboring the invariant
V
7-J
33 chain should be ~1/6,000.
|
In mice, V
19-J
33+ cells were less numerous than in
humans. Their frequency within
/
DN lymph node
cells was 1/56 (Fig. 5 A), compared with ~1/7.5 in humans (Fig. 4 A).
|
Surface Phenotype and TCR
Repertoire of
V
7/19-J
33-bearing Cells
7-J
33-bearing Cells Express Memory Markers
and Show a Biased Usage of hBV2 and hBV13 TCR
Chains.
In the absence of anti-hAV7S2 or anti-mAV19 antibody,
we used the following strategy to characterize the surface
phenotype of the population expressing the invariant V
7-J
33 chain.
/
DN and CD8
+ cells were depleted or
enriched for a given marker by FACS® sorting, and the
amounts of V
7-J
33 transcripts in the positive and negative fractions were quantified and compared with the
amounts of amplified C
transcripts, in order to take into
account variations in cell number. Fig. 6 displays an example of such an experiment, where we examined whether
the CD8 molecules expressed by V
7-J
33+ cells were either heterodimeric (
) or homodimeric (
), since CD8
+ cells represent between 5 and 25% of CD8
+
TCR
/
+ lymphocytes in human PBLs (data not shown).
There were ~45-fold more V
7-J
33 transcripts in the
CD8
+ fraction than in the CD8
+ fraction. This result
was confirmed by polyclonal sequencing of the amplicons
obtained after amplification with hAV7S2/C
(V-C) or
hAV7S2/hAJ33 (V-J) primers: no readable sequence was
obtained from the CD8
+ fraction, whereas the invariant
chain was present in the CD8
+ fraction (Fig. 2 B).
The absence of a readable sequence in the CD8
+ fraction using V-J amplification indicates the near absence of the invariant
chain in this fraction. Using this strategy, it could be established that V
7-J
33+ cells had mainly a
memory phenotype (i.e., CD45R0+CD45RA
) and were
CD56
CD57
CD28+CD27+ (data not shown).
|
Despite many attempts using different lymphokine mixtures, we were unable to obtain a large enough number of T
cell clones expressing the invariant V
7-J
33 chain. Therefore, the TCR
chain repertoire of DN cells bearing invariant V
7-J
33 chain was directly estimated by single cell
PCR analysis. After single cell deposition of DN
/
cells
into PCR plates, cells were lysed and a first PCR reaction
was carried out using hAV7S2, hAJ33, and a mixture of 29 V
and 7 J
. This first reaction was then amplified in a second PCR with nested AV7S2/AJ33 primers allowing us to
find the wells containing V
7-J
33+ cells. Using the reaction mixture of the first PCR corresponding to the positive
wells, 24 individual PCR reactions were set up using 1 (or 2)
V
and a mixture of 7 J
primers. This allowed us to get a
specific band for 0-2 V
which was then sequenced using
the relevant V
primer. In 9 independent experiments carried out on DN cells obtained from 3 different subjects, the
frequency of V
7-J
33+ wells ranged between 6 and 16/84.
Among the 92 V
7-J
33+ wells studied, a
chain could be
assigned and sequenced in 37 cases (40%), and we found that
there was a heavy bias toward V
13 and V
2. Out of 13 V
sequenced in donor A, 7 were BV13+ and 3 were BV2+. In
donor B, 8/12 were BV13+ and 4/12 were BV2+. In donor
C, 7/12 were BV13+ and 2/12 were BV2+. However, despite this biased usage of BV13 or BV2 regions, the TCR
chains derived from V
7-J
33+ cells did not show obvious
restrictions in J
usage or in CDR3 length (Table I). Sequence analysis of V
J
junctions confirmed the presence of
V
7-J
33 chains with the canonical CDR3 length and revealed significant variations in amino acid composition at the
two N-encoded positions (Table I). Moreover, the presence of repeated TCR
and
chain junctional sequences in different cells from the same subject cloned in different PCR
plates and the fact that these TCR chains were not found in
other subjects indicated that this subset had undergone clonal
expansion in vivo, an interpretation that is consistent with its
memory phenotype (see above). Overall, V
7-J
33+ cells
appear to use a semirestricted repertoire that is expanded as
needed.
|
Chain Repertoire of V
19-J
33+ Cells.
Because the
frequency of V
19-J
33+ cells is not as high in mice as in
humans, the strategy followed to characterize the surface phenotype of human V
7-J
33+ cells was not successful in
mice. Therefore, to characterize the TCR
chain repertoire of this subset, we took advantage of the fact that
V
19-J
33+ cells are enriched in TAP
/
mice (see below). We generated T-T hybridomas from DN enriched lymph node cells from TAP
/
mice, and screened for expression of V
19-J
33 transcripts. In agreement with the
single cell analysis (Fig. 5 B), 16/168 hybridomas studied
were V
19-J
33+. As shown in Table II, in all cases, these
hybridomas carried V
19-J
33 chains with the canonical
CDR3 length and in all but two cases, the V
19-J
33
junction was germline encoded. The V
segments used
were predominantly BV8+ (7/16) and BV6+ (4/16). No
restriction in the J
repertoire was apparent.
Development and Selection of V
7/19-J
33-bearing Cells
7/19-J33-bearing Cells.
NK1 T cells are
not found in neonates and accumulate after birth (5).
Therefore, we examined cord blood lymphocytes for V
7/
19-J
33 sequences by quantitative PCR and polyclonal sequencing of V
7-C
or V
7-J
33 amplicons on cDNA
obtained from enriched DN/CD8+ or CD4+ fractions.
We were unable to find significant amounts of invariant V
7-J
33 transcripts in cord blood in the six samples studied. However, significant amounts of this chain could be
obtained in young children, albeit in lower amounts than
in adults (data not shown).
Similarly, V
19-J
33-bearing cells were not found in
spleen or thymus of mouse neonates (data not shown). They
were present in lymph nodes and blood in large amounts
and in smaller amounts in the spleen in the five mouse
strains tested, as shown in Table III (top), which displays a
summary of the studies examining the tissue distribution of
V
19-J
33-bearing cells. Importantly, although more than
half of the human invariant V
7-J
33+ cells were CD8
+
cells, which might suggest an extrathymic development
pathway (43), invariant V
19-J
33 rearrangements were
not detected in nude mice either by quantitative PCR (Table III, top) or polyclonal sequencing (data not shown), indicating that the thymus is required for their development.
|
7-J
33+ Cells Is Not Affected in MHC
Class II- and TAP-deficient Patients.
The restriction element
of V
7-J
33+ cells could be either a class I or class II
MHC molecule, as they do not express CD4 or CD8
accessory molecules. To address this issue, we quantified the expression of the V
7-J
33 invariant chain in PBLs
obtained from MHC-deficient patients. MHC class II-
deficient patients harbor low but significant numbers of
CD4+
/
lymphocytes whose V
repertoire is grossly
normal (44). CD4+, CD8
+, and DN enriched fractions
were prepared and analyzed by quantitative PCR. Although the amount of C
was much lower in the DN than
in the CD4+ samples (Fig. 7 A), the amounts of V
7-J
33
transcripts were comparable in both samples (Fig. 7 B),
therefore indicating an enrichment of V
7-J
33 transcripts
within DN cells and, presumably, selection of invariant
V
7-J
33-bearing cells in this patient. Accordingly, the
predominance of the invariant V
7-J
33 sequence within
DN cells was confirmed by polyclonal sequencing (data not shown). Similar results were obtained in the two other patients studied. Taken together, these results strongly suggest
that the restriction element of the invariant V
7-J
33+
cells is not an MHC class II molecule.
|
There is no MHC class I-deficient patient described to
date, but we could obtain PBLs from two TAP-deficient
siblings (45). In these patients,
/
+ TCR CD8
+ cells are
reduced in numbers at birth but may expand with age.
/
+
TCR CD4+ and CD8
+ cells were separated in one of
these patients, and the amount of C
and V
7-J
33 transcripts was quantified in the two fractions. Despite lower
amounts of C
in the CD8
+ fraction, the amount of
V
7-J
33 transcripts was much higher in the CD8
+ fraction (Fig. 7, C and D). Enrichment for V
7-J
33 transcripts was also demonstrated in a PHA-stimulated CD8
+
line derived from the other TAP-deficient patient, when
compared with either unsorted PBL-derived cell line from
the same patient or to CD8
+ cells from healthy donors
(data not shown). Actually, the larger amounts of V
7-J
33
transcripts in the CD8
+
/
T cells of TAP-deficient
patients is in agreement with the higher proportion of
CD8
+ cells in these patients (data not shown). This indicates that T cells bearing this invariant
chain are probably
not selected by a TAP-dependent MHC class I molecule.
Thus, the selecting molecule for the invariant V
7-J
33+ cells appeared to be neither an MHC class II nor a
classical MHC class I molecule. However, because the defect in MHC class II expression may not be complete and
the level of MHC class I expression in TAP-deficient patients is still 1% of normal, no definitive conclusion could
be drawn from these studies. Therefore, we turned to the mouse, where carefully controlled studies using well-characterized MHC-deficient mice can be performed.
19-J
33+ Cells Is
2m-dependent, TAP-independent, and Distinct from CD1.
The amount
of V
19-J
33 transcripts was examined in
/
+ DN lymph
node cells from several MHC-deficient strains. Because the frequency of V
19-J
33+ cells and the percentage of DN
cells are lower in mice, the differences between positive and
negative samples are smaller in mice than in humans. However, despite higher levels of C
in the
2m
/
samples,
there were fewer V
19-J
33 transcripts than in control or
I-Ab
/
mice (Fig. 8, A and B). Polyclonal sequencing of
V
19-J
33 amplicons from
2m
/
samples showed the
complete absence of invariant V
19-J
33 transcripts. This
was consistent with an MHC class I or
2m-dependent class I-like selection of the invariant V
19-J
33+ cells. However,
the relevant molecule is not a classical MHC class I molecule
because the amount of invariant V
19-J
33 transcripts was
higher in the DN cells from Kb
/
Db
/
mice than in controls, though the C
levels were lower. These results suggest
that the MHC class I selecting molecule is not a classical one
and that, in the absence of classical class I molecules, the invariant chain-bearing DN cells are less diluted by mainstream cells. In Fig. 8, C and D, V
19-J
33 transcripts were
quantified in CD8-, CD1-, and TAP-deficient mice, B6 and
2m
/
mice being used as positive and negative controls,
respectively. There was no decrease in the amounts of
V
19-J
33 transcripts in CD1-deficient mice, indicating
that V
19-J
33+ cells were not selected by CD1 or a CD1-bound ligand. The curves for TAP
/
samples were actually
shifted to the left, indicating an increased frequency of
V
19-J
33+ cells in TAP
/
mice, in agreement with the
result shown in Fig. 5 B where the frequency of V
19-J
33+ cells in DN TAP
/
mice was 1/8.5 (i.e., a sixfold increase compared with B6; Fig. 5 A). The V
19-J
33 curve
corresponding to the CD8-deficient mice is similar to that of
B6, indicating the presence of V
19-J
33 invariant chains in
CD8
/
mice. This was confirmed by polyclonal sequencing
(data not shown). Altogether, these results, summarized in
Table III (bottom), indicate that V
19-J
33+ cells do not
require CD8 for their selection and that the selecting molecule is a
2m-dependent, TAP-independent molecule distinct from CD1.
|
| |
Discussion |
|---|
|
|
|---|
Invariant V
7.2-J
33 TCR
chain and its murine and
bovine homologues were found in three different mammalian species and, thus, define a new phylogenetically conserved T cell population using a canonical TCR
repertoire. In humans, DN and CD8
+ cells bearing invariant
V
7-J
33 chain accumulate after birth and become quite
abundant, as they represent ~0.1-0.2% of all human PBLs.
Therefore, it is legitimate to wonder why such cells have
not been previously reported. This may be due to the lack of a stringent V
repertoire restriction, or to the difficulties in growing clones expressing this invariant chain (our unpublished observations), together with methodological limitations linked to TCR
chain repertoire analysis (e.g.,
lack of allelic exclusion [46]). However, this invariant
chain had already been described in DN cells by Porcelli et al.
(39) and, among the 317 random CDR3 sequences reported by Moss and Bell (47), 4 (1.2%) had a sequence corresponding to the V
7-J
33 invariant
chain. In the same
study, this canonical sequence was not found in cord blood
samples or in CD4+ cells, but represented 3/40 (7.5%)
CDR3 sequences derived from CD8
+ cells. This age and
cell distribution is in agreement with our own measurements (data not shown). In cattle, this CDR3 was found in
1/20 TCR
chains randomly sequenced (40). In mice,
random cloning of TCR
chains revealed one example of
this invariant V
19-J
33
chain (48). It should be stressed
that as shown in Fig. 3, the AJ33 segments are quasi-identical in the three species. The mouse and human J
loci are
entirely homologous, with the same genomic organization
and an average similarity of 71% including the J
coding
sequences (41, 42, 49). The AJ33 is the most similar J
segment between mouse and human sequences with only one
amino acid difference; the two other most similar human/
mouse pairs (AJ23 and AJ24) have four and three amino
acid differences, respectively (41). This quasi identity between mouse and human AJ33 segments suggests a strong
selective pressure for these segments.
In humans and cattle, the TCR
chain displayed some
junctional diversity, whereas in mice a genomic sequence
without trimming or N additions was found in most cases
(Table II). However, a murine sequence made by trimming
and reconstitution of the canonical sequence through N
additions was found in two hybridomas (11F1 and 4H1 in
Table II), indicating that the TCR in mice is selected at the
protein level. In humans, the invariant TCR
chain was associated with a limited number of V
segments (mostly
hBV2 and hBV13), and the same TCR with the same nucleotide sequence was present in different cells from two
subjects, suggesting oligoclonal expansions. Despite this
combinatorial restriction, TCR
chain diversity of invariant V
7-J
33+ cells remained extensive, since most J
segments and seven V
s were found associated with CDR3s
of variable length. In mice, five different V
s were observed with a high proportion of mBV6 and mBV8. Importantly, the murine orthologous segments of hBV13 are
mBV8 and mBV6 (50).
This semi-invariant repertoire selected at the protein
level is reminiscent of the repertoire observed in murine
epithelial DECs and in murine and human NK1 T cells. In
DECs, an invariant repertoire generated from genomic sequences is selected at the protein level, as the same epitope
recognizable by an mAb can be reconstituted by different
V
segments when the original GV1 and GV2 segments
are inactivated by homologous recombination (13). For
NK1 T cells, selection at the protein level was also apparent (14), and the transgenic overexpression of the invariant
mAV14AJ18 was sufficient to induce a large increase in the
number of NK1 T cells (53).
The restriction element of V
7/19-J
33+ cells is probably an MHC class Ib molecule distinct from CD1d, though
a
2m-derived peptide presented by a "nonclassical" class II
molecule cannot be formally excluded. The selecting molecule should be present in both mice and humans. Murine
Qa-1 and human HLA-E might be good candidates, given
their structural homology and their ability to bind to homologous CD94/NKG2 receptors in both species (54). However, when using HLA-E tetramers complexed with
HLA-G leader sequence-derived peptide (56), we were unable to find any difference in expression levels of the invariant V
7-J
33
chain between FACS®-sorted HLA-E tetramer-positive and -negative (DN plus CD8
+)
/
+
TCR PBL fractions (data not shown). Moreover, the invariant V
19-J
33 chain was not expressed by three TAP-independent anti-Qa-1 clones provided by J. Forman
(University of Texas, Dallas, TX [57]; data not shown).
Nonetheless, no definitive conclusions as to the HLA-E/ Qa-1 specificity of the invariant TCR can be drawn from
these negative results because the invariant TCR may recognize HLA-E complexed with another peptide. Another
candidate class I molecule that is widely expressed in both
mice and humans is the recently described MR1 molecule
(58, 59). Identification of the selecting element is underway
by testing reactivity of mouse hybridomas against different
cell types and MHC class I/Ib transfectants.
The expression of CD8
on V
7-J
33+ cells could argue for an extrathymic development pathway (43). However, these cells were not found in nude mice (Table III,
top), in human intraepithelial lymphocytes (IELs) (Cerf-Bensussan, N., E. Treiner, and O. Lantz, unpublished results), or in murine IELs or lamina propria lymphocytes (Guy-Grand, D., F. Tilloy, and O. Lantz, unpublished results), and
their frequency was not particularly high in mouse bone
marrow (Table III, top). Thus, V
7/19-J
33+ cells seem
to be mainly thymus dependent. In this respect, the fact that
we have been unable to find large numbers of these cells in
human or mouse thymus (data not shown) does not preclude
an intrathymic development. Indeed, if the antigen is not
present in sufficient amounts in the thymus, these cells may
not accumulate locally and may be diluted out by mainstream
/
T cells in the periphery. The absence of significant numbers of V
19-J33+ cells in mouse CD8
+ cells
(Fig. 1 F, and polyclonal sequencing after V-J amplification [not shown]) is in agreement with the extremely low numbers (<0.4%) of CD8
+ cells in murine blood or lymph
nodes (data not shown). The CD8
expression on some
invariant V
7-J
33+ cells and its complete absence on
V
19-J
33+ counterparts is reminiscent of the phenotype of
NK1 T cells, which may express CD8
+ in humans (28)
but never in mice. The reasons for such phenotypic differences between mice/cattle and humans as well as the role of
CD8
expression in human PBLs are not clear. There have
been contradictory reports concerning the role of homo-
versus heterodimeric CD8 (60). In addition, CD8
expression in human PBLs might reflect an activated status
rather than a particular differentiation pathway (64).
Concerning the development pathway of the V
7/19-J
33 cells, in the three species there seems to be no expression of the invariant
chain in the CD8
+ T cells, strong
enrichment for this sequence within DN cells (as well as
within human CD8
+ cells), and persistence of the invariant sequence in the CD4+ subset. Indeed, in humans, the
frequency of invariant
chain-bearing cells was ~1/6,000
in the CD4+ fraction. Moreover, polyclonal sequencing
of V
7-J
33 amplicons from CD4+ cells (Fig. 2 A) revealed
the presence of canonical CDR3 at a low, though readable,
frequency, whereas the canonical CDR3 was undetectable in
CD8
+ samples (Fig. 2 B). In mice and cattle, there was
also a small but reproducible shift of the CD4+ amplification
curves to the left compared with the CD8
+ curves, suggesting some expression of the invariant
chain in murine or bovine CD4+ cells. Accordingly, a readable canonical sequence
in V
19-J
33 amplicons was detected in the CD4+ but not
in the CD8
+ fraction in both species (data not shown). The
absence of any readable sequence after V-J amplification of
CD8
/
+ cells suggests that the CD8
+ V
7/19-J
33-
bearing cells are deleted by negative selection, as are NK1 T
cells in CD8 transgenic mice (14). These results are compatible with the hypothesis that V
7/19-J
33 cells follow a
normal T cell development pathway but that, in contrast
with NK1 T cells where the numbers of CD4 and DN
NK1 T cells are similar, CD4+ T cells bearing the V
7/19-J
33
chain are diluted out by mainstream lymphocytes.
A memory phenotype associated with an oligoclonal
repertoire may be related to recognition of either an endogenous ligand or a ubiquitous pathogen. In favor of an
endogenous ligand is the finding that invariant V
7-J
33+
cells existed in an 18-mo-old child who had not been vaccinated with Calmette-Guérin bacillus (BCG) and in several subjects who had negative EBV and CMV serologies
(data not shown). On the other hand, the abundance of
V
7/19-J
33-bearing cells in humans and cattle contrasting with a lower number of these cells in mice could be related to the clean environment in which laboratory mice
are housed. The two hypotheses are not mutually exclusive, as cells selected by an endogenous ligand could be
ready to react against a highly prevalent pathogen.
Both NK1 T cells and V
7/19-J
33-bearing cells display semi-invariant repertoires (i.e., one monomorphic
chain and a biased V
chain repertoire), suggesting that
their TCRs may have similar characteristics, probably a
high affinity for a selecting ligand by the invariant
chains,
as the transgenic overexpression of AV14AJ18 is sufficient
to greatly increase the number of NK1 T cells (53). Together with the similarities in their restricting elements (a
TAP-independent,
2m-dependent nonclassical MHC
class I-like molecule), the absence of accessory molecule
(CD4 or CD8) involvement suggests that they may recognize a high-density ligand that might therefore be a saccharide or a glycolipid.
Are there other invariant TCR
chains defining other T
cell subpopulations? We did not find any after measuring the
amounts of several other
chains which had been found either in DN T cells (39) or in a "regulatory" subpopulation
(65-67; Tilloy, F., and O. Lantz, unpublished observations).
However, the definite resolution of this issue awaits a systematic study of the expression of all AV-AJ combinations,
and other populations may exist in other organs in the same
way that
/
subpopulations are distributed.
Concerning the functions of V
7/19-J
33+ lymphocytes, future analysis of the mAV19AJ33 transgenic mice
we have made will certainly help address this point. The
high frequency of V
7/19-J
33+ T cells and their extensive phylogenetic conservation in mammals both argue for
an important physiological function. Because V
7/19-J
33+ and NK1 T cells are selected by distinct ligands, they
may complement each other and act synergistically either
in defense mechanisms against broadly distributed pathogens or in immune/nonimmune homeostatic processes.
| |
Footnotes |
|---|
Address correspondence to Oliver Lantz, Unité INSERM 25, Hôpital Necker, 155 rue de Sèvres, 75015 Paris, France. Phone: 33-1-44-49-53-75; Fax: 33-1-43-06-23-88; E-mail: lantz{at}infobiogen.fr
Received for publication 3 February 1999 and in revised form 8 April 1999.
Isabelle Cissé is greatly thanked for managing the specific pathogen-free animal facility. We thank Delphine Guy-Grand and Nadine Cerf-Bensussan for intestinal lymphocytes, Alain Fisher's team and the patients for allowing us to obtain MHC class II-deficient patient samples, V. Braud for HLA-E tetramers, and J. Forman for anti-Qa-1 clones. J. Naessens is gratefully acknowledged for the anti-cattle lymphocyte subpopulation antibodies. I. Schwartz is thanked for her help in obtaining these antibodies and the second step reagents, and Sarah Boudali for her help in making the mouse T-T hybridomas. We thank Claude Carnaud and Polly Matzinger for discussions and for reviewing the manuscript, and Martine Bruley-Rosset and Jean-François Bach for support.This work is supported by grants from the Association de la Recherche Contre le Cancer, Ligue Nationale contre le Cancer, Direction de la Recherche Clinique Assistance Publique-Hôpitaux de Paris, Fondation de la Recherche Médicale, and the Institut National de la Santé et de la Recherche Médicale (INSERM).
Abbreviations used in this paper
APC, allophycocyanin;
2m,
2-microglobulin;
B6, C57BL/6;
DEC, dendritic epithelial cell;
DN, CD4
CD8
double-negative;
IEL, intraepithelial lymphocyte;
TAP, transporter associated with antigen processing;
TC, Tricolor.
| |
References |
|---|
|
|
|---|
| 1. | Davis, M.M., and Y.-H. Chien. 1998. T-cell antigen receptors. In Fundamental Immunology. 4th ed. W.E. Paul, editor. Lippincott-Raven Publishers, Philadelphia. 341-366. |
| 2. | Hardy, R.R., Y.S. Li, and K. Hayakawa. 1996. Distinctive developmental origins and specificities of the CD5+ B-cell subset. Semin. Immunol. 8: 37-44 [Medline]. |
| 3. | Kantor, A.B., and L.A. Herzenberg. 1993. Origin of murine B cell lineages. Annu. Rev. Immunol. 11: 501-538 [Medline]. |
| 4. | Haas, W., P. Pereira, and S. Tonegawa. 1993. Gamma/delta cells. Annu. Rev. Immunol. 11: 637-685 [Medline]. |
| 5. | Bendelac, A., M.N. Rivera, S.H. Park, and J.H. Roark. 1997. Mouse CD1-specific NK1 T cells: development, specificity, and function. Annu. Rev. Immunol. 15: 535-562 [Medline]. |
| 6. | Park, S.H., Y.H. Chiu, J. Jayawardena, J. Roark, U. Kavita, and A. Bendelac. 1998. Innate and adaptive functions of the CD1 pathway of antigen presentation. Semin. Immunol. 10: 391-398 [Medline]. |
| 7. | Bendelac, A., and D.T. Fearon. 1997. Innate pathways that control acquired immunity. Curr. Opin. Immunol. 9: 1-3 [Medline]. |
| 8. |
Boismenu, R., and
W.L. Havran.
1994.
Modulation of epithelial cell growth by intraepithelial gamma delta T cells.
Science.
266:
1253-1255
|
| 9. |
Havran, W.L.,
Y.H. Chien, and
J.P. Allison.
1991.
Recognition of self antigens by skin-derived T cells with invariant
gamma delta antigen receptors.
Science.
252:
1430-1432
|
| 10. | Kantor, A.B.. 1996. V-gene usage and N-region insertions in B-1a, B-1b and conventional B cells. Semin. Immunol. 8: 29-35 [Medline]. |
| 11. |
Hayakawa, K.,
R.R. Hardy,
M. Honda,
L.A. Herzenberg, and
A.D. Steinberg.
1984.
Ly-1 B cells: functionally distinct
lymphocytes that secrete IgM autoantibodies.
Proc. Natl.
Acad. Sci. USA.
81:
2494-2498
|
| 12. | Allison, J.P., and W.L. Havran. 1991. The immunobiology of T cells with invariant gamma delta antigen receptors. Annu. Rev. Immunol. 9: 679-705 [Medline]. |
| 13. |
Mallick-Wood, C.A.,
J.M. Lewis,
L.I. Richie,
M.J. Owen,
R.E. Tigelaar, and
A.C. Hayday.
1998.
Conservation of T
cell receptor conformation in epidermal gammadelta cells
with disrupted primary Vgamma gene usage.
Science.
279:
1729-1733
|
| 14. |
Lantz, O., and
A. Bendelac.
1994.
An invariant T cell receptor chain is used by a unique subset of major histocompatibility complex class I-specific CD4+ and CD4 8 T cells in
mice and humans.
J. Exp. Med.
180:
1097-1106
|
| 15. |
Dellabona, P.,
E. Padovan,
G. Casorati,
M. Brockhaus, and
A. Lanzavecchia.
1994.
An invariant V 24-J Q/V 11 T cell
receptor is expressed in all individuals by clonally expanded
CD4 8 T cells.
J. Exp. Med.
180:
1171-1176
|
| 16. |
Bendelac, A..
1995.
Positive selection of mouse NK1+ T cells
by CD1-expressing cortical thymocytes.
J. Exp. Med.
182:
2091-2096
|
| 17. |
Brutkiewicz, R.R.,
J.R. Bennink,
J.W. Yewdell, and
A. Bendelac.
1995.
TAP-independent, 2-microglobulin-
dependent surface expression of functional mouse CD1.1.
J.
Exp. Med.
182:
1913-1919
|
| 18. |
Brossay, L.,
M. Chioda,
N. Burdin,
Y. Koezuka,
G. Casorati,
P. Dellabona, and
M. Kronenberg.
1998.
CD1d-mediated
recognition of an -galactosylceramide by natural killer T
cells is highly conserved through mammalian evolution.
J.
Exp. Med.
188:
1521-1528
|
| 19. |
Kawano, T.,
J. Cui,
Y. Koezuka,
I. Toura,
Y. Kaneko,
K. Motoki,
H. Ueno,
R. Nakagawa,
H. Sato,
E. Kondo, et al
.
1997.
CD1d-restricted and TCR-mediated activation of
v 14 NKT cells by glycosylceramides.
Science.
278:
1626-1629
|
| 20. |
Schofield, L.,
M.J. McConville,
D. Hansen,
A.S. Campbell,
B. Fraser-Reid,
M.J. Grusby, and
S.D. Tachado.
1999.
CD1d-
restricted immunoglobulin G formation to GPI-anchored antigens mediated by NKT cells.
Science.
283:
225-229
|
| 21. |
Yoshimoto, T., and
W.E. Paul.
1994.
CD4+, NK1.1+ T cells
promptly produce interleukin 4 in response to in vivo challenge with anti-CD3.
J. Exp. Med.
179:
1285-1295
|
| 22. |
Arase, H.,
N. Arase, and
T. Saito.
1996.
Interferon production by natural killer (NK) cells and NK1.1+ T cells upon
NKR-P1 cross-linking.
J. Exp. Med.
183:
2391-2396
|
| 23. |
Yoshimoto, T.,
A. Bendelac,
C. Watson,
J. Hu-Li, and
W.E. Paul.
1995.
Role of NK1.1+ T cells in a TH2 response and
in immunoglobulin E production.
Science.
270:
1845-1847
|
| 24. |
Cui, J.,
T. Shin,
T. Kawano,
H. Sato,
E. Kondo,
I. Toura,
Y. Kaneko,
H. Koseki,
M. Kanno, and
M. Taniguchi.
1997.
Requirement for Valpha14 NKT cells in IL-12-mediated rejection of tumors.
Science.
278:
1623-1626
|
| 25. |
Sumida, T.,
A. Sakamoto,
H. Murata,
Y. Makino,
H. Takahashi,
S. Yoshida,
K. Nishioka,
I. Iwamoto, and
M. Taniguchi.
1995.
Selective reduction of T cells bearing invariant
V 24J Q antigen receptor in patients with systemic sclerosis.
J. Exp. Med.
182:
1163-1168
|
| 26. | Wilson, S.B., S.C. Kent, K.T. Patton, T. Orban, R.A. Jackson, M. Exley, S. Porcelli, D.A. Schatz, M.A. Atkinson, S.P. Balk, et al . 1998. Extreme Th1 bias of invariant Valpha24JalphaQ T cells in type 1 diabetes. Nature. 391: 177-181 [Medline]. |
| 27. | Mieza, M.A., T. Itoh, J.Q. Cui, Y. Makino, T. Kawano, K. Tsuchida, T. Koike, T. Shirai, H. Yagita, A. Matsuzawa, et al . 1996. Selective reduction of V alpha 14+ NK T cells associated with disease development in autoimmune-prone mice. J. Immunol 156: 4035-4040 [Abstract]. |
| 28. | Prussin, C., and B. Foster. 1997. TCR V alpha 24 and V beta 11 coexpression defines a human NK1 T cell analog containing a unique Th0 subpopulation. J. Immunol. 159: 5862-5870 [Abstract]. |
| 29. |
Bendelac, A.,
N. Killeen,
D.R. Littman, and
R.H. Schwartz.
1994.
A subset of CD4+ thymocytes selected by MHC class
I molecules.
Science.
263:
1774-1778
|
| 30. |
Dellabona, P.,
G. Casorati,
B. Friedli,
L. Angman,
F. Sallusto,
A. Tunnacliffe,
E. Roosneek, and
A. Lanzavecchia.
1993.
In vivo persistence of expanded clones specific for bacterial antigens within the human T cell receptor /
CD4 8 subset.
J. Exp. Med.
177:
1763-1771
|
| 31. |
Porcelli, S.,
M.B. Brenner,
J.L. Greenstein,
S.P. Balk,
C. Terhorst, and
P.A. Bleicher.
1989.
Recognition of cluster of
differentiation 1 antigens by human CD4 CD8 cytolytic
T lymphocytes.
Nature.
341:
447-450
[Medline].
|
| 32. | Beckman, E.M., S.A. Porcelli, C.T. Morita, S.M. Behar, S.T. Furlong, and M.B. Brenner. 1994. Recognition of a lipid antigen by CD1-restricted alpha beta+ T cells. Nature. 372: 691-694 [Medline]. |
| 33. |
Vugmeyster, Y.,
R. Glas,
B. Perarnau,
F.A. Lemonnier,
H. Eisen, and
H. Ploegh.
1998.
Major histocompatibility complex (MHC) class I KbDb / deficient mice possess functional CD8+ T cells and natural killer cells.
Proc. Natl. Acad.
Sci. USA.
95:
12492-12497
|
| 34. |
Casanova, J.L.,
P. Romero,
C. Widmann,
P. Kourilsky, and
J.L. Maryanski.
1991.
T cell receptor genes in a series of class
I major histocompatibility complex-restricted cytotoxic T
lymphocyte clones specific for a Plasmodium berghei nonapeptide: implications for T cell allelic exclusion and antigen-specific repertoire.
J. Exp. Med.
174:
1371-1383
|
| 35. | Puisieux, I., J. Even, C. Pannetier, F. Jotereau, M. Favrot, and P. Kourilsky. 1994. Oligoclonality of tumor-infiltrating lymphocytes from human melanomas. J. Immunol. 153: 2807-2818 [Abstract]. |
| 36. | Martinon, F., C. Michelet, I. Peguillet, Y. Taoufik, P. Lefebvre, C. Goujard, J.-G. Guillet, J.-F. Delfraissy, and O. Lantz. 1999. Persistent alterations in T-cell repertoire, cytokine and chemokine receptor gene expression after 1 year of highly active antiretroviral therapy. AIDS 13: 185-194 [Medline]. |
| 37. | Alard, P., O. Lantz, M. Sebagh, C.F. Calvo, D. Weill, G. Chavanel, A. Senik, and B. Charpentier. 1993. A versatile ELISA-PCR assay for mRNA quantitation from a few cells. Biotechniques. 15: 730-737 [Medline]. |
| 38. |
Holland, P.M.,
R.D. Abramson,
R. Watson, and
D.H. Gelfand.
1991.
Detection of specific polymerase chain reaction
product by utilizing the 5' 3' exonuclease activity of Thermus aquaticus DNA polymerase.
Proc. Natl. Acad. Sci. USA.
88:
7276-7280
|
| 39. |
Porcelli, S.,
C.E. Yockey,
M.B. Brenner, and
S.P. Balk.
1993.
Analysis of T cell antigen receptor (TCR) expression
by human peripheral blood CD4 8 / T cells demonstrates preferential use of several V genes and an invariant
TCR chain.
J. Exp. Med.
178:
1-16
|
| 40. | Ishiguro, N., A. Tanaka, and M. Shinagawa. 1990. Sequence analysis of bovine T-cell receptor alpha chain. Immunogenetics. 31: 57-60 [Medline]. |
| 41. | Koop, B.F., L. Rowen, K. Wang, C.L. Kuo, D. Seto, J.A. Lenstra, S. Howard, W. Shan, P. Deshpande, and L. Hood. 1994. The human T-cell receptor TCRAC/TCRDC (C alpha/C delta) region: organization, sequence, and evolution of 97.6 kb of DNA. Genomics. 19: 478-493 [Medline]. |
| 42. | Koop, B.F., R.K. Wilson, K. Wang, B. Vernooij, D. Zallwer, C.L. Kuo, D. Seto, M. Toda, and L. Hood. 1992. Organization, structure, and function of 95 kb of DNA spanning the murine T-cell receptor C alpha/C delta region. Genomics. 13: 1209-1230 [Medline]. |
| 43. |
Rocha, B.,
P. Vassalli, and
D. Guy-Grand.
1994.
Thymic
and extrathymic origins of gut intraepithelial lymphocyte
populations in mice.
J. Exp. Med.
180:
681-686
|
| 44. | Rieux-Laucat, F., F. Le Deist, F. Selz, A. Fischer, and J.P. de Villartay. 1993. Normal T cell receptor V beta usage in a primary immunodeficiency associated with HLA class II deficiency. Eur. J. Immunol. 23: 928-934 [Medline]. |
| 45. |
de la Salle, H.,
D. Hanau,
D. Fricker,
A. Urlacher,
A. Kelly,
J. Salamero,
S.H. Powis,
L. Donato,
H. Bausinger,
M. Laforet, et al
.
1994.
Homozygous human TAP peptide
transporter mutation in HLA class I deficiency.
Science.
265:
237-241
|
| 46. | Malissen, M., J. Trucy, E. Jouvin-Marche, P.A. Cazenave, R. Scollay, and B. Malissen. 1992. Regulation of TCR alpha and beta gene allelic exclusion during T-cell development. Immunol. Today. 13: 315-322 [Medline]. |
| 47. | Moss, P.A., and J.I. Bell. 1995. Sequence analysis of the human alpha beta T-cell receptor CDR3 region. Immunogenetics. 42: 10-18 [Medline]. |
| 48. | Lin, W.L., J. Kuzmak, J. Pappas, G. Peng, Y. Chernajovsky, C.D. Platsoucas, and E.L. Oleszak. 1998. Amplification of T-cell receptor alpha- and beta-chain transcripts from mouse spleen lymphocytes by the nonpalindromic adaptor-polymerase chain reaction. Hematopathol. Mol. Hematol. 11: 73-88 . [Medline] |
| 49. | Koop, B.F., and L. Hood. 1994. Striking sequence similarity over almost 100 kilobases of human and mouse T-cell receptor DNA. Nat. Genet. 7: 48-53 [Medline]. |
| 50. | Clark, S.P., B. Arden, D. Kabelitz, and T.W. Mak. 1995. Comparison of human and mouse T-cell receptor variable gene segment subfamilies. Immunogenetics. 42: 531-540 [Medline]. |
| 51. | Arden, B., S.P. Clark, D. Kabelitz, and T.W. Mak. 1995. Mouse T-cell receptor variable gene segment families. Immunogenetics. 42: 501-530 [Medline]. |
| 52. | Arden, B., S.P. Clark, D. Kabelitz, and T.W. Mak. 1995. Human T-cell receptor variable gene segment families. Immunogenetics. 42: 455-500 [Medline]. |
| 53. |
Bendelac, A.,
R.D. Hunziker, and
O. Lantz.
1996.
Increased
interleukin 4 and immunoglobulin E production in transgenic mice overexpressing NK1 T cells.
J. Exp. Med.
184:
1285-1293
|
| 54. |
Vance, R.E.,
J.R. Kraft,
J.D. Altman,
P.E. Jensen, and
D.H. Raulet.
1998.
Mouse CD94/NKG2A is a natural killer cell
receptor for the nonclassical major histocompatibility complex (MHC) class I molecule Qa-1(b).
J. Exp. Med.
188:
1841-1848
|
| 55. | Soloski, M.J., A. DeCloux, C.J. Aldrich, and J. Forman. 1995. Structural and functional characteristics of the class IB molecule, Qa-1. Immunol. Rev. 147: 67-89 [Medline]. |
| 56. | Braud, V.M., D.S. Allan, C.A. O'Callaghan, K. Soderstrom, A. D'Andrea, G.S. Ogg, S. Lazetic, N.T. Young, J.I. Bell, J.H. Phillips, et al . 1998. HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C. Nature. 391: 795-799 [Medline]. |
| 57. | Aldrich, C.J., R. Waltrip, E. Hermel, M. Attaya, K.F. Lindahl, J.J. Monaco, and J. Forman. 1992. T cell recognition of QA-1b antigens on cells lacking a functional Tap-2 transporter. J. Immunol. 149: 3773-3777 [Abstract]. |
| 58. |
Riegert, P.,
V. Wanner, and
S. Bahram.
1998.
Genomics,
isoforms, expression, and phylogeny of the MHC class I-related
MR1 gene.
J. Immunol.
161:
4066-4077
|
| 59. |
Hashimoto, K.,
M. Hirai, and
Y. Kurosawa.
1995.
A gene
outside the human MHC related to classical HLA class I
genes.
Science.
269:
693-695
|
| 60. |
Irie, H.Y.,
K.S. Ravichandran, and
S.J. Burakoff.
1995.
CD8
chain influences CD8 chain-associated Lck kinase activity.
J. Exp. Med.
181:
1267-1273
|
| 61. | Renard, V., J. Delon, I.F. Luescher, B. Malissen, E. Vivier, and A. Trautmann. 1996. The CD8 beta polypeptide is required for the recognition of an altered peptide ligand as an agonist. Eur. J. Immunol. 26: 2999-3007 [Medline]. |
| 62. | Sun, J., and P.B. Kavathas. 1997. Comparison of the roles of CD8 alpha alpha and CD8 alpha beta in interaction with MHC class I. J. Immunol. 159: 6077-6082 [Abstract]. |
| 63. | Kern, P.S., M.K. Teng, A. Smolyar, J.H. Liu, J. Liu, R.E. Hussey, R. Spoerl, H.C. Chang, E.L. Reinherz, and J.H. Wang. 1998. Structural basis of CD8 coreceptor function revealed by crystallographic analysis of a murine CD8alphaalpha ectodomain fragment in complex with H-2Kb. Immunity. 9: 519-530 [Medline]. |
| 64. | Paliard, X., R.W. Malefijt, J.E. de Vries, and H. Spits. 1988. Interleukin-4 mediates CD8 induction on human CD4+ T-cell clones. Nature. 335: 642-644 [Medline]. |
| 65. |
Austrup, F.,
V. Kodelja,
T. Kucharzik, and
E. Kolsch.
1993.
Characterization of idiotype-specific I-Ed-restricted T suppressor lymphocytes which confine immunoglobulin class
expression to IgM in the anti-alpha (1 3) Dextran B 1355 S
response of BALB/c mice.
Immunobiology.
187:
36-50
[Medline].
|
| 66. |
Schmidt-Wolf, I.G.,
O. Liang,
S. Dejbakhsh-Jones,
H. Wang,
L. Cheng,
B. Holm,
R. Bell, and
S. Strober.
1993.
Homogeneous antigen receptor beta-chain genes in cloned
CD4 CD8 alpha beta T suppressor cells.
J. Immunol.
151:
5348-5353
[Abstract].
|
| 67. | Cheng, L., S. Dejbakhsh-Jones, R. Liblau, D. Zeng, and S. Strober. 1996. Different patterns of TCR transgene expression in single-positive and double-negative T cells. Evidence for separate pathways of T cell maturation. J. Immunol. 156: 3591-3601 [Abstract]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|