To elucidate the intracellular pathways that mediate early B cell development, we directed expression of activated Ras to the B cell lineage in the context of the recombination-activating gene 1 (RAG1)-deficient background (referred to as Ras-RAG). Similar to the effects of an
immunoglobulin (Ig) µ heavy chain (HC) transgene, activated Ras caused progression of
RAG1-deficient progenitor (pro)-B cells to cells that shared many characteristics with precursor (pre)-B cells, including downregulation of surface CD43 expression plus expression of
5,
RAG2, and germline
locus transcripts. However, these Ras-RAG pre-B cells also upregulated surface markers characteristic of more mature B cell stages and populated peripheral lymphoid tissues, with an overall phenotype reminiscent of B lineage cells generated in a RAG-
deficient background as a result of expression of an Ig µ HC together with a Bcl-2 transgene.
Taken together, these findings suggest that activated Ras signaling in pro-B cells induces developmental progression by activating both differentiation and survival signals.
Key words:
 |
Introduction |
Blymphocyte development proceeds through a series of
stages defined by the expression of surface markers and
by the status of Ig gene rearrangement (1). In this developmental program, upon productive rearrangement and expression of Ig µ heavy chain (HC)1 genes, B220+CD43+
pro-B cells progress to B220+CD43
pre-B cells. This
transition requires expression of the pre-B cell receptor
(pre-BCR) complex consisting of µ HC associated with
the invariant surrogate light chain proteins
5 and VpreB, most likely on the cell surface (2). Consistent with this notion, targeted germline deletion of the µ membrane exon
arrested murine B cell development at the pro-B cell stage
(3). Moreover, germline inactivation in mice of either the
recombinase-activating gene (RAG)1 or RAG2 genes,
which encode components of the V(D)J recombinase required for initiation of antigen receptor gene rearrangement, again resulted in a block in B lymphocyte development at the pro-B cell stage (4, 5). However, expression of
a rearranged µ HC transgene in the RAG-deficient background partially rescued this developmental block in the B
lineage, leading to the generation of B220+CD43
pre-B
cells and demonstrating that µ chain expression was sufficient to drive this developmental transition (6, 7).
Because the pre-BCR, like the mature BCR, has no
known intrinsic enzymatic functions, it must rely upon
associated proteins to provide a functional linkage with intracellular signaling pathways. The mature and pre-BCR-
associated Ig
and Ig
contain immunoreceptor tyrosine-based activation motifs (ITAMs), which are targets for phosphorylation by tyrosine kinases (8); these proteins are required for normal B cell development (9, 10). Furthermore, the importance of an ITAM-associated tyrosine kinase activity during early B lymphopoiesis was demonstrated in mice deficient in the syk tyrosine kinase, in
which an incomplete block in development was observed
at the B220+CD43+ pro-B cell stage (11, 12). Although
several downstream signaling pathways can be induced in B
cell lines (13), the identity of the targets downstream of the
nonreceptor tyrosine kinases that are activated by the pre-BCR complex has remained unclear. In this context, the
Ras family of GTPases (14) represents an attractive candidate. In numerous vertebrate systems, Ras proteins have
been implicated in linking tyrosine kinase-mediated signal
transduction to downstream effectors (15). In the T cell
lineage, constitutive expression of activated Ras in a RAG-deficient background has been shown to drive the expansion and differentiation of double negative thymocytes to
the CD4+ CD8+ (double positive, or DP) stage (16).
Moreover, Ras-dependent signaling after cross-linking of
the mature BCR has also been observed in lymphocyte cell
lines (17, 18). We hypothesized that if activation of endogenous Ras represents a necessary event in pre-BCR signaling, then introduction of constitutively activated Ras into
RAG-deficient pro-B cells could mimic signaling by the pre-BCR and result in developmental progression.
 |
Materials and Methods |
DNA Constructs.
The plasmid pEµ was constructed through
ligation of a 1,042-bp fragment containing the Ig HC enhancer
(Eµ) linked to a variable region promoter (19) into the SmaI site
of Bluescript II SK. A BamHI/PstI fragment containing two exons of the human
-globin gene was introduced at the KpnI site
of Bluescript II SK to provide splice sites and a polyadenylation
signal. pEµ was digested with SalI, treated with Klenow fragment
and alkaline phosphatase, and ligated to the c-Ha-ras V12 cDNA
(20) to complete pEµRasV12.
Embryonic Stem Cell Transfection and RAG2-deficient Chimera
Generation.
Cotransfection of RAG1
/
(16) CCE embryonic
stem (ES) cells was carried out with 10 µg NotI-linearized
pEµRasV12 together with 1 µg linearized PGK-puro (a gift of
P.W. Laird, University of Southern California School of Medicine, Los Angeles, CA). DNA was added to 107 ES cells, and
transfection was via electroporation at 300 V, 70 µF twice. Cells
were selected in 0.5 µg/ml puromycin (Sigma Chemical Co.).
Drug-resistant ES colonies were picked and subcloned for injection into RAG2-deficient blastocysts as previously described (21).
Analysis of RAG2-deficient Chimeras.
RAG2-deficient chimeras were maintained in a pathogen-free environment, and were
analyzed at 4-6 wk of age. FACS® analyses of bone marrow,
spleen, and lymph nodes were carried out as previously described
(22). Antibodies were purchased from PharMingen and were:
Cy-Chrome conjugated B220/CD45R (clone RA3-6B2); FITC-conjugated CD21/35 (CR2/CR1) (7G6), CD22.2 (Cy34.1), IgM (II/41), Ly 9.1 (30C7), B220/CD45R, and CD43 (S7); and
PE-conjugated CD43 (S7), CD2 (RM2-5), CD23 (B3B4), and
CD22.2. Analysis of stained samples was performed on a Becton
Dickinson FACSCalibur®, and sorting of B220+ Ly 9.1+ B lineage cells was carried out on an Ortho Cytofluorograf II or Becton Dickinson FACScan®; dot plots were generated using Cell
Quest software (Becton Dickinson).
Western Blot Analysis.
After red blood cell lysis in ammonium
chloride, single-cell splenocyte or lymph node suspensions were
treated with RIPA lysis solution (0.15 mM NaCl, 0.05 mM Tris-HCl, pH 7.2, 1% Triton X-100, 1% sodium deoxycholate, and
0.1% SDS) at 108 cells per ml, and postnuclear supernatants were
prepared following standard procedures. Proteins were resolved
using SDS/10% PAGE (loading 2 × 106 cell equivalents of lysate
per lane), transferred to Immobilon-P membranes (Millipore),
and probed with an anti-Ha-ras monoclonal antibody (clone
F235; Calbiochem), followed by a horseradish peroxidase-linked F(ab')2 sheep anti-mouse Ig (Boehringer Mannheim). For detection we used the ECL system (Amersham), and Ponceau-S staining was employed to verify equivalent protein loading.
Reverse Transcription PCR Analysis.
RNA was isolated from
106 sorted B220+Ly 9.1+ cells derived from Ras-RAG1
/
chimera or wild-type lymph node and spleen, together with sorted B220+CD43
IgM
wild-type pre-B cells, and B220+CD43+
RAG2-deficient pro-B cells using the TRIZOL reagent (GIBCO
BRL) and the manufacturer's protocol. 2 µg of RNA was used
for first-strand cDNA synthesis using SuperScript II reverse transcriptase (RT) (GIBCO BRL), following conditions recommended by the manufacturer. 1% of each cDNA synthesis reaction was used for PCR amplification, together with two serial
fivefold dilutions. 5- and 25-fold cDNA dilution samples were
mixed with cDNA derived from J1 ES cells to equalize template
amount in reactions amplifying lymphoid-specific
5 and RAG2;
because Bcl-2 and Bcl-xL were both expressed in ES cDNA (data
not shown), ES cell cDNA was not diluted into these reactions.
The ES cell cDNA dilution was determined through amplification of
-actin. 25 µl reactions contained: 1× PCR buffer, 200 µM dNTPs, 2 µM of both sense and antisense oligonucleotide
primers, and 1 U Taq polymerase (Qiagen). Primers for
5,
RAG2, Bcl-2, and
-actin were as previously described (23),
except that the 5'
5 oligonucleotide primer was 5' CTTGAGGGTCAATGAAGCTCAGA 3'. Primers for Bcl-xL were
as previously described (24). All primers contained sequences
spanning at least two exons, allowing clear distinction between
RNA and genomic DNA signals. PCR amplification conditions were as previously described (23). Expected sizes of amplified products were:
5, 337 bp; RAG2, 515 bp; Bcl-2, 315 bp, Bcl-xL, 557 bp;
-actin, 623 bp. For analysis of germline
transcripts, a
primer 5' of J
1 (5'CCACGCATGCTTGGAGAGGGGGTT3')
and a 3' primer within the coding sequence of J
2 were used
(25). RNA samples were treated with 5 U of RNase-free DNase
(Boehringer Mannheim) in 1× RT buffer for 30 min at 37°C.
The DNase was inactivated at 75°C for 10 min, followed by reverse transcription as above. Since germline
transcripts could
not be distinguished from contaminating genomic DNA, samples
not treated with RT were subjected to PCR analysis. Conditions
for amplification were 95°C for 2 min, then 24 cycles at 95°C for
30 s, 60°C for 1 min, and 72°C for 1.5 min. PCR products were
resolved on 1.5% agarose gels, blotted onto Zetaprobe GT (Bio-Rad), and probed with 32P-labeled cDNAs for
5 (6), with
cloned PCR fragments for RAG2,
-actin, Bcl-2, and Bcl-xL, or
with a HindIII fragment containing the germline J
region (26).
 |
Results |
To direct expression of activated Ras to B lineage cells,
we used an expression construct containing a c-Ha-rasV12
cDNA and Ig HC regulatory sequences (Fig. 1 A). This expression construct was transfected into RAG1-deficient ES
cells (16), and the resulting ES clones were tested for their
ability to generate B lineage cells in the RAG2-deficient
blastocyst complementation assay (21). Flow cytometry
analysis of bone marrow cells from Ras-RAG chimeras revealed low numbers of IgM
B220+CD43
B lineage cells
(which are absent in RAG-deficient mice); however, these
cells were also found in the spleen and lymph nodes in
numbers approaching those of normal, Ig-positive B cells
in wild-type mice (Fig. 2 and data not shown). To verify
that B220+ cells were derived from ES cells, the clonotypic
marker Ly 9.1 was used (data not shown). Furthermore,
expression of the Ha-ras protein in these chimeric mice
was confirmed by Western analysis of spleen and lymph
node cell lysates using an Ha-ras-specific monoclonal antibody (expression of endogenous Ras in lymphocytes is limited to N-ras and K-ras; reference 27) (Fig. 1 B). Therefore, activated Ras expression results in the generation of B
lineage cell populations that substantially populate the peripheral lymphoid tissues of RAG1-deficient mice.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 1.
Activated c-Ha-Ras
expression vector and Western
blot analysis of c-Ha-Ras expression. (A) Diagram of the
pEµRasV12 expression vector.
Eµ, Ig HC enhancer; VH, HC
variable region promoter; Ras,
c-Ha-ras V12 cDNA; -globin,
-globin exons 2 and 3 with
polyadenylation signal. (B)
Western blot analysis of total
spleen or lymph node lysates
from a Ras-RAG1 / , RAG2-deficient chimera and RAG2-deficient
mouse, probed with a monoclonal antibody against Ha-ras. The position
of p21 Ha-ras is indicated by the arrow. Ponceau-S staining was employed to verify equivalent loading of protein. Lane 1, Ras-RAG1 / total lymph node; lane 2, Ras-RAG1 / total spleen; lane 3, RAG2 / total spleen.
|
|

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 2.
Surface phenotype of Ras-RAG B lineage cells. Lymphocytes
isolated from lymph node of Ras-RAG1 / , RAG2-deficient chimera,
RAG2 / , and wild-type (129 Sv/Ev) mice were subjected to FACS® analyses. Depicted are log-scale dot plots of B220 versus CD43, IgM, CD23,
and CD21/CD35. The plots reflect 20,000 collected events, with dead cells
excluded by forward and side scatter. Similar results were found in the
spleen. Results shown are representative of those obtained in the analysis of
six chimeric mice derived from two independent transfected ES clones.
The number of B220+Ly9.1+ cells in these RAG2-deficient chimeras
ranged from 5 × 105 to 1.6 × 107 in lymph node and 2 × 106 to 7 × 106
in spleen. Chimeric animals analyzed for evidence of B cell developmental
progression showed no gross evidence of malignancy. Older chimeric mice
do tend to develop B lineage lymphomas, but such transformed cells are
significantly larger in cell size and have markedly altered surface antigen
staining characteristics (data not shown). Ras-Rag, activated Ras-complemented-RAG1-/-, RAG2-deficient chimera; Rag, RAG2 / mouse.
|
|
To further delineate the stage of maturation of B lineage
cells in Ras-RAG mice, we assayed for expression of various genes used to define stages of B cell differentiation.
RT-PCR assays demonstrated that populations of splenic
or lymph node Ras-RAG B lineage cells expressed
substantial levels of
5 and RAG2 transcripts, which are
normally transcribed in the pro-B and pre-B cells but generally are absent during later stages of development (23, 28). On the basis of semiquantitative RT-PCR analyses,
we determined that Ras-RAG cell populations expressed
5 and RAG2 at levels comparable to those in purified
wild-type pre-B cells (Fig. 3). In normal mice, productive
rearrangement and expression of µ HC genes in developing B cell progenitors leads to the transcriptional activation
and rearrangement of
light chain genes (29). To study
if signaling by activated Ras could mimic the induction of
germline transcription normally induced by expression of HC in pro-B cells, we determined the levels of germline
transcripts in Ras-RAG B lineage cells. We observed that
such transcripts were present in Ras-RAG B lineage cells
at levels similar to those in wild-type pre-B cells (Fig. 4).
These results suggest that activated Ras signaling in RAG-deficient B lineage cells promotes transcriptional activation
of the
light chain gene locus.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 3.
Analysis of 5 and RAG expression. RNA isolated from
Ras-RAG1 / (Ras-Rag), wild-type mature B (WT B), and wild-type
pre-B (WT Pre-B) lymphocytes purified from lymph node and spleen
was reverse transcribed, and first-strand cDNA was subjected to PCR
analysis using 5, RAG2, and -actin primer pairs (see Materials and
Methods). For each B lineage cell type, serial fivefold dilutions are shown.
ES cell cDNA was added to the 5- and 25-fold dilutions of each B lineage
cDNA sample to equalize template quantity. Single lanes containing no
cDNA (H2O) or ES cDNA alone are shown for each primer pair.
|
|

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 4.
light chain locus germline transcripts are upregulated in
Ras-RAG B lineage cells. RNAs from sorted B220+ Ly 9.1+Ras-
RAG1 / (Ras-Rag) B lineage cells, from B220+ CD43 IgM wild-type
pre-B cells (WT Pre-B), and from B220+CD43+ RAG2-deficient pro-B
cells (Rag Pro-B) were subjected to RT-PCR analysis for detection of
germline transcripts. Serial fivefold dilutions are shown, and ES cell
cDNA was diluted into 5- and 25-fold dilutions. Samples with (+) and
without (-) reverse transcriptase are indicated.
|
|
Given the large number of peripheral B lineage cells in
Ras-RAG mice, we further assayed for staining of more
mature B cell surface markers. On the basis of these assays,
we also found that the Ras-RAG B lineage cells in both
the bone marrow and periphery expressed surface antigens
usually associated with later stages of B cell development,
such as the low affinity IgE Fc receptor CD23 (34), the
BCR coreceptor CD22 (35), and complement receptor CD21/CD35 (36) (Fig. 2 and data not shown). Thus, our
data suggest that expression of activated Ras results in the
development of RAG-deficient B lineage cells that retain
major properties of pre-B lymphocytes while also expressing cell surface markers usually found only in mature B cell
stages. These Ras-RAG B lineage cells are distinct from
those generated in the RAG-deficient background via expression of an Ig µ HC transgene, which only promotes differentiation to cells that show pre-B cell characteristics and
remain primarily in the bone marrow (6, 7), but are similar
in patterns of gene expression and tissue distribution to
those observed in µ HC/Bcl-2 double transgenic, RAG-deficient mice (22, 37).
The similarity of the Ras-RAG phenotype to that promoted by µ HC plus Bcl-2 transgenes suggested to us that
activated Ras may signal both differentiative and cell survival processes. During normal B cell development, the antiapoptotic gene Bcl-2 is expressed at the pro-B stage, but is
downregulated in pre-B cells and later upregulated in mature B lymphocytes (23, 38). In contrast, the cell survival
gene Bcl-xL displays a reciprocal pattern of expression, with
high levels in pre-B cells that are downregulated in mature
B cells (39). To assay for Bcl-2 and Bcl-xL expression in
sorted Ras-RAG peripheral B lineage cells, we used RT-PCR analysis and determined that the expression levels of
Bcl-2 and Bcl-xL in Ras-RAG B cells were more comparable with those in wild-type mature B cells with substantial levels of Bcl-2 expression (Fig. 5).

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 5.
Analysis of Bcl-2 and Bcl-xL expression. RNAs from sorted
Ras-RAG1 / (Ras-Rag), mature wild-type B (WT B), and wild-type
pre-B (WT Pre-B) lymphocytes were subjected to RT-PCR analysis, using
-actin expression as a standard. Serial fivefold dilutions are shown for each
B lineage cell type.
|
|
 |
Discussion |
Several studies have implicated Ras as an intermediate in
signal transduction downstream of the BCR (17, 18). Our
studies of Ras-RAG mice demonstrate that activated Ras
can induce differentiation of pro-B cells in the absence of µ HC. B lineage cells that develop in Ras-RAG mice acquired characteristics shared with normal pre-B cells, including expression of RAG and
5, and the induction of germline
light chain locus transcripts. However, these
cells also expressed surface markers characteristic of more
mature stages of B lymphopoiesis. Thus, we believe it is
most likely that Ras-RAG B cells have progressed in their
differentiation beyond the pre-B cell stage, at least to the
pre-B-B cell junction. It also remains possible, given their
peripheral location, that Ras-RAG B cells may be developmentally similar to the recently described subset of germinal center B cells that reinitiate light chain gene rearrangement as a result of antigenic challenge (40).
Although such cells, unlike Ras-RAG B cells, lack CD23
expression (43), both cell types demonstrate the concurrent
expression of
5 and RAG genes with mature B cell surface markers. The accumulation of the Ras-RAG B lineage cells in the periphery could be due to several potential effects of activated Ras expression, including acquisition of surface markers necessary for transit from the bone marrow
or prolonged survival allowing exit from the marrow and
accumulation in the periphery.
Previous work has demonstrated that the introduction of
a rearranged µ transgene into RAG-deficient pro-B cells
induced their differentiation to pre-B cells (6, 7). Although
such cells remained predominantly within the bone marrow and did not express surface markers characteristic of
more mature B cells, the expression of a Bcl-2 transgene in
the B lineage of µ-RAG mice resulted in the appearance of
cells in the marrow and periphery with a phenotype that
resembles B lineage cells found in Ras-RAG mice (22, 37). These findings suggested that survival signals provided by
Bcl-2 may advance B lymphopoiesis beyond the stage
achieved by µ HC alone. In this regard, we found that
Ras-RAG cells expressed significantly higher levels of endogenous Bcl-2 than normal pre-B cells; in fact, the observed Bcl-2 expression levels approached those in mature
B cells. At present, we do not know whether this upregulation of Bcl-2 expression in Ras-RAG cells is directly induced by activated Ras, or, alternatively, occurs as a result
of developmental progression to a more mature stage. Nevertheless, the phenotypic similarities between µ HC/Bcl-2/RAG and Ras-RAG B cells suggest that introduction of
activated Ras may induce and/or enable both differentiation and survival signals in RAG-deficient and, presumably, normal progenitor B lineage cells.
Our finding that B cells in Ras-RAG mice develop to a
stage beyond that of B cells in µ-RAG mice indicates that
signaling events triggered by constitutively activated Ras
may surpass or differ from those initiated upon HC-mediated activation of endogenous Ras. In this context, in other
experimental systems the effects of activated Ras on cultured cells varied depending on the level and duration of
Ras expression (44). It is also possible that the expression of
activated Ras in B lineage cells mimics signaling from other
surface receptors, in addition to the pre-BCR, which normally trigger endogenous Ras. Numerous Ras effector
pathways have been identified to date, including a well-characterized mitogen-activated protein kinase cascade and
a growing number of stress-activated protein kinase cascades (45). Ras has also been shown to induce phosphatidylinositol-3 kinase (46, 47), as well as the Rho family of
GTPases which regulate the actin cytoskeleton (48). It remains to be established which of these (or other) Ras-effector pathways are involved in mediating the developmental
progression of pro-B cells. Selective engagement of Ras effectors using activated mutant alleles may facilitate further
elucidation of these issues.
Recent data demonstrate that Ras signaling is used during several stages of B and T lymphocyte development. For
example, a dominant negative Ras transgene was shown to
cause an incomplete block in B cell development at the
earliest known B cell precursor stage before B220+CD43+
pro-B cells (49). In T lineage cells, several studies with dominant negative alleles implicated the Ras/Raf/Mitogen-activated protein kinase pathway in the development
of CD4+CD8+ (DP) thymocytes and mature T cells (50-
52). Notably, a complete reconstitution of DP thymocytes
was induced by activated Ras in RAG-deficient mice;
however, in these mice no developmental progression beyond the DP stage was observed, and no T cells were detected in the peripheral lymphoid organs (16). These results
suggested that additional signals are required for the T cell
positive selection process that normally results from signaling events accompanying ligation of the T cell receptor
with self-MHC ligands of specific avidity (53). Such a requirement for additional signaling events, independent of
Ras, in the development of T cells beyond the DP stage
suggests that an important distinction may exist in the signals required to effect further development of precursor B versus precursor T lineage cells.
Address correspondence to Frederick W. Alt, Howard Hughes Medical Institute, Children's Hospital, 320 Longwood Ave., Boston, MA 02115. Phone: 617-355-7290; Fax: 617-730-0432; E-mail: alt{at}rascal.med.harvard.edu
Received for publication 14 October 1998 and in revised form 27 October 1998.
We thank Juanita Campos-Torres for invaluable cell sorting assistance, and Drs. Yansong Gu, Timo Breit,
and Nienke van der Stoep for helpful advice and discussions.
This work was supported in part by National Institutes of Health grants AI20047 (to F.W. Alt) and
AI01532-01 (to A.C. Shaw). A.C. Shaw was a recipient of a Howard Hughes Medical Institute Postdoctoral
Research Fellowship for Physicians. W. Swat is a recipient of the Arthritis Foundation Hulda Irene Duggan
Investigator Award. F.W. Alt is an investigator of the Howard Hughes Medical Institute.
| 1.
|
Willerford, D.M.,
W. Swat, and
F.W. Alt.
1996.
Developmental regulation of V(D)J recombination and lymphocyte
differentiation.
Curr. Opin. Genet. Dev.
6:
603-609
[Medline].
|
| 2.
|
Karasuyama, H.,
A. Rolink, and
F. Melchers.
1996.
Surrogate
light chain in B cell development.
Adv. Immunol.
63:
1-41
[Medline].
|
| 3.
|
Kitamura, D.,
J. Roes,
R. Kuhn, and
K. Rajewsky.
1991.
A B
cell-deficient mouse by targeted disruption of the membrane
exon of the immunoglobulin µ gene.
Nature.
350:
423-426
[Medline].
|
| 4.
|
Shinkai, Y.,
G. Rathbun,
K.P. Lam,
E.M. Oltz,
V. Stewart,
M. Mendelsohn,
J. Charron,
M. Datta,
F. Young,
A. Stall, and
F.W. Alt.
1992.
RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement.
Cell.
68:
855-867
[Medline].
|
| 5.
|
Mombaerts, P.,
J. Iacomini,
R.S. Johnson,
K. Herrup, and
S. Tonegawa.
1992.
RAG-1-deficient mice have no mature B
and T lymphocytes.
Cell.
68:
869-877
[Medline].
|
| 6.
|
Young, F.,
B. Ardman,
Y. Shinkai,
R. Lansford,
T.K. Blackwell,
M. Mendelsohn,
A. Rolink,
F. Melchers, and
F.W. Alt.
1994.
Influence of immunoglobulin heavy- and light-chain
expression on B-cell differentiation.
Genes Dev.
8:
1043-1057
[Abstract/Free Full Text].
|
| 7.
|
Spanopoulou, E.,
C.A. Roman,
L.M. Corcoran,
M.S. Schlissel,
D.P. Silver,
D. Nemazee,
M.C. Nussenzweig,
S.A. Shinton,
R.R. Hardy, and
D. Baltimore.
1994.
Functional immunoglobulin transgenes guide ordered B-cell differentiation
in Rag-1-deficient mice.
Genes Dev.
8:
1030-1042
[Abstract/Free Full Text].
|
| 8.
|
Reth, M..
1989.
Antigen receptor tail clue.
Nature.
338:
383-384
[Medline].
|
| 9.
|
Gong, S., and
M.C. Nussenzweig.
1996.
Regulation of an
early developmental checkpoint in the B cell pathway by
Ig .
Science.
272:
411-414
[Abstract].
|
| 10.
|
Torres, R.M.,
H. Flaswinkel,
M. Reth, and
K. Rajewsky.
1996.
Aberrant B cell development and immune response in mice
with a compromised BCR complex.
Science.
272:
1804-1808
[Abstract].
|
| 11.
|
Cheng, A.M.,
B. Rowley,
W. Pao,
A. Hayday,
J.B. Bolen, and
T. Pawson.
1995.
Syk tyrosine kinase required for mouse
viability and B-cell development.
Nature.
378:
303-306
[Medline].
|
| 12.
|
Turner, M.,
P.J. Mee,
P.S. Costello,
O. Williams,
A.A. Price,
L.P. Duddy,
M.T. Furlong,
R.L. Geahlen, and
V.L.J. Tybulewicz.
1995.
Perinatal lethality and blocked B-cell development in mice lacking the tyrosine kinase Syk.
Nature.
378:
298-302
[Medline].
|
| 13.
|
DeFranco, A.L..
1997.
The complexity of signaling pathways
activated by the BCR.
Curr. Opin. Immunol.
9:
296-308
[Medline].
|
| 14.
|
Boguski, M.S., and
F. McCormick.
1993.
Proteins regulating
Ras and its relatives.
Nature.
366:
643-654
[Medline].
|
| 15.
|
Kazlauskas, A..
1994.
Receptor tyrosine kinases and their targets.
Curr. Opin. Genet. Dev.
4:
5-14
[Medline].
|
| 16.
|
Swat, W.,
Y. Shinkai,
H.-L. Cheng,
L. Davidson, and
F.W. Alt.
1996.
Activated Ras signals differentiation and expansion of
CD4+8+ thymocytes.
Proc. Natl. Acad. Sci. USA.
93:
4683-4687
[Abstract/Free Full Text].
|
| 17.
|
Lazarus, A.H.,
K. Kawauchi,
M.J. Rapoport, and
T.J. Delovitch.
1993.
Antigen-induced B lymphocyte activation involves the p21ras and ras GAP signaling pathway.
J. Exp. Med.
178:
1765-1769
[Abstract/Free Full Text].
|
| 18.
|
Harwood, A.E., and
J.C. Cambier.
1993.
B cell antigen receptor cross-linking triggers rapid protein kinase C independent activation of p21ras1.
J. Immunol.
151:
4513-4522
[Abstract].
|
| 19.
|
Blankenstein, T.,
E. Winter, and
W. Muller.
1988.
A retroviral expression vector containing murine immunoglobulin
heavy chain promoter/enhancer.
Nucleic Acids Res.
16:
10939
[Free Full Text].
|
| 20.
|
Shibuya, E.K.,
A.J. Polverino,
E. Chang,
M. Wigler, and
J.V. Ruderman.
1992.
Oncogenic Ras triggers the activation of 42-kDa mitogen-activated protein kinase in extracts of quiescent
Xenopus oocytes.
Proc. Natl. Acad. Sci. USA
89:
9831-9835
[Abstract/Free Full Text].
|
| 21.
|
Chen, J.,
R. Lansford,
V. Stewart,
F. Young, and
F.W. Alt.
1993.
RAG-2-deficient blastocyst complementation: an assay
of gene function in lymphocyte development.
Proc. Natl.
Acad. Sci. USA.
90:
4528-4532
[Abstract/Free Full Text].
|
| 22.
|
Young, F.,
E. Mizoguchi,
A.K. Bhan, and
F.W. Alt.
1997.
Constitutive Bcl-2 expression during immunoglobulin heavy
chain-promoted B cell differentiation expands novel precursor B cells.
Immunity.
6:
23-33
[Medline].
|
| 23.
|
Li, Y.S.,
K. Hayakawa, and
R.R. Hardy.
1993.
The regulated expression of B lineage associated genes during B cell
differentiation in bone marrow and fetal liver.
J. Exp. Med.
178:
951-960
[Abstract/Free Full Text].
|
| 24.
|
Schneider, T.J.,
D. Grillot,
L.C. Foote,
G.E. Nunez, and
T.L. Rothstein.
1997.
Bcl-x protects primary B cells against
Fas-mediated apoptosis.
J. Immunol.
159:
4834-4839
[Abstract].
|
| 25.
|
Schlissel, M.S., and
D. Baltimore.
1989.
Activation of immunoglobulin kappa gene rearrangement correlates with induction of germline kappa gene transcription.
Cell.
58:
1001-1007
[Medline].
|
| 26.
|
Gorman, J.R.,
N. van der Stoep,
R. Monroe,
M. Cogne,
L. Davidson, and
F.W. Alt.
1996.
The Ig 3' enhancer influences the ratio of Ig versus Ig B lymphocytes.
Immunity.
5:
241-252
[Medline].
|
| 27.
|
Leon, J.,
I. Guerrero, and
A. Pellicer.
1987.
Differential expression of the ras gene family in mice.
Mol. Cell. Biol.
7:
1535-1540
[Abstract/Free Full Text].
|
| 28.
|
Grawunder, U.,
T.M.J. Leu,
D.G. Schatz,
A. Werner,
A.G. Rolink,
F. Melchers, and
T.H. Winkler.
1995.
Down-regulation of RAG1 and RAG2 gene expression in preB cells after functional immunoglobulin heavy chain rearrangement.
Immunity.
3:
601-608
[Medline].
|
| 29.
|
Alt, F.,
N. Rosenberg,
S. Lewis,
E. Thomas, and
D. Baltimore.
1981.
Organization and reorganization of immunoglobulin genes in A-MuLV-transformed cells: rearrangement of
heavy but not light chain genes.
Cell.
27:
381-390
[Medline].
|
| 30.
|
Ritchie, K.A.,
R.L. Brinster, and
U. Storb.
1984.
Allelic exclusion and control of endogenous immunoglobulin gene rearrangement in transgenic mice.
Nature.
312:
517-520
[Medline].
|
| 31.
|
Reth, M.G.,
P. Ammirati,
S. Jackson, and
F.W. Alt.
1985.
Regulated progression of a cultured pre-B cell line to the B
cell stage.
Nature.
317:
353-355
[Medline].
|
| 32.
|
Reth, M.,
E. Petrac,
P. Wiese,
L. Lobel, and
F.W. Alt.
1987.
Activation of V kappa gene rearrangement in pre-B cells follows the expression of membrane-bound immunoglobulin
heavy chains.
EMBO (Eur. Mol. Biol. Organ.) J.
6:
3299-3305
[Medline].
|
| 33.
|
Nussenzweig, M.C.,
A.C. Shaw,
E. Sinn,
D.B. Danner,
K.L. Holmes,
H.C. Morse, and
P. Leder.
1987.
Allelic exclusion
in transgenic mice that express the membrane form of immunoglobulin µ.
Science.
236:
816-819
[Abstract/Free Full Text].
|
| 34.
| Wells, S.M., A.M. Stall, A.B. Kantor, and L.A. Herzenberg.
1995. Development of B-cell subsets. In Immunoglobulin
Genes, 2nd Edition. T. Honjo and F.W. Alt, editors. Academic Press, San Diego. 83-101.
|
| 35.
|
Tedder, T.F.,
J. Tuscano,
S. Sato, and
J.H. Kehrl.
1997.
CD22,
a B lymphocyte-specific adhesion molecule that regulates antigen receptor signaling.
Annu. Rev. Immunol.
15:
481-504
[Medline].
|
| 36.
|
Tedder, T.F.,
M. Inaoki, and
S. Sato.
1997.
The CD19-CD21 complex regulates signal transduction thresholds governing humoral immunity and autoimmunity.
Immunity.
6:
107-118
[Medline].
|
| 37.
|
Tarlinton, D.M.,
L.M. Corcoran, and
A. Strasser.
1997.
Continued differentiation during B lymphopoiesis requires signals
in addition to cell survival.
Int. Immunol.
9:
1481-1494
[Abstract/Free Full Text].
|
| 38.
|
Merino, R.,
L. Ding,
D.J. Veis,
S.J. Korsmeyer, and
G. Nunez.
1994.
Developmental regulation of the Bcl-2 protein
and susceptibility to cell death in B lymphocytes.
EMBO
(Eur. Mol. Biol. Organ.) J.
13:
683-691
[Medline].
|
| 39.
|
Choi, M.S.K.,
M. Holman,
C.J. Atkins, and
G.G.B. Klaus.
1996.
Expression of bcl-x during mouse B cell differentiation
and following activation by various stimuli.
Eur. J. Immunol.
26:
676-682
[Medline].
|
| 40.
|
Hikida, M.,
M. Mori,
T. Takai,
K.-I. Tomochika,
K. Hamatani, and
H. Ohmori.
1996.
Reexpression of RAG-1 and
RAG-2 genes in activated mature mouse B cells.
Science.
274:
2092-2094
[Abstract/Free Full Text].
|
| 41.
|
Han, S.,
B. Zheng,
D.G. Schatz,
E. Spanopoulou, and
G. Kelsoe.
1996.
Neoteny in lymphocytes: Rag1 and Rag2 expression in germinal center B cells.
Science.
274:
2094-2097
[Abstract/Free Full Text].
|
| 42.
|
Han, S.,
S.R. Dillon,
B. Zheng,
M. Shimoda,
M.S. Schlissel, and
G. Kelsoe.
1997.
V(D)J recombinase activity in a subset
of germinal center B lymphocytes.
Science.
278:
301-305
[Abstract/Free Full Text].
|
| 43.
|
Kelsoe, G..
1995.
In situ studies of the germinal center reaction.
Adv. Immunol.
60:
267-288
[Medline].
|
| 44.
|
Marshall, C.J..
1995.
Specificity of receptor tyrosine kinase
signaling: transient versus sustained extracellular signal-regulated kinase activation.
Cell.
80:
179-185
[Medline].
|
| 45.
|
Su, B., and
M. Karin.
1996.
Mitogen-activated protein kinase
cascades and regulation of gene expression.
Curr. Opin. Immunol.
8:
402-411
[Medline].
|
| 46.
|
Rodriguez-Viciana, P.,
P.H. Warne,
R. Dhand,
B. Vanhaesebroeck,
I. Gout,
M.J. Fry,
M.D. Waterfield, and
J. Downward.
1994.
Phosphatidylinositol-3-OH-kinase as a direct target of Ras.
Nature.
370:
527-532
[Medline].
|
| 47.
|
Rodriguez-Viciana, P.,
P.H. Warne,
B. Vanhaesebroeck,
M.D. Waterfield, and
J. Downward.
1996.
Activation of phosphoinositide 3-kinase by interaction with Ras and by point
mutation.
EMBO (Eur. Mol. Biol. Organ.) J.
15:
2442-2451
[Medline].
|
| 48.
|
Reif, K., and
D.A. Cantrell.
1998.
Networking Rho family
GTPases in lymphocytes.
Immunity.
8:
395-401
[Medline].
|
| 49.
|
Iritani, B.M.,
K.A. Forbush,
M.A. Farrar, and
R.M. Perlmutter.
1997.
Control of B cell development by Ras-mediated activation of Raf.
EMBO (Eur. Mol. Biol. Organ.) J.
16:
7019-7031
[Medline].
|
| 50.
|
Crompton, T.,
K.C. Gilmour, and
M.J. Owen.
1996.
The
MAP kinase pathway controls differentiation from double-negative to double-positive thymocyte.
Cell.
86:
243-251
[Medline].
|
| 51.
|
Swan, K.A.,
J. Alberola-Ila,
J.A. Gross,
M.W. Appleby,
K.A. Forbush,
J.F. Thomas, and
R.M. Perlmutter.
1995.
Involvement of p21ras distinguishes positive and negative selection in
thymocytes.
EMBO (Eur. Mol. Biol. Organ.) J.
14:
276-285
[Medline].
|
| 52.
|
Alberola-Ila, J.,
K.A. Forbush,
R. Seger,
E.G. Krebs, and
R.M. Perlmutter.
1995.
Selective requirement for MAP kinase
activation in thymocyte differentiation.
Nature.
373:
620-623
[Medline].
|
| 53.
|
Kisielow, P., and
H. von Boehmer.
1995.
Development and
selection of T cells: facts and puzzles.
Adv. Immunol.
58:
87-209
[Medline].
|