Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article Abstract Full Text (PDF, 327K) PPT slides of all figures Alert me when this article is cited Citation Map Services Email this article Similar articles in this journal Similar articles in PubMed Alert me to new content in the JEM Download to citation manager Citing Articles Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Tilloy, F. Articles by Lantz, O. Search for Related Content PubMed PubMed Citation Articles by Tilloy, F. Articles by Lantz, O. Social Bookmarking                            What's this?

Articles

An Invariant T Cell Receptor Chain Defines a Novel TAP-independent Major Histocompatibility Complex Class Ib–restricted /β T Cell Subpopulation in Mammals

Florence Tilloy^*, Emmanuel Treiner^*, Se-Ho Park, Corinne Garcia, François Lemonnier^||, Henri de la Salle^¶, Albert Bendelac, Marc Bonneville^**, and Olivier Lantz^*,

From ^* Institut National de la Santé et de la Recherche Médicale (INSERM) U25 and INSERM U373, Hôpital Necker, 75015 Paris, France; the Department of Molecular Biology, Princeton University, Princeton, New Jersey 08540; ^|| Département SIDA-Rétrovirus, Unité d'Immunité Cellulaire Antivirale, Institut Pasteur, 75724 Paris, France; ^¶ CJF-93-42, Établissement de Transfusion Sanguine, 67065 Strasbourg, France; ^** INSERM U463, Institut de Biologie, 44035 Nantes, France; and University Paris XI, 94276 Le Kremlin-Bicêtre, France

	Abstract

Top Abstract Materials and Methods Results Discussion References

 
We describe here a new subset of T cells, found in humans, mice, and cattle. These cells bear a canonical T cell receptor (TCR) chain containing hAV7S2 and AJ33 in humans and the homologous AV19-AJ33 in mice and cattle with a CDR3 of constant length. These T cells are CD4^–CD8^– double-negative (DN) T cells in the three species and also CD8 in humans. In humans, their frequency was 1/10 in DN, 1/50 in CD8⁺, and 1/6,000 in CD4⁺ lymphocytes, and they display an activated/memory phenotype (CD45RA^loCD45RO⁺). They preferentially use hBV2S1 and hBV13 segments and have an oligoclonal Vβ repertoire suggesting peripheral expansions. These cells were present in major histocompatibility complex (MHC) class II– and transporter associated with antigen processing (TAP)-deficient humans and mice and also in classical MHC class I– and CD1-deficient mice but were absent from β2-microglobulin–deficient mice, indicating their probable selection by a nonclassical MHC class Ib molecule distinct from CD1. The conservation between mammalian species, the abundance, and the unique selection pattern suggest an important role for cells using this novel canonical TCR chain.

Key Words: invariant T cell receptor chain • CD4^–CD8^– T cells • humans • cattle • mice

Abbreviations used: APC, allophycocyanin; β2m, β2-microglobulin; B6, C57BL/6; DEC, dendritic epithelial cell; DN, CD4^–CD8^– double-negative; IEL, intraepithelial lymphocyte; TAP, transporter associated with antigen processing; TC, Tricolor.

Band T lymphocytes display a wide repertoire of antigen receptors, made by random recombination of V, (D), and J segments and trimming/addition of nucleotides at the junctions between these rearranged segments (1). Besides the mainstream lymphocytes, three different types of cell subpopulations have been described that have a limited repertoire diversity: the B1 B cell subset (2, 3), some / T cell subpopulations (4), and the TCR /β⁺ NK1 T cells (5). Restricted repertoires seem to define discrete lymphocyte subpopulations at the frontier between innate and adaptive immunity, as these selected repertoires may allow the presence of a high frequency of preexisting cells reactive against phylogenetically conserved antigens (6, 7). Alternatively, cells with such a restricted repertoire may play an immunoregulatory role or another physiologic function, such as the wound healing, that results from the secretion of keratinocyte growth factor (8) by / dendritic epithelial cells (DECs)¹ recognizing self-ligands (9).

B1 cells, which appear early during embryonic life, use recurrent VDJ combinations with few "N" additions (10), and seem to be selected by endogenous ligands (11). Similarly, some / T cell subsets appear early during ontogeny and use peculiar V-J combinations without N additions (12). These recurrent sequences seem to be favored by enzymatic constraints linked to the recombination process, such as homologous region–guided recombination (4). Cells bearing these invariant / TCRs seem to be also selected by endogenous ligands as, in mice deficient for these segments, they are replaced by cells expressing other VV combinations but similar clonotypic motifs (13).

NK1 T cells use an "invariant" chain (mAV14AJ18 in mice [14], hAV24AJ18 in humans [14, 15]) with a CDR3 of constant length paired with a limited number of Vβ segments (BV2S1, 7S1, and 8S2 in mice, BV11S1 in humans). NK1 T cells display peculiar phenotypic characteristics: they are CD3^int, CD4⁺, or CD4^–CD8^– (DN), and have both activation (CD44^hi and 3G11^lo) and NK markers (NKRP1, Ly49) (5). In vivo development of NK1 T cells requires the MHC class Ib CD1d molecule (16), whose expression is β2-microglobulin (β2m) dependent but transporter associated with antigen processing (TAP) independent (17). In both humans and rodents, mature NK1 T cells recognize some glycolipids (such as -galactosylceramide) in a CD1d-restricted fashion (18, 19) as well as some exogenous protozoan glycosylphosphatidylinositol (GPI [20]), but the exact endogenous ligand(s) presented physiologically by CD1d have not yet been identified. The most salient feature of NK1 T cells is their ability to secrete very rapidly large amounts of IL-4 in a primary response (21). They can also secrete large amounts of IFN-, especially when triggered through their NKRP1 receptor (22). However, their true in vivo functions are still enigmatic, though there is evidence that they may be involved in Th1/Th2 class polarization (23), in IL-12–induced tumor rejection (24), and in autoimmunity (25–27).

Mainstream /β T lymphocytes express either CD8 or CD4 accessory molecules and respond to peptidic antigens presented in low amounts by either MHC class I or class II molecules. The absence of accessory molecules in the DN T cell subpopulation suggests that these cells may recognize high-density ligands (such as -galactosylceramide or glycosylphosphatidylinositol presented by CD1 for NK1 T cells) and/or display TCRs with high affinity. Indeed, most / T cells are DN or CD8, and the NK1 T cells comprise both DN (and CD8⁺ in humans [28]) and CD4⁺ cells, though the CD4 molecule in these latter does not seem to play a role in the binding affinity (14, 29). DN /β⁺ T cells represent between 0.5 and 2% of PBLs in normal individuals and comprise the aforementioned NK1 T cells and other cells of unclear specificity or functions. Some of these also recognize CD1d, while others are specific for glycolipids presented by CD1a, b, or c (30–32).

NK1 T cells thus far represent the only known T cell subset that has conserved its TCR, its specificity, and its functional features between rodents and primates, suggesting that they may play an ancient and important physiological role (18). Here, we report on the existence of another phylogenetically conserved population of T cells in mammals, defined by the expression of a novel canonical TCR chain comprising the hAV7S2 and AJ33 elements in humans and the homologous AV19 and AJ33 elements in mice and cattle. V7/19-J33⁺ T cells show an oligoclonal TCR β chain repertoire and are selected by a β2m-dependent but TAP-independent molecule that is neither a classical MHC class I molecule nor CD1d. The conservation between species of T cells displaying this limited repertoire and their unusual restriction pattern suggest that this population may serve a function complementary to that played by NK1 T cells.

	Materials and Methods

Top Abstract Materials and Methods Results Discussion References

 
Antibodies.
In humans, the following antibodies, anti-CD28– PE, anti-CD45RA–PE, anti-CD45RO–PE, anti-CD57–FITC, anti-CD56–PE, anti-/β TCR–allophycocyanin (APC), anti-/β TCR–PE, anti-CD8β–PE, biotinylated anti-CD4, and anti-CD8, were obtained from Immunotech; anti-CD27–FITC and anti-/β TCR–FITC were purchased from PharMingen. Anti-CD8–FITC and –Tricolor (TC), anti-CD4–FITC and –PE, and anti-CD3–TC were obtained from Caltag Laboratories. An anti-CD4–FITC (Diaclone) recognizing an epitope distinct from the anti-CD4 magnetic beads was also used. Streptavidin–Red 613 was purchased from GIBCO BRL. Streptavidin-PE and -TC were obtained from Caltag Laboratories.

In mice, anti-CD4 (RM4-5 or RM4-4)–PE, anti-CD8– or anti-CD8β–FITC, biotinylated or Cychrome-conjugated anti-/β TCR and streptavidin-APC were obtained from PharMingen. Anti-/β TCR–TC was obtained from Caltag Laboratories. Bovine anti-CD4 and anti-CD8 antibodies were provided by J. Naessens, International Laboratory for Research on Animal Diseases (ILRAD, Nairobi, Kenya).

Human Cell Preparations.
Heparinized blood was obtained from healthy donors or from MHC-deficient patients, and PBMCs were purified by Ficoll-Hypaque (Amersham Pharmacia Biotech) gradient centrifugation. Cells were frozen in liquid nitrogen until use.

Bovine Cell Separations.
Bovine blood was provided by Mr. Noé from the GENA Laboratory, Institut National de la Recherche Agronomique (INRA, Jouy en Josas, France). After Ficoll-Hypaque separation, PBLs were labeled with anti-CD4 and/or anti-CD8 (both Ig2a), which were revealed with an FITC-conjugated goat anti-Ig2a serum. Cells were FACS^® sorted into CD4 or CD4/CD8 positive or negative fractions as indicated, and the relative amounts of boC- or boAV19-boAJ33 transcripts were estimated by kinetic PCR (see below).

Mice.
C57BL/6 (H-2^b) (B6), BALB/c (H-2^d), 129 (H-2^b), DBA/2 (H-2^d), and CBA (H-2^k) mice were bred in our own specific pathogen–free animal facility. β2m^–/– and I-A^b–/– mice, backcrossed nine times to B6, were obtained from the Centre National de la Recherche Scientifique central animal facility (CNRS, Orleans, France). TAP^–/– B6/129 and CD8^–/– deficient mice were obtained from The Jackson Laboratory. K^b–/– D^b–/– mice have been described (33). CD1^–/– mice were generated by S.-H. Park and A. Bendelac (unpublished results).

Immunofluorescence Studies.
Surface phenotyping was carried out on a FACSCalibur^TM cytometer (Becton Dickinson). Three-color sorting (CD4, CD8, and /β TCR staining) was carried out on a FACS Vantage^TM (Becton Dickinson) to obtain /β⁺ DN, -CD8⁺, or -CD4⁺ cells. Reanalyzed fractions were >99% pure. In some experiments, DN cells were seeded into 96-well PCR microplates at the indicated cell concentrations using a single cell deposition unit (Becton Dickinson). DN/CD8⁺ fractions, enriched or depleted for a given marker, were obtained by FACS^® sorting negative and positive fractions for this marker after quadruple staining with anti-CD4, anti-CD8, anti-/β TCR, and the relevant marker (either CD8β, CD45RA, CD45R0, CD56, CD57, CD28, or CD27).

In some experiments, DN and CD8⁺ enriched fractions were obtained using paramagnetic beads and the VarioMacs system (Miltenyi Biotec). In brief, cells at 10⁷/100 µl were resuspended in PBS, 0.5% BSA, 5 mM EDTA and incubated with anti-CD4 paramagnetic microbeads, washed once, resuspended in 500 µl of the same buffer, and passed through an RS column. Effluent was collected as the DN⁺CD8⁺ fraction. After thorough washes of the column, the eluate was collected as CD4⁺ fraction. In these conditions, the CD4⁺ fraction was >95% pure.

Oligonucleotides.
All primers and probes were obtained from Genosys Biotechnologies and used without further purification. Probes were FITC conjugated. The following primers have been described previously (14): mAV14, mAJ18, mAC-5', mACV, mAC-3', hACV, hAC-5', and hAC-3'. The following primers were used (m, bo, and h stand for murine, bovine, and human; p is for probe; in and out are for the inner and outer primer, respectively, in the case of nested PCR): mAV19, CACTTTCCTGAGCCGCTCGAA; mAJ33, biotin-TTAGCTTGGTCCCAGAGCCCC; pmAV19, GCTTCTGACAGAGCTCCAG-FITC. The mouse-specific Vβ and V primers were slightly modified from Casanova et al. (34). The human Vβ primers were derived from Puisieux et al. (35) as modified by Martinon et al. (36). The other human primers were as follows: hAV7S2, biotin-CCTTAGTCGGTCTAAAGGGTACAG; hAJ33, CCCAGCGCCCCAGATTAA; hBJ1S2, GTCTCCCTCAGTCTGGCTCCG; hBJ1S3in, GGTGGTAAGGTCAGAGGCTCTTTTATC; hBJ1S3- out, TCTGTGTGAGGGAGAGAAACG; hBJ1S5, CAAGACACACCAAAGGGAACGC; hBJ2S2, CTCTCCCAGCACCCAGAACCA; hBJ2S4, CGCACAAAAACCCGAGCGCAG; hBJ1S6in, CCAGGCACCCCCGAGTCAAGA; hBJ1S6out, GGCAACACAGCAGAGCAACAA; hBJ2S7out, TCGTCCTCTCCAGTCTCGCCT; hBJ2S7in, CGCCCTCTGCTCAGCTTTCCG; and hAJ33in, CAAAAGCTGACTTGCAGGCATCG. In cattle, the following primers were used: boAV19, biotin-CATTCCTTAGACGCTCTGATGCACA; boAJ33, GCCCCAGATCCACTGATAGTTGC; pboAV19, FITC-GTGGAGTTCCTTCAGAAGGAG; bo5'CA, biotin-AGGACCCCAACCCCACTGTGT; bo3'CA, CTTCAGGAGGAGGATGCGGAAC; and pboCA, FITC-CACTGGATTGGGGGCTTC.

Nucleic Acid Preparation.
Genomic DNA was obtained as crude cell lysate by adding to the cell pellets (1–10⁶ cells) a solution containing 200 µg/ml proteinase K (Promega Corp.), 0.5% Tween 20 (Sigma-Aldrich), 10 mM Tris-HCl, pH 9, 50 mM KCl, 2.5 mM MgCl₂. After resuspension, this solution was incubated for 2 h at 56°C, and the proteinase K was denatured by incubation at 95°C for 20 min.

Total RNA was extracted from 1–5 x 10⁵ cells with the RNAble solution (Eurobio), ethanol precipitated with addition of 2 µl Pellet Paint coprecipitant (Novagen), and resuspended in 20 µl sterile water. Reverse transcription was carried out as described with random hexamers and oligo-dT priming (37).

Quantitative Kinetic PCR.
Quantitative kinetic ELISA PCR was carried out as described (37). Polyclonal samples were divided into two aliquots before RNA extraction except in a few instances in which the amount of sorted cells was too low (<2 x 10⁴). Average values are shown.

In the most recent experiments, an ABI prism 7700 (Perkin-Elmer) apparatus was used instead of the ELISA assay to monitor the amount of amplicon during the PCRs. This apparatus is based on the 5' to 3' nuclease activity of Taq polymerase (38), which allows the release of a fluorescent reporter during the PCR. A probe labeled with both a reporter and a quencher dye is spiked into the PCR mix at the beginning of the reaction. The sequences of the Taqman probes used in this study are the following: hCA, mGCATGTGCAAACGCCTTCAACAACAqp; hAV7.2, mTGAAAGACTCTGCCTCTTACCTCTGTGCqp; mAC, mCTCCCAAATCAATGTGCCGAAAACCAqp; mAV19, mTCCAGATCAAAGACTCTGCCTCATACCTCTGqp; and mAV14, mCACCCTGCTGGATGACACTGCCACqp; where m preceding each sequence stands for FAM and qp following for TAMRA blocked with a phosphate. When using the ABI prism 7700 apparatus, the following primers were also used: hAV7S2, TCCTTAGTCGGTCTAAAGGGTACAG; hAJ33, CCAGCGCCCCAGATTAA; hAC-5', ACCCTGACCCTGCCGTGT; hAC-3', GGCTGGGGAAGAAGGTGTCTT; mAV14, TGGGAGATACTCAGCAACTCTGG; mAJ18, CCAGCTCCAAAATGCAGCC; mAV19, CTTTCCTGAGCCGCTCGAA; mAJ33, CTTGGTCCCAGAGCCCC; mAC-5', CCTCTGCCTGTTCACCGACTT; and mAC-3', CGGTCAACGTGGCATCACA. In these quantitative kinetic PCR methods, for two samples containing the same amount of C, a shift of n cycles along the x-axis of the two amplification curves represents an 1.8ⁿ-fold difference in the two samples studied.

Single Cell Repertoire Analysis.
Single human DN /β T cells were sorted into 84 wells of PCR plate. 11 of the remaining wells were used as negative controls and 1 as positive. After cell lysis, PCR amplification was carried out for 25 cycles using the following primers: 29 Vβ, 7 Jβ, AV7S2out, AJ33out, and as positive control AV24 and AJ18out. The resulting reaction mix was diluted fivefold, and aliquots were amplified in a second PCR reaction with an AV7S2/AJ33 primer pair for 40 cycles. The specific AV7S2-AJ33 amplicons were detected by ELISA or using the Taqman assay. Aliquots of the AV7S2-AJ33–positive wells from the first PCR reaction were then PCR amplified in 24 individual PCR reactions with 1 (or 2) specific Vβ primer(s) and a mixture of 7 Jβ primers for 45 cycles. The positive reactions were detected by agarose gel electrophoresis, and the amplicons were sequenced as described below.

Sequencing.
Polyclonal sequencing was performed after amplification for 42 cycles with hAV7S2, boAV19, or mAV19 and either AJ33 or C primer pairs. The amplicons were purified using the Wizard PCR clean-up system (Promega Corp.) and sequenced using either a nested primer in the C constant region (in mouse) or the same AV19 or AV7S2 primer as used for amplification, as appropriate. Sequences were performed with the Thermosequenase radiolabeled terminator cycle sequencing kit (Amersham Pharmacia Biotech) with ³³P-ddNTP.

T–T Hybridoma Generation.
DN and CD8⁺ T cells were obtained from TAP^–/– mice after depleting CD4⁺ T cells with anti-CD4 antibody (GK1.5 and 172.4) plus rabbit complement (Behring AG) followed by centrifugation over a density gradient (Lympholyte M; Cedarlane Laboratories). 2 x 10⁶ cells were stimulated, in the presence of 4 x 10⁶ -irradiated (2,500 cGy) splenic cells, for 2 d with soluble anti-/β TCR (H57) at 7.5 µg/ml which had been precoated for 1 h at 37°C in flat-bottomed 96-well plates. Cells were cultured for an additional 2 d with IL-2 (100 U/ml) in complete culture medium: RPMI 1640, 15% FCS, 2 mM L-glutamine (GIBCO BRL), penicillin 100 U/ml, streptomycin 100 µg/ml, 50 µM β-ME. At day 4, 8 x 10⁶ cells were fused with 2.5 x 10⁷ TCR /β^– BW5147 thymoma cells using standard procedures, plated at 4 x 10⁴ cells per well in 96-well microplates, and selected in HAT medium. Resulting clones were screened for expression of AV19-AJ33 rearrangement on genomic DNA followed by sequencing. Vβ were characterized by 17 Vβ-specific PCR reactions, and the resulting amplicons were then sequenced. Results were verified by immunofluorescence with specific anti-Vβ antibodies.

	Results

Top Abstract Materials and Methods Results Discussion References

 
A previous analysis of TCR chain repertoire of human DN T cells indicated that besides the invariant hAV24AJ18 TCR chain, another TCR chain was frequently expressed that also had a restricted AVAJ usage and recurrent junctional features (39). This chain, which was encoded by rearranged hAV7S2AJ33 elements, had a CDR3 of constant length but some variability in the two junctional codons. A GenBank search showed that among the 20 TCR chains sequenced in cattle, one chain (BOTCRA14) used the homologous V and J segments with a CDR3 of the same length (40). In mice, no homologous invariant chain had been described, but the corresponding V (mAV19) and J (mAJ33) segments display high homology with their human counterparts, as there is only one amino acid difference between the murine AJ33 and its human counterpart (41, 42). Based on these observations, which suggested the existence of another conserved T cell population in mammals, we undertook an extensive analysis of the frequency and repertoire of the T cells bearing this particular combination of AVAJ elements in these three species.

Canonical hAV7S2AJ33 TCR Chains, as well as Their Murine and Bovine Homologues, Are Abundantly Expressed in DN T Cells
Homologous hAV7S2AJ33 or bo/mAV19AJ33 Transcripts Are Enriched in Human, Bovine, and Murine DN T Cells.
To determine the frequency and coreceptor phenotype of T cells bearing hAV7S2AJ33 TCR chains, PBLs were separated into highly purified /β DN, CD4⁺, or CD8⁺ (i.e., CD8⁺ and CD8β⁺) subsets, and the amount of hAV7S2AJ33-encoded transcripts in duplicate fractions was quantified by kinetic PCR. Although the amounts of C chain were similar in all samples (Fig. 1 A), there was a large shift to the left of the hAV7S2AJ33 amplification curves for the DN (8.5 cycles) and the CD8⁺ fractions (5 cycles) (Fig. 1 B) compared with the CD4⁺ fractions, indicating that DN and CD8⁺ cells contained 150–360- and 19–32-fold more hAV7S2AJ33 transcripts, respectively, than CD4⁺ lymphocytes. hAV7S2AJ33 transcripts were enriched in DN and CD8⁺ T cell preparations from all individuals tested, and on average the enrichment levels of hAV7S2AJ33 transcripts in DN T cells were much higher than those observed for the NK1 T cell–specific invariant chain hAV24AJ18 (data not shown).

View larger version (20K): [in this window] [in a new window] [Download PPT slide]   Figure 1 High levels of hAV7S2/AV19-AJ33 TCR chain are present in DN T cells from three mammal species: the indicated cell subpopulations were purified by FACS® sorting from human (A and B) or bovine (C and D) PBLs and from mouse lymph nodes (E and F). Duplicate RNA preparations were obtained and, after reverse transcription, PCR was carried out for the indicated gene segments. The amount of amplicon was quantified by ELISA at the indicated cycle. Averaged values of duplicates are shown for C–F. CD8+ fraction contains both CD8+ and CD8β+ TCR /β+ T cells. In cattle, no amplification could be obtained with boAV19-AJ33 primers in the CD8+ fraction, and thus the corresponding curves are not displayed.

 
Because a similar invariant chain had been sequenced once in cattle (40), we examined its distribution within CD4⁺, CD8⁺, DN, or (CD4⁺ plus CD8⁺) sorted cells obtained from bovine blood. As shown in Fig. 1, C and D, the levels of boAV19AJ33 transcripts in the DN fractions were as high as those observed in humans. No boAV19AJ33 amplification could be obtained with the CD8⁺ fraction, and the comparison of CD4⁺ and CD4⁺ plus CD8⁺ amplification curves suggested that bovine CD8⁺ cells did not express high amounts of boAV19AJ33 transcripts.

In mice, no canonical TCR chain rearrangement involving mAV19 and mAJ33, the murine elements that are homologous to hAV7S2 and hAJ33, respectively, had been described. However, quantitative PCR analysis of mAV19AJ33 transcripts within highly purified murine /β DN, CD4⁺, and CD8⁺ lymphocytes indicated that, as in human and bovine blood, increased mAV19AJ33 expression was observed in the DN fraction from lymph nodes (Fig. 1, E and F). The shift of the amplification curves between DN and CD4⁺ cell preparations was lower than in humans and cattle, suggesting that mAV19AJ33-bearing cells were less abundant in mice.

hAV7S2-AJ33, mAV19AJ33, and boAV19AJ33 Transcripts Display the Same CDR3 Length in the Three Species.
To examine the length of the CDR3 regions of the hAV7S2AJ33 transcripts and their homologues in mice and cattle, we carried out polyclonal sequencing of V-C or V-J amplicons obtained from the various lymphocyte subpopulations in these species. As shown in Fig. 2 A, a readable hAV7S2AJ33 sequence was obtained from hAV7S2-C amplicons derived from DN and CD8⁺ samples but not from CD4⁺ samples. Therefore, this indicated that in the former but not the latter cells, the hAV7S2 segment was predominantly rearranged to the hAJ33 segment and comprised a CDR3 of constant length. The polyclonal hAV7S2AJ33 sequence displayed some heterogeneity at the VJ junction, in agreement with previous results from Porcelli et al. showing some variability of the two N-encoded amino acids (39).

View larger version (84K): [in this window] [in a new window] [Download PPT slide]   Figure 2 (A) The CDR3 of hAV7S2-AJ33 TCR chain is of constant length in DN T cells and in human CD8+ T cells. PCR amplifications from hAV7S2 to C (V-C) or to AJ33 (V-J) were carried out on cDNA from the T cell subpopulations indicated, and polyclonal sequencing was carried out using the same AV7S2/AV19 primer as used for amplification. Panel B displays polyclonal sequencing of FACS®-sorted CD8β+ or CD8+ TCR /β+ human PBLs.

 
In cattle, the picture was slightly different, as polyclonal sequencing of boAV19-C amplicons demonstrated the predominant presence of the invariant boAV19AJ33 chain in DN cells, but not in CD4⁺ or CD8⁺ cells (data not shown). At the VJ junction, the polyclonal sequence derived from DN cells displayed some junctional heterogeneity, indicating also some variability of the two amino acids encoded by N additions. In mice, polyclonal sequencing of the mAV19-C amplicons showed a fully readable sequence for the DN but not for the CD8⁺ fraction (data not shown). Moreover, the VJ sequence displayed no heterogeneity and corresponded to a "germline" junction without nucleotide trimming or N addition (see also Table II below). Altogether, these results demonstrated that in the three species, DN /β⁺ T cells were enriched for cells bearing TCR chains with highly homologous AVAJ elements (hAV7S2AJ33, mAV19AJ33, and boAV19AJ33) and constant CDR3 length as shown in the multiple alignment displayed in Fig. 3. This novel canonical TCR chain will be referred to hereafter as the "invariant" V7/19-J33 TCR chain.

View this table: [in this window] [in a new window]   Table II Summary of the Mouse Vβ Repertoire of T–T mAV19-AJ33+ Hybridomas

 

View larger version (20K): [in this window] [in a new window] [Download PPT slide]   Figure 3 High homology of human, cattle, and mouse hAV7S2/AV19-AJ33 chains. Homologies were scored using the default PAM250 of ClustalW as implemented in MacVector software (Oxford Technology). Identities are bold and shaded in gray; similarities are light gray. The CDR3 region is boxed.

 
Direct Numbering of Cells Bearing Invariant V7/19-J33 Chains.
A large amount of invariant chain transcripts does not formally demonstrate the existence of a large number of invariant TCR chain–bearing cells, as this transcript could have been expressed at very high levels in a few cells. To more directly estimate the number of cells using the invariant V7-J33 chain, single /β⁺ DN cells from three different subjects were sorted into PCR plates using a single cell deposition unit. FACS^®-sorted /β⁺ TCR CD8⁺ or CD4⁺ cell suspensions were also serially diluted into PCR plates to get 12 replicates of the indicated cell concentrations. After cell lysis, hAV7S2AJ33 PCR amplification was carried out on genomic DNA with luminometry detection of the amplicons. As shown in Fig. 4 A, the assay was sensitive enough to detect a single cell harboring the relevant rearrangement and yielded a frequency of V7-J33⁺ DN cells of 1/7.4. Using limiting dilution analysis (LDA), the frequency observed for CD8⁺ cells was 1/36 (confidence interval: 1/25–1/70; Fig. 4 B). Sequence analysis of amplicons from single cell preparations obtained with DN and CD8⁺ cells demonstrated the presence of invariant V7-J33 transcripts in all cases. A similar analysis on CD4⁺ cells yielded a frequency of V7-J33⁺ cells of 1/1,093 (1/751–1/2,003; Fig. 4 C). Importantly, sequencing of the positive wells at concentrations where the V7-J33 amplicons were derived from one cell showed that out of six positive wells, two corresponded to a rearrangement of the hAV7S2 to hAJ34 (which were amplified because of the short genomic distance [700 bp] separating hAJ34 from hAJ33), three corresponded to a rearranged V7-J33 chain with a different CDR3 length, and only one corresponded to the invariant V7-J33 chain. Thus, the actual frequency of CD4⁺ cells harboring the invariant V7-J33 chain should be 1/6,000.

View larger version (15K): [in this window] [in a new window] [Download PPT slide]   Figure 4 Direct enumeration of AV7S2/AV19-AJ33–bearing cells by PCR–limiting dilution analysis and single cell PCR. (A) DN cells obtained from three human subjects were seeded into microtiter plates using a FACS® single cell deposition unit. After cell lysis, PCR was carried out with AV7S2 and AJ33 primers, and the amount of amplicons was quantified by ELISA. (B and C) /β CD8+ or CD4+ cells were obtained by FACS® sorting, serially diluted, distributed in a microtiter plate at the indicated cell concentration, and processed as above. In C (CD4+ cells), the amplicons of the six wells indicated (which had a high probability of clonality) were sequenced. The sequences were as follows:1-GCT GTG ATG TCG AT2-GCT GTG AGA GAG ATC GGA3-GCT GTG AGA GAT4-GCT GNN ACT CGA5-GCT GTG AGA GAG GAT AAC-AJ34-intron-AJ336-GCT GTG AGG GGG GGG GAA AAC-AJ34-intron-AJ33Only one (sequence 3) corresponds to the canonical AV7S2-AJ33 rearrangement (see text for details). In B and C, frequencies were calculated by maximum likelihood analysis.

 
In mice, V19-J33⁺ cells were less numerous than in humans. Their frequency within /β DN lymph node cells was 1/56 (Fig. 5 A), compared with 1/7.5 in humans (Fig. 4 A).

View larger version (17K): [in this window] [in a new window] [Download PPT slide]   Figure 5 mAV19-AJ33+ cells are more frequent in TAP–/– mice. The indicated number of DN T cells from B6 (A) or TAP–/– (B) mice were seeded in PCR microplates, and the presence of the mAV19-AJ33 rearrangement was detected by PCR-ELISA.

 
Surface Phenotype and TCR β Repertoire of V7/19-J33–bearing Cells
Invariant V7-J33–bearing Cells Express Memory Markers and Show a Biased Usage of hBV2 and hBV13 TCR β Chains.
In the absence of anti-hAV7S2 or anti-mAV19 antibody, we used the following strategy to characterize the surface phenotype of the population expressing the invariant V7-J33 chain. /β DN and CD8⁺ cells were depleted or enriched for a given marker by FACS^® sorting, and the amounts of V7-J33 transcripts in the positive and negative fractions were quantified and compared with the amounts of amplified C transcripts, in order to take into account variations in cell number. Fig. 6 displays an example of such an experiment, where we examined whether the CD8 molecules expressed by V7-J33⁺ cells were either heterodimeric (β) or homodimeric (), since CD8⁺ cells represent between 5 and 25% of CD8⁺ TCR /β⁺ lymphocytes in human PBLs (data not shown). There were 45-fold more V7-J33 transcripts in the CD8⁺ fraction than in the CD8β⁺ fraction. This result was confirmed by polyclonal sequencing of the amplicons obtained after amplification with hAV7S2/C (V-C) or hAV7S2/hAJ33 (V-J) primers: no readable sequence was obtained from the CD8β⁺ fraction, whereas the invariant chain was present in the CD8⁺ fraction (Fig. 2 B). The absence of a readable sequence in the CD8β⁺ fraction using V-J amplification indicates the near absence of the invariant chain in this fraction. Using this strategy, it could be established that V7-J33⁺ cells had mainly a memory phenotype (i.e., CD45R0⁺CD45RA^–) and were CD56^–CD57^–CD28⁺CD27⁺ (data not shown).

View larger version (17K): [in this window] [in a new window] [Download PPT slide]   Figure 6 hAV7S2-AJ33–bearing cells are CD8+ or DN. The indicated TCR /β+ fractions were FACS® sorted using a four-color staining with anti-CD4–TC, anti-CD8–FITC, anti-CD8β–PE, and anti-/β TCR–APC. The amounts of C (A) or hAV7S2-AJ33 (B) transcripts were quantified by kinetic PCR using the ABI Prism 7700 apparatus (Taqman). This experiment was repeated with cells from another subject with identical results. Rn, difference in fluorescence relative units.

 
Despite many attempts using different lymphokine mixtures, we were unable to obtain a large enough number of T cell clones expressing the invariant V7-J33 chain. Therefore, the TCR β chain repertoire of DN cells bearing invariant V7-J33 chain was directly estimated by single cell PCR analysis. After single cell deposition of DN /β cells into PCR plates, cells were lysed and a first PCR reaction was carried out using hAV7S2, hAJ33, and a mixture of 29 Vβ and 7 Jβ. This first reaction was then amplified in a second PCR with nested AV7S2/AJ33 primers allowing us to find the wells containing V7-J33⁺ cells. Using the reaction mixture of the first PCR corresponding to the positive wells, 24 individual PCR reactions were set up using 1 (or 2) Vβ and a mixture of 7 Jβ primers. This allowed us to get a specific band for 0–2 Vβ which was then sequenced using the relevant Vβ primer. In 9 independent experiments carried out on DN cells obtained from 3 different subjects, the frequency of V7-J33⁺ wells ranged between 6 and 16/84. Among the 92 V7-J33⁺ wells studied, a β chain could be assigned and sequenced in 37 cases (40%), and we found that there was a heavy bias toward Vβ13 and Vβ2. Out of 13 Vβ sequenced in donor A, 7 were BV13⁺ and 3 were BV2⁺. In donor B, 8/12 were BV13⁺ and 4/12 were BV2⁺. In donor C, 7/12 were BV13⁺ and 2/12 were BV2⁺. However, despite this biased usage of BV13 or BV2 regions, the TCR β chains derived from V7-J33⁺ cells did not show obvious restrictions in Jβ usage or in CDR3 length (Table I). Sequence analysis of VJ junctions confirmed the presence of V7-J33 chains with the canonical CDR3 length and revealed significant variations in amino acid composition at the two N-encoded positions (Table I). Moreover, the presence of repeated TCR and β chain junctional sequences in different cells from the same subject cloned in different PCR plates and the fact that these TCR chains were not found in other subjects indicated that this subset had undergone clonal expansion in vivo, an interpretation that is consistent with its memory phenotype (see above). Overall, V7-J33⁺ cells appear to use a semirestricted repertoire that is expanded as needed.

View this table: [in this window] [in a new window]   Table I Vβ Repertoire of Human Invariant AV7S2-AJ33 TCR Chain–bearing Cells

 
TCR β Chain Repertoire of V19-J33⁺ Cells.
Because the frequency of V19-J33⁺ cells is not as high in mice as in humans, the strategy followed to characterize the surface phenotype of human V7-J33⁺ cells was not successful in mice. Therefore, to characterize the TCR β chain repertoire of this subset, we took advantage of the fact that V19-J33⁺ cells are enriched in TAP^–/– mice (see below). We generated T–T hybridomas from DN enriched lymph node cells from TAP^–/– mice, and screened for expression of V19-J33 transcripts. In agreement with the single cell analysis (Fig. 5 B), 16/168 hybridomas studied were V19-J33⁺. As shown in Table II, in all cases, these hybridomas carried V19-J33 chains with the canonical CDR3 length and in all but two cases, the V19-J33 junction was germline encoded. The Vβ segments used were predominantly BV8⁺ (7/16) and BV6⁺ (4/16). No restriction in the Jβ repertoire was apparent.

Development and Selection of V7/19-J33–bearing Cells
Ontogeny of V7/19-J33–bearing Cells.
NK1 T cells are not found in neonates and accumulate after birth (5). Therefore, we examined cord blood lymphocytes for V7/ 19-J33 sequences by quantitative PCR and polyclonal sequencing of V7-C or V7-J33 amplicons on cDNA obtained from enriched DN/CD8⁺ or CD4⁺ fractions. We were unable to find significant amounts of invariant V7-J33 transcripts in cord blood in the six samples studied. However, significant amounts of this chain could be obtained in young children, albeit in lower amounts than in adults (data not shown).

Similarly, V19-J33–bearing cells were not found in spleen or thymus of mouse neonates (data not shown). They were present in lymph nodes and blood in large amounts and in smaller amounts in the spleen in the five mouse strains tested, as shown in Table III (top), which displays a summary of the studies examining the tissue distribution of V19-J33–bearing cells. Importantly, although more than half of the human invariant V7-J33⁺ cells were CD8⁺ cells, which might suggest an extrathymic development pathway (43), invariant V19-J33 rearrangements were not detected in nude mice either by quantitative PCR (Table III, top) or polyclonal sequencing (data not shown), indicating that the thymus is required for their development.

View this table: [in this window] [in a new window]   Table III Strain and Tissue Distribution, and MHC Selection of mAV19-AJ33+ T Cells

 
Development of V7-J33⁺ Cells Is Not Affected in MHC Class II– and TAP-deficient Patients.
The restriction element of V7-J33⁺ cells could be either a class I or class II MHC molecule, as they do not express CD4 or CD8β accessory molecules. To address this issue, we quantified the expression of the V7-J33 invariant chain in PBLs obtained from MHC-deficient patients. MHC class II– deficient patients harbor low but significant numbers of CD4⁺ /β lymphocytes whose Vβ repertoire is grossly normal (44). CD4⁺, CD8⁺, and DN enriched fractions were prepared and analyzed by quantitative PCR. Although the amount of C was much lower in the DN than in the CD4⁺ samples (Fig. 7 A), the amounts of V7-J33 transcripts were comparable in both samples (Fig. 7 B), therefore indicating an enrichment of V7-J33 transcripts within DN cells and, presumably, selection of invariant V7-J33–bearing cells in this patient. Accordingly, the predominance of the invariant V7-J33 sequence within DN cells was confirmed by polyclonal sequencing (data not shown). Similar results were obtained in the two other patients studied. Taken together, these results strongly suggest that the restriction element of the invariant V7-J33⁺ cells is not an MHC class II molecule.

View larger version (20K): [in this window] [in a new window] [Download PPT slide]   Figure 7 AV7S2-AJ33–bearing cells are present in MHC class II– and TAP-deficient patients. The indicated cell subpopulations were obtained from an MHC class II– (A and B) or a TAP-deficient (C and D) patient. The amounts of C or hAV7S2-AJ33 transcripts were quantified by kinetic PCR-ELISA. Two other MHC class II– deficient patients and another TAP-deficient patient were studied with similar results.

 
There is no MHC class I–deficient patient described to date, but we could obtain PBLs from two TAP-deficient siblings (45). In these patients, /β⁺ TCR CD8⁺ cells are reduced in numbers at birth but may expand with age. /β⁺ TCR CD4⁺ and CD8⁺ cells were separated in one of these patients, and the amount of C and V7-J33 transcripts was quantified in the two fractions. Despite lower amounts of C in the CD8⁺ fraction, the amount of V7-J33 transcripts was much higher in the CD8⁺ fraction (Fig. 7, C and D). Enrichment for V7-J33 transcripts was also demonstrated in a PHA-stimulated CD8⁺ line derived from the other TAP-deficient patient, when compared with either unsorted PBL-derived cell line from the same patient or to CD8⁺ cells from healthy donors (data not shown). Actually, the larger amounts of V7-J33 transcripts in the CD8⁺ /β T cells of TAP-deficient patients is in agreement with the higher proportion of CD8⁺ cells in these patients (data not shown). This indicates that T cells bearing this invariant chain are probably not selected by a TAP-dependent MHC class I molecule.

Thus, the selecting molecule for the invariant V7-J33⁺ cells appeared to be neither an MHC class II nor a classical MHC class I molecule. However, because the defect in MHC class II expression may not be complete and the level of MHC class I expression in TAP-deficient patients is still 1% of normal, no definitive conclusion could be drawn from these studies. Therefore, we turned to the mouse, where carefully controlled studies using well-characterized MHC-deficient mice can be performed.

The Selecting Ligand for V19-J33⁺ Cells Is β2m-dependent, TAP-independent, and Distinct from CD1.
The amount of V19-J33 transcripts was examined in /β⁺ DN lymph node cells from several MHC-deficient strains. Because the frequency of V19-J33⁺ cells and the percentage of DN cells are lower in mice, the differences between positive and negative samples are smaller in mice than in humans. However, despite higher levels of C in the β2m^–/– samples, there were fewer V19-J33 transcripts than in control or I-A^b–/– mice (Fig. 8, A and B). Polyclonal sequencing of V19-J33 amplicons from β2m^–/– samples showed the complete absence of invariant V19-J33 transcripts. This was consistent with an MHC class I or β2m-dependent class I–like selection of the invariant V19-J33⁺ cells. However, the relevant molecule is not a classical MHC class I molecule because the amount of invariant V19-J33 transcripts was higher in the DN cells from K^b–/–D^b–/– mice than in controls, though the C levels were lower. These results suggest that the MHC class I selecting molecule is not a classical one and that, in the absence of classical class I molecules, the invariant chain–bearing DN cells are less diluted by mainstream cells. In Fig. 8, C and D, V19-J33 transcripts were quantified in CD8-, CD1-, and TAP-deficient mice, B6 and β2m^–/– mice being used as positive and negative controls, respectively. There was no decrease in the amounts of V19-J33 transcripts in CD1-deficient mice, indicating that V19-J33⁺ cells were not selected by CD1 or a CD1-bound ligand. The curves for TAP^–/– samples were actually shifted to the left, indicating an increased frequency of V19-J33⁺ cells in TAP^–/– mice, in agreement with the result shown in Fig. 5 B where the frequency of V19-J33⁺ cells in DN TAP^–/– mice was 1/8.5 (i.e., a sixfold increase compared with B6; Fig. 5 A). The V19-J33 curve corresponding to the CD8-deficient mice is similar to that of B6, indicating the presence of V19-J33 invariant chains in CD8^–/– mice. This was confirmed by polyclonal sequencing (data not shown). Altogether, these results, summarized in Table III (bottom), indicate that V19-J33⁺ cells do not require CD8 for their selection and that the selecting molecule is a β2m-dependent, TAP-independent molecule distinct from CD1.

View larger version (25K): [in this window] [in a new window] [Download PPT slide]   Figure 8 AV19-AJ33+ cells are selected by a β2m-dependent, TAP-independent nonclassical MHC–like molecule distinct from CD1. DN lymph node cells were obtained from the indicated mice, and the amounts of C (A and C) and mAV19-AJ33 (B and D) transcripts were quantified by kinetic PCR-ELISA. All results were confirmed by polyclonal sequencing.

 

	Discussion

Top Abstract Materials and Methods Results Discussion References

 
Invariant V7.2-J33 TCR chain and its murine and bovine homologues were found in three different mammalian species and, thus, define a new phylogenetically conserved T cell population using a canonical TCR repertoire. In humans, DN and CD8⁺ cells bearing invariant V7-J33 chain accumulate after birth and become quite abundant, as they represent 0.1–0.2% of all human PBLs. Therefore, it is legitimate to wonder why such cells have not been previously reported. This may be due to the lack of a stringent Vβ repertoire restriction, or to the difficulties in growing clones expressing this invariant chain (our unpublished observations), together with methodological limitations linked to TCR chain repertoire analysis (e.g., lack of allelic exclusion [46]). However, this invariant chain had already been described in DN cells by Porcelli et al. (39) and, among the 317 random CDR3 sequences reported by Moss and Bell (47), 4 (1.2%) had a sequence corresponding to the V7-J33 invariant chain. In the same study, this canonical sequence was not found in cord blood samples or in CD4⁺ cells, but represented 3/40 (7.5%) CDR3 sequences derived from CD8⁺ cells. This age and cell distribution is in agreement with our own measurements (data not shown). In cattle, this CDR3 was found in 1/20 TCR chains randomly sequenced (40). In mice, random cloning of TCR chains revealed one example of this invariant V19-J33 chain (48). It should be stressed that as shown in Fig. 3, the AJ33 segments are quasi-identical in the three species. The mouse and human J loci are entirely homologous, with the same genomic organization and an average similarity of 71% including the J coding sequences (41, 42, 49). The AJ33 is the most similar J segment between mouse and human sequences with only one amino acid difference; the two other most similar human/ mouse pairs (AJ23 and AJ24) have four and three amino acid differences, respectively (41). This quasi identity between mouse and human AJ33 segments suggests a strong selective pressure for these segments.

In humans and cattle, the TCR chain displayed some junctional diversity, whereas in mice a genomic sequence without trimming or N additions was found in most cases (Table II). However, a murine sequence made by trimming and reconstitution of the canonical sequence through N additions was found in two hybridomas (11F1 and 4H1 in Table II), indicating that the TCR in mice is selected at the protein level. In humans, the invariant TCR chain was associated with a limited number of Vβ segments (mostly hBV2 and hBV13), and the same TCR with the same nucleotide sequence was present in different cells from two subjects, suggesting oligoclonal expansions. Despite this combinatorial restriction, TCR β chain diversity of invariant V7-J33⁺ cells remained extensive, since most Jβ segments and seven Vβs were found associated with CDR3s of variable length. In mice, five different Vβs were observed with a high proportion of mBV6 and mBV8. Importantly, the murine orthologous segments of hBV13 are mBV8 and mBV6 (50–52).

This semi-invariant repertoire selected at the protein level is reminiscent of the repertoire observed in murine epithelial DECs and in murine and human NK1 T cells. In DECs, an invariant repertoire generated from genomic sequences is selected at the protein level, as the same epitope recognizable by an mAb can be reconstituted by different V segments when the original GV1 and GV2 segments are inactivated by homologous recombination (13). For NK1 T cells, selection at the protein level was also apparent (14), and the transgenic overexpression of the invariant mAV14AJ18 was sufficient to induce a large increase in the number of NK1 T cells (53).

The restriction element of V7/19-J33⁺ cells is probably an MHC class Ib molecule distinct from CD1d, though a β2m-derived peptide presented by a "nonclassical" class II molecule cannot be formally excluded. The selecting molecule should be present in both mice and humans. Murine Qa-1 and human HLA-E might be good candidates, given their structural homology and their ability to bind to homologous CD94/NKG2 receptors in both species (54–56). However, when using HLA-E tetramers complexed with HLA-G leader sequence–derived peptide (56), we were unable to find any difference in expression levels of the invariant V7-J33 chain between FACS^®-sorted HLA-E tetramer–positive and –negative (DN plus CD8⁺) /β⁺ TCR PBL fractions (data not shown). Moreover, the invariant V19-J33 chain was not expressed by three TAP-independent anti–Qa-1 clones provided by J. Forman (University of Texas, Dallas, TX [57]; data not shown). Nonetheless, no definitive conclusions as to the HLA-E/ Qa-1 specificity of the invariant TCR can be drawn from these negative results because the invariant TCR may recognize HLA-E complexed with another peptide. Another candidate class I molecule that is widely expressed in both mice and humans is the recently described MR1 molecule (58, 59). Identification of the selecting element is underway by testing reactivity of mouse hybridomas against different cell types and MHC class I/Ib transfectants.

The expression of CD8 on V7-J33⁺ cells could argue for an extrathymic development pathway (43). However, these cells were not found in nude mice (Table III, top), in human intraepithelial lymphocytes (IELs) (Cerf-Bensussan, N., E. Treiner, and O. Lantz, unpublished results), or in murine IELs or lamina propria lymphocytes (Guy-Grand, D., F. Tilloy, and O. Lantz, unpublished results), and their frequency was not particularly high in mouse bone marrow (Table III, top). Thus, V7/19-J33⁺ cells seem to be mainly thymus dependent. In this respect, the fact that we have been unable to find large numbers of these cells in human or mouse thymus (data not shown) does not preclude an intrathymic development. Indeed, if the antigen is not present in sufficient amounts in the thymus, these cells may not accumulate locally and may be diluted out by mainstream /β T cells in the periphery. The absence of significant numbers of V19-J33⁺ cells in mouse CD8⁺ cells (Fig. 1 F, and polyclonal sequencing after V-J amplification [not shown]) is in agreement with the extremely low numbers (<0.4%) of CD8⁺ cells in murine blood or lymph nodes (data not shown). The CD8 expression on some invariant V7-J33⁺ cells and its complete absence on V19-J33⁺ counterparts is reminiscent of the phenotype of NK1 T cells, which may express CD8⁺ in humans (28) but never in mice. The reasons for such phenotypic differences between mice/cattle and humans as well as the role of CD8 expression in human PBLs are not clear. There have been contradictory reports concerning the role of homo- versus heterodimeric CD8 (60–63). In addition, CD8 expression in human PBLs might reflect an activated status rather than a particular differentiation pathway (64).

Concerning the development pathway of the V7/19-J33 cells, in the three species there seems to be no expression of the invariant chain in the CD8β⁺ T cells, strong enrichment for this sequence within DN cells (as well as within human CD8⁺ cells), and persistence of the invariant sequence in the CD4⁺ subset. Indeed, in humans, the frequency of invariant chain–bearing cells was 1/6,000 in the CD4⁺ fraction. Moreover, polyclonal sequencing of V7-J33 amplicons from CD4⁺ cells (Fig. 2 A) revealed the presence of canonical CDR3 at a low, though readable, frequency, whereas the canonical CDR3 was undetectable in CD8β⁺ samples (Fig. 2 B). In mice and cattle, there was also a small but reproducible shift of the CD4⁺ amplification curves to the left compared with the CD8⁺ curves, suggesting some expression of the invariant chain in murine or bovine CD4⁺ cells. Accordingly, a readable canonical sequence in V19-J33 amplicons was detected in the CD4⁺ but not in the CD8⁺ fraction in both species (data not shown). The absence of any readable sequence after V-J amplification of CD8/β⁺ cells suggests that the CD8β⁺ V7/19-J33– bearing cells are deleted by negative selection, as are NK1 T cells in CD8 transgenic mice (14). These results are compatible with the hypothesis that V7/19-J33 cells follow a normal T cell development pathway but that, in contrast with NK1 T cells where the numbers of CD4 and DN NK1 T cells are similar, CD4⁺ T cells bearing the V7/19-J33 chain are diluted out by mainstream lymphocytes.

A memory phenotype associated with an oligoclonal repertoire may be related to recognition of either an endogenous ligand or a ubiquitous pathogen. In favor of an endogenous ligand is the finding that invariant V7-J33⁺ cells existed in an 18-mo-old child who had not been vaccinated with Calmette-Guérin bacillus (BCG) and in several subjects who had negative EBV and CMV serologies (data not shown). On the other hand, the abundance of V7/19-J33–bearing cells in humans and cattle contrasting with a lower number of these cells in mice could be related to the clean environment in which laboratory mice are housed. The two hypotheses are not mutually exclusive, as cells selected by an endogenous ligand could be ready to react against a highly prevalent pathogen.

Both NK1 T cells and V7/19-J33–bearing cells display semi-invariant repertoires (i.e., one monomorphic chain and a biased Vβ chain repertoire), suggesting that their TCRs may have similar characteristics, probably a high affinity for a selecting ligand by the invariant chains, as the transgenic overexpression of AV14AJ18 is sufficient to greatly increase the number of NK1 T cells (53). Together with the similarities in their restricting elements (a TAP-independent, β2m-dependent nonclassical MHC class I–like molecule), the absence of accessory molecule (CD4 or CD8) involvement suggests that they may recognize a high-density ligand that might therefore be a saccharide or a glycolipid.

Are there other invariant TCR chains defining other T cell subpopulations? We did not find any after measuring the amounts of several other chains which had been found either in DN T cells (39) or in a "regulatory" subpopulation (65–67; Tilloy, F., and O. Lantz, unpublished observations). However, the definite resolution of this issue awaits a systematic study of the expression of all AV-AJ combinations, and other populations may exist in other organs in the same way that / subpopulations are distributed.

Concerning the functions of V7/19-J33⁺ lymphocytes, future analysis of the mAV19AJ33 transgenic mice we have made will certainly help address this point. The high frequency of V7/19-J33⁺ T cells and their extensive phylogenetic conservation in mammals both argue for an important physiological function. Because V7/19-J33⁺ and NK1 T cells are selected by distinct ligands, they may complement each other and act synergistically either in defense mechanisms against broadly distributed pathogens or in immune/nonimmune homeostatic processes.

	Acknowledgments

Submitted: 3 February 1999
Revised: 8 April 1999

F. Tilloy and E. Treiner contributed equally to this work.

	References

Top Abstract Materials and Methods Results Discussion References

 

1 Davis, M.M., and Y.-H. Chien. 1998. T-cell antigen receptors. In Fundamental Immunology. 4th ed. W.E. Paul, editor. Lippincott-Raven Publishers, Philadelphia. 341–366.

2 Hardy RR, Li YS & Hayakawa K. Distinctive developmental origins and specificities of the CD5+ B-cell subset, Semin Immunol, 1996, 8, 37–44.[Medline]

3 Kantor AB & Herzenberg LA. Origin of murine B cell lineages, Annu Rev Immunol, 1993, 11, 501–538.[Medline]

4 Haas W, Pereira P & Tonegawa S. Gamma/delta cells, Annu Rev Immunol, 1993, 11, 637–685.[Medline]

5 Bendelac A, Rivera MN, Park SH & Roark JH. Mouse CD1-specific NK1 T cells: development, specificity, and function, Annu Rev Immunol, 1997, 15, 535–562.[Medline]

6 Park SH, Chiu YH, Jayawardena J, Roark J, Kavita U & Bendelac A. Innate and adaptive functions of the CD1 pathway of antigen presentation, Semin Immunol, 1998, 10, 391–398.[Medline]

7 Bendelac A & Fearon DT. Innate pathways that control acquired immunity, Curr Opin Immunol, 1997, 9, 1–3.[Medline]

8 Boismenu R & Havran WL. Modulation of epithelial cell growth by intraepithelial gamma delta T cells, Science, 1994, 266, 1253–1255.[Abstract/Free Full Text]

9 Havran WL, Chien YH & Allison JP. Recognition of self antigens by skin-derived T cells with invariant gamma delta antigen receptors, Science, 1991, 252, 1430–1432.[Abstract/Free Full Text]

10 Kantor AB. V-gene usage and N-region insertions in B-1a, B-1b and conventional B cells, Semin Immunol, 1996, 8, 29–35.[Medline]

11 Hayakawa K, Hardy RR, Honda M, Herzenberg LA & Steinberg AD. Ly-1 B cells: functionally distinct lymphocytes that secrete IgM autoantibodies, Proc Natl Acad Sci USA, 1984, 81, 2494–2498.[Abstract/Free Full Text]

12 Allison JP & Havran WL. The immunobiology of T cells with invariant gamma delta antigen receptors, Annu Rev Immunol, 1991, 9, 679–705.[Medline]

13 Mallick-Wood CA, Lewis JM, Richie LI, Owen MJ, Tigelaar RE & Hayday AC. Conservation of T cell receptor conformation in epidermal gammadelta cells with disrupted primary Vgamma gene usage, Science, 1998, 279, 1729–1733.[Abstract/Free Full Text]

14 Lantz O & Bendelac A. An invariant T cell receptor chain is used by a unique subset of major histocompatibility complex class I–specific CD4⁺ and CD4^–8^–T cells in mice and humans, J Exp Med, 1994, 180, 1097–1106.[Abstract/Free Full Text]

15 Dellabona P, Padovan E, Casorati G, Brockhaus M & Lanzavecchia A. An invariant V24-JQ/Vβ11 T cell receptor is expressed in all individuals by clonally expanded CD4^–8^–T cells, J Exp Med, 1994, 180, 1171–1176.[Abstract/Free Full Text]

16 Bendelac A. Positive selection of mouse NK1⁺T cells by CD1-expressing cortical thymocytes, J Exp Med, 1995, 182, 2091–2096.[Abstract/Free Full Text]

17 Brutkiewicz RR, Bennink JR, Yewdell JW & Bendelac A. TAP-independent, β2-microglobulin– dependent surface expression of functional mouse CD1.1, J Exp Med, 1995, 182, 1913–1919.[Abstract/Free Full Text]

18 Brossay L, Chioda M, Burdin N, Koezuka Y, Casorati G, Dellabona P & Kronenberg M. CD1d-mediated recognition of an -galactosylceramide by natural killer T cells is highly conserved through mammalian evolution, J Exp Med, 1998, 188, 1521–1528.[Abstract/Free Full Text]

19 Kawano T, Cui J, Koezuka Y, Toura I, Kaneko Y, Motoki K, Ueno H, Nakagawa R, Sato H, Kondo E et al.. CD1d-restricted and TCR-mediated activation of v14 NKT cells by glycosylceramides, Science, 1997, 278, 1626–1629.[Abstract/Free Full Text]

20 Schofield L, McConville MJ, Hansen D, Campbell AS, Fraser-Reid B, Grusby MJ & Tachado SD. CD1d- restricted immunoglobulin G formation to GPI-anchored antigens mediated by NKT cells, Science, 1999, 283, 225–229.[Abstract/Free Full Text]

21 Yoshimoto T & Paul WE. CD4⁺, NK1.1⁺T cells promptly produce interleukin 4 in response to in vivo challenge with anti-CD3, J Exp Med, 1994, 179, 1285–1295.[Abstract/Free Full Text]

22 Arase H, Arase N & Saito T. Interferon production by natural killer (NK) cells and NK1.1⁺T cells upon NKR-P1 cross-linking, J Exp Med, 1996, 183, 2391–2396.[Abstract/Free Full Text]

23 Yoshimoto T, Bendelac A, Watson C, Hu-Li J & Paul WE. Role of NK1.1+ T cells in a TH2 response and in immunoglobulin E production, Science, 1995, 270, 1845–1847.[Abstract/Free Full Text]

24 Cui J, Shin T, Kawano T, Sato H, Kondo E, Toura I, Kaneko Y, Koseki H, Kanno M & Taniguchi M. Requirement for Valpha14 NKT cells in IL-12-mediated rejection of tumors, Science, 1997, 278, 1623–1626.[Abstract/Free Full Text]

25 Sumida T, Sakamoto A, Murata H, Makino Y, Takahashi H, Yoshida S, Nishioka K, Iwamoto I & Taniguchi M. Selective reduction of T cells bearing invariant V24JQ antigen receptor in patients with systemic sclerosis, J Exp Med, 1995, 182, 1163–1168.[Abstract/Free Full Text]

26 Wilson SB, Kent SC, Patton KT, Orban T, Jackson RA, Exley M, Porcelli S, Schatz DA, Atkinson MA, Balk SP et al.. Extreme Th1 bias of invariant Valpha24JalphaQ T cells in type 1 diabetes, Nature, 1998, 391, 177–181.[Medline]

27 Mieza MA, Itoh T, Cui JQ, Makino Y, Kawano T, Tsuchida K, Koike T, Shirai T, Yagita H, Matsuzawa A et al.. Selective reduction of V alpha 14+ NK T cells associated with disease development in autoimmune-prone mice, J Immunol, 1996, 156, 4035–4040.[Abstract]

28 Prussin C & Foster B. TCR V alpha 24 and V beta 11 coexpression defines a human NK1 T cell analog containing a unique Th0 subpopulation, J Immunol, 1997, 159, 5862–5870.[Abstract]

29 Bendelac A, Killeen N, Littman DR & Schwartz RH. A subset of CD4+ thymocytes selected by MHC class I molecules, Science, 1994, 263, 1774–1778.[Abstract/Free Full Text]

30 Dellabona P, Casorati G, Friedli B, Angman L, Sallusto F, Tunnacliffe A, Roosneek E & Lanzavecchia A. In vivo persistence of expanded clones specific for bacterial antigens within the human T cell receptor /β CD4^–8^–subset, J Exp Med, 1993, 177, 1763–1771.[Abstract/Free Full Text]

31 Porcelli S, Brenner MB, Greenstein JL, Balk SP, Terhorst C & Bleicher PA. Recognition of cluster of differentiation 1 antigens by human CD4–CD8– cytolytic T lymphocytes, Nature, 1989, 341, 447–450.[Medline]

32 Beckman EM, Porcelli SA, Morita CT, Behar SM, Furlong ST & Brenner MB. Recognition of a lipid antigen by CD1-restricted alpha beta+ T cells, Nature, 1994, 372, 691–694.[Medline]

33 Vugmeyster Y, Glas R, Perarnau B, Lemonnier FA, Eisen H & Ploegh H. Major histocompatibility complex (MHC) class I KbDb –/– deficient mice possess functional CD8+ T cells and natural killer cells, Proc Natl Acad Sci USA, 1998, 95, 12492–12497.[Abstract/Free Full Text]

34 Casanova JL, Romero P, Widmann C, Kourilsky P & Maryanski JL. T cell receptor genes in a series of class I major histocompatibility complex–restricted cytotoxic T lymphocyte clones specific for a Plasmodium bergheinonapeptide: implications for T cell allelic exclusion and antigen-specific repertoire, J Exp Med, 1991, 174, 1371–1383.[Abstract/Free Full Text]

35 Puisieux I, Even J, Pannetier C, Jotereau F, Favrot M & Kourilsky P. Oligoclonality of tumor-infiltrating lymphocytes from human melanomas, J Immunol, 1994, 153, 2807–2818.[Abstract]

36 Martinon F, Michelet C, Peguillet I, Taoufik Y, Lefebvre P, Goujard C, Guillet J-G, Delfraissy J-F & Lantz O. Persistent alterations in T-cell repertoire, cytokine and chemokine receptor gene expression after 1 year of highly active antiretroviral therapy, AIDS, 1999, 13, 185–194.[Medline]

37 Alard P, Lantz O, Sebagh M, Calvo CF, Weill D, Chavanel G, Senik A & Charpentier B. A versatile ELISA-PCR assay for mRNA quantitation from a few cells, Biotechniques, 1993, 15, 730–737.[Medline]

38 Holland PM, Abramson RD, Watson R & Gelfand DH. Detection of specific polymerase chain reaction product by utilizing the 5'—3' exonuclease activity of Thermus aquaticusDNA polymerase, Proc Natl Acad Sci USA, 1991, 88, 7276–7280.[Abstract/Free Full Text]

39 Porcelli S, Yockey CE, Brenner MB & Balk SP. Analysis of T cell antigen receptor (TCR) expression by human peripheral blood CD4^–8^–/β T cells demonstrates preferential use of several Vβ genes and an invariant TCR chain, J Exp Med, 1993, 178, 1–16.[Abstract/Free Full Text]

40 Ishiguro N, Tanaka A & Shinagawa M. Sequence analysis of bovine T-cell receptor alpha chain, Immunogenetics, 1990, 31, 57–60.[Medline]

41 Koop BF, Rowen L, Wang K, Kuo CL, Seto D, Lenstra JA, Howard S, Shan W, Deshpande P & Hood L. The human T-cell receptor TCRAC/TCRDC (C alpha/C delta) region: organization, sequence, and evolution of 97.6 kb of DNA, Genomics, 1994, 19, 478–493.[Medline]

42 Koop BF, Wilson RK, Wang K, Vernooij B, Zallwer D, Kuo CL, Seto D, Toda M & Hood L. Organization, structure, and function of 95 kb of DNA spanning the murine T-cell receptor C alpha/C delta region, Genomics, 1992, 13, 1209–1230.[Medline]

43 Rocha B, Vassalli P & Guy-Grand D. Thymic and extrathymic origins of gut intraepithelial lymphocyte populations in mice, J Exp Med, 1994, 180, 681–686.[Abstract/Free Full Text]

44 Rieux-Laucat F, Le Deist F, Selz F, Fischer A & de Villartay JP. Normal T cell receptor V beta usage in a primary immunodeficiency associated with HLA class II deficiency, Eur J Immunol, 1993, 23, 928–934.[Medline]

45 de la Salle H, Hanau D, Fricker D, Urlacher A, Kelly A, Salamero J, Powis SH, Donato L, Bausinger H, Laforet M et al.. Homozygous human TAP peptide transporter mutation in HLA class I deficiency, Science, 1994, 265, 237–241.[Abstract/Free Full Text]

46 Malissen M, Trucy J, Jouvin-Marche E, Cazenave PA, Scollay R & Malissen B. Regulation of TCR alpha and beta gene allelic exclusion during T-cell development, Immunol Today, 1992, 13, 315–322.[Medline]

47 Moss PA & Bell JI. Sequence analysis of the human alpha beta T-cell receptor CDR3 region, Immunogenetics, 1995, 42, 10–18.[Medline]

48 Lin WL, Kuzmak J, Pappas J, Peng G, Chernajovsky Y, Platsoucas CD & Oleszak EL. Amplification of T-cell receptor alpha- and beta-chain transcripts from mouse spleen lymphocytes by the nonpalindromic adaptor-polymerase chain reaction, Hematopathol Mol Hematol, 1998, 11, 73–88.[Medline]

49 Koop BF & Hood L. Striking sequence similarity over almost 100 kilobases of human and mouse T-cell receptor DNA, Nat Genet, 1994, 7, 48–53.[Medline]

50 Clark SP, Arden B, Kabelitz D & Mak TW. Comparison of human and mouse T-cell receptor variable gene segment subfamilies, Immunogenetics, 1995, 42, 531–540.[Medline]

51 Arden B, Clark SP, Kabelitz D & Mak TW. Mouse T-cell receptor variable gene segment families, Immunogenetics, 1995, 42, 501–530.[Medline]

52 Arden B, Clark SP, Kabelitz D & Mak TW. Human T-cell receptor variable gene segment families, Immunogenetics, 1995, 42, 455–500.[Medline]

53 Bendelac A, Hunziker RD & Lantz O. Increased interleukin 4 and immunoglobulin E production in transgenic mice overexpressing NK1 T cells, J Exp Med, 1996, 184, 1285–1293.[Abstract/Free Full Text]

54 Vance RE, Kraft JR, Altman JD, Jensen PE & Raulet DH. Mouse CD94/NKG2A is a natural killer cell receptor for the nonclassical major histocompatibility complex (MHC) class I molecule Qa-1(b), J Exp Med, 1998, 188, 1841–1848.[Abstract/Free Full Text]

55 Soloski MJ, DeCloux A, Aldrich CJ & Forman J. Structural and functional characteristics of the class IB molecule, Qa-1, Immunol Rev, 1995, 147, 67–89.[Medline]

56 Braud VM, Allan DS, O'Callaghan CA, Soderstrom K, D'Andrea A, Ogg GS, Lazetic S, Young NT, Bell JI, Phillips JH et al.. HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C, Nature, 1998, 391, 795–799.[Medline]

57 Aldrich CJ, Waltrip R, Hermel E, Attaya M, Lindahl KF, Monaco JJ & Forman J. T cell recognition of QA-1b antigens on cells lacking a functional Tap-2 transporter, J Immunol, 1992, 149, 3773–3777.[Abstract]

58 Riegert P, Wanner V & Bahram S. Genomics, isoforms, expression, and phylogeny of the MHC class I-related MR1 gene, J Immunol, 1998, 161, 4066–4077.[Abstract/Free Full Text]

59 Hashimoto K, Hirai M & Kurosawa Y. A gene outside the human MHC related to classical HLA class I genes, Science, 1995, 269, 693–695.[Abstract/Free Full Text]

60 Irie HY, Ravichandran KS & Burakoff SJ. CD8 β chain influences CD8 chain–associated Lck kinase activity, J Exp Med, 1995, 181, 1267–1273.[Abstract/Free Full Text]

61 Renard V, Delon J, Luescher IF, Malissen B, Vivier E & Trautmann A. The CD8 beta polypeptide is required for the recognition of an altered peptide ligand as an agonist, Eur J Immunol, 1996, 26, 2999–3007.[Medline]

62 Sun J & Kavathas PB. Comparison of the roles of CD8 alpha alpha and CD8 alpha beta in interaction with MHC class I, J Immunol, 1997, 159, 6077–6082.[Abstract]

63 Kern PS, Teng MK, Smolyar A, Liu JH, Liu J, Hussey RE, Spoerl R, Chang HC, Reinherz EL & Wang JH. Structural basis of CD8 coreceptor function revealed by crystallographic analysis of a murine CD8alphaalpha ectodomain fragment in complex with H-2Kb, Immunity, 1998, 9, 519–530.[Medline]

64 Paliard X, Malefijt RW, de Vries JE & Spits H. Interleukin-4 mediates CD8 induction on human CD4+ T-cell clones, Nature, 1988, 335, 642–644.[Medline]

65 Austrup F, Kodelja V, Kucharzik T & Kolsch E. Characterization of idiotype-specific I-Ed-restricted T suppressor lymphocytes which confine immunoglobulin class expression to IgM in the anti-alpha (1 3) Dextran B 1355 S response of BALB/c mice, Immunobiology, 1993, 187, 36–50.[Medline]

66 Schmidt-Wolf IG, Liang O, Dejbakhsh-Jones S, Wang H, Cheng L, Holm B, Bell R & Strober S. Homogeneous antigen receptor beta-chain genes in cloned CD4– CD8– alpha beta T suppressor cells, J Immunol, 1993, 151, 5348–5353.[Abstract]

67 Cheng L, Dejbakhsh-Jones S, Liblau R, Zeng D & Strober S. Different patterns of TCR transgene expression in single-positive and double-negative T cells. Evidence for separate pathways of T cell maturation, J Immunol, 1996, 156, 3591–3601.[Abstract]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Facebook

Reddit

Technorati

Twitter

This Article Abstract Full Text (PDF, 327K) PPT slides of all figures Alert me when this article is cited Citation Map Services Email this article Similar articles in this journal Similar articles in PubMed Alert me to new content in the JEM Download to citation manager Citing Articles Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Tilloy, F. Articles by Lantz, O. Search for Related Content PubMed PubMed Citation Articles by Tilloy, F. Articles by Lantz, O. Social Bookmarking                            What's this?