|
||
, Repressing the HIV-1
Long Terminal Repeat in Macrophages: Pulmonary
Tuberculosis Alters C/EBP Expression, Enhancing
HIV-1 Replication
By



From the * Division of Pulmonary and Critical Care Medicine and Bellevue Chest Service, New York
University Medical Center, New York 10016; the
Department of Microbiology and Infection, Institute
of Medical Science, Tokyo University, Tokyo 108, Japan; the § Department of Medicine, Sendai Kosei
Hospital, Sendai 980, Japan; and the
Public Health Research Institute, New York 10016
| |
Abstract |
|---|
|
|
|---|
We have previously observed that HIV-1 replication is suppressed in uninflamed lung and increased during tuberculosis. In vitro THP-1 cell-derived macrophages inhibited HIV-1 replication after infection with Mycobacterium tuberculosis. Suppression of HIV-1 replication was associated with inhibition of the HIV-1 long terminal repeat (LTR) and induction of ISGF-3, a
type I interferon (IFN)-specific transcription factor. Repression of the HIV-1 LTR required
intact CCAAT/enhancer binding protein (C/EBP) sites. THP-1 cell-derived macrophages
infected with M. tuberculosis, lipopolysaccharide, or IFN-
induced the 16-kD inhibitory
C/EBP
isoform and coincidentally repressed HIV-1 LTR transcription. C/EBP
was the
predominant C/EBP family member produced in THP-1 macrophages during HIV-1 LTR
repression. In vivo, alveolar macrophages from uninflamed lung strongly expressed inhibitory
16-kD C/EBP
, but pulmonary tuberculosis abolished inhibitory C/EBP
expression and induced a novel C/EBP DNA binding protein. Therefore, in vitro, proinflammatory stimulation
produces an IFN response inhibiting viral replication by induction of a C/EBP
transcriptional
repressor. THP-1 cell-derived macrophages stimulated with type I IFN are similar to alveolar
macrophages in the uninflamed lung in vivo. In contrast, the cellular immune response in
active pulmonary tuberculosis disrupts this innate immunity, switching C/EBP expression and
allowing high level viral replication.
;
CCAAT/enhancer binding protein
;
HIV-1 long terminal repeat;
tuberculosis;
repression
| |
Introduction |
|---|
|
|
|---|
AIDS patients without pneumonia have very low levels of HIV-1 provirus or viral particles in the lung. Only 1 in 105 alveolar macrophages is infected (1), and AIDS patients with clear chest x rays have no detectable virus in bronchoalveolar lavage (BAL)1 fluid (2). The situation is remarkably different in patients with pulmonary infiltrates: the number of lung cells infected and the level of virus produced are increased up to 1,000-fold (2). The alveolar macrophage is an important source of HIV-1 production in patients with tuberculosis (6). The high levels of virus produced during infections such as tuberculosis and the increased viral mutation produced by enhanced viral replication (2) may contribute to the accelerated course of AIDS after opportunistic infection (7).
Inflammatory stimuli such as TNF-
and LPS suppress
viral replication in macrophages (8). The negative regulatory element (NRE) is the DNA element responsible for
suppressing the HIV-1 LTR after LPS stimulation (8). The
transcription repressors induced by LPS stimulation of macrophages have not been identified. The suppression of
HIV-1 replication seen after LPS stimulation closely resembles the suppression seen after addition of IFNs (9). Type I
IFN is required for the suppressive effects of LPS and
TNF-
on viral replication (11, 12). Macrophages derived from knockout mice deficient in the IFN receptor
/
p100, also known as IFNR-1, do not repress viral replication after stimulation with LPS or TNF-
(12, 13). In
macrophages with intact type I IFN receptors, antibodies to
IFN-
but not IFN-
will block the suppressive effects of
proinflammatory stimuli (11). IFN-
is also the most potent inhibitor of HIV-1 replication in macrophages, producing a 99% inhibition of p24 production after treatment
with 1 U/ml (9).
IFN-
and IFN-
are the major type I IFNs, which
constitute an essential early arm of the innate immune response (14). Type I IFNs are expressed at low levels in normal tissue macrophages (15). Knockout mice deficient in
type I IFN receptors have reduced levels of IFN responsive
enzymes in macrophages compared with normal mice, supporting the concept that macrophages are primed by low
levels of type I IFN in the absence of viral infection (13).
Signal transduction in the type I IFN system is mediated by
a high-affinity transmembrane receptor composed of two
subunits (16). Knockout mice deficient in the p100 subunit
are particularly susceptible to viral infection (13, 17). Upon
binding of type I IFNs to their receptor, specific protein tyrosine kinases are activated, and signal transducer and activator of transcription (Stat) proteins are phosphorylated.
IFN-stimulated gene factor 3 (ISGF-3) is then rapidly assembled without the need for protein synthesis. ISGF-3 is a
heterotrimer of Stat-1, Stat-2, and p48 that rapidly translocates to the nucleus, binds promoter sequences named
IFN-stimulated response elements (ISRE), and activates
gene expression (18).
The HIV-1 LTR NRE has three CCAAT/enhancer
binding protein (C/EBP) sites that bind C/EBP
(19). The
C/EBP
gene has no introns, but two different proteins
are produced from the same mRNA. Large 30-37-kD isoforms stimulate transcription while small (~16-20-kD) isoforms repress transcription (20, 21). The small inhibitory C/EBP
is likely produced when the ribosome starts protein translation from an internal ribosome entry site in the
C/EBP
mRNA. Calame and colleagues transfected constructs expressing inhibitory 16-kD C/EBP
isoform and
demonstrated inhibition of HIV-1 replication and LTR
promoter function (22, 23). Further, intact C/EBP sites are
required for HIV-1 replication in macrophages but not lymphocytes (24). C/EBP sites in the LTR of Rous sarcoma virus can mediate either stimulation or repression of
promoter function depending on which C/EBP isoform is
expressed (25). These data suggest that transcription factors
binding to the C/EBP sites in the LTR are important enhancers and repressors of replication in monocytes. Cytokine genes such as TNF-
also have C/EBP binding sites,
and transfection of inhibitory C/EBP
represses TNF-
promoter activity (26).
In this investigation, we demonstrate that Mycobacterium
tuberculosis infection of THP-1 macrophages suppresses
HIV-1 replication and induces a type I IFN response. This
is accompanied by repressed LTR transcription that depends
on intact C/EBP sites in the LTR. An inhibitory 16-kD
C/EBP
transcription factor is induced by M. tuberculosis or
LPS, and C/EBP
accounts for >95% of the LTR NRE
binding. Treatment of macrophages with IFN-
also represses LTR transcription and induces the inhibitory C/EBP
.
Resting alveolar macrophages strongly express the inhibitory C/EBP
but downregulate it in pulmonary tuberculosis and switch expression to another C/EBP site binding
factor.
| |
Materials and Methods |
|---|
|
|
|---|
Study Population.
We evaluated seven patients with active pulmonary tuberculosis with sputum or lung tissue culture positive for M. tuberculosis. Tuberculosis patients had received antimycobacterial therapy for 1-7 d before fiberoptic bronchoscopy. HIV-1 testing on all patients was done with ELISA and confirmed by Western blot; five out of seven were HIV-1 positive. None were on antiretroviral therapy during the acute illness. All patients had segmental infiltrates; radiographically uninvolved lobes were identified, and a separate BAL was performed and processed from this segment. Three out of the seven were smokers; all seven were male. Their mean age ± SD was 40 ± 11 yr. Two normal volunteers were lavaged; both were HIV-1 negative, and both had a normal chest radiograph and spirometry. BAL was approved by the Human Subjects Review Committees of New York University Medical Center and Bellevue Hospital Center.BAL Cells.
BAL was performed with a flexible fiberoptic bronchoscope with local Xylocaine anesthesia. We instilled six 50-ml aliquots (total 300 ml) of normal saline and suctioned sequentially from radiographically uninvolved and involved segments. The lavage fluid was filtered through sterile gauze to remove mucous, and total cells were counted in a hemacytometer. Cell differentials were performed on cytospin slides stained with Wright-Giemsa. For purification of alveolar macrophages, BAL cells were spun and resuspended in RPMI 1640 and allowed to adhere to plastic plates for 3 h. Cells were recovered by gentle scraping with a rubber policeman. Alveolar macrophages were 95% pure by morphology and nonspecific esterase staining.HIV-1-Mycobacteria Coinfection.
THP-1 cells (104 cells/well in 96-well plates) were incubated overnight with 10 ng/ml PMA. Cells were infected with HIV-1 strains BaL or NL4-3 (1 ng p24/ ml) and M. tuberculosis H37Ra at various multiplicities of infection (moi) for 2 h at 37°C. They were washed twice and incubated with RPMI 1640/10% FCS containing PMA. p24 was assayed by ELISA.Stable LTR Reporter Constructs.
BF-24 cells, obtained from the AIDS Reference Reagent Program (#1296; Rockville, MD), are THP-1 cells with an integrated HIV-1 LTR.CAT construct. pHIV-CAT LTR reporter construct was obtained from the AIDS Reference Reagent Program (#2619). The HindIII-XhoI LTR fragment was transferred to the HindIII-XhoI site of pGL 3 (Stratagene, Inc., La Jolla, CA). The SalI-NotI pGL 3 LTR luciferase fragment was then transferred to a modified pCR3 plasmid carrying a NotI site (Invitrogen Corp., Carlsbad, CA). Double-stranded PCR mutagenesis was performed according to the manufacturer's instruction (Stratagene, Inc.). Three oligonucleotides and their reverse complements were used to mutate the C/ EBP domains 1, 2, and 3 of the HIV-1 LTR (see Fig. 3 for position of C/EBP domains and mutations introduced). Mutants were selected for addition of PstI or PvuII sites and were confirmed by complete sequencing of the LTR. 2 × 106 THP-1 cells were transfected with 2 µg of mutant or wild-type plasmid mixed with 10 µl of lipofectamine (GIBCO BRL, Gaithersburg, MD) for 5 h; transfected cells were cultured in RPMI/10% FCS at 105 cells/well in 24-well plates. After 24 h, 700 µg/ml of G418 was added. Resistant clones were expanded and screened for luciferase production.
|
Cell Stimulation and Nuclear Protein Isolation.
Cells were incubated with PMA at 20 ng/ml and live M. tuberculosis at an moi of 0.1-10 or PMA and LPS at 10 µg/ml. When used, IFN-
was
added at 1 U/ml after pretreatment for 24 h with PMA at 20 ng/
ml. Cells were harvested at various time points and were washed
in PBS twice. Nuclei were isolated by NP-40 lysis and high salt
extraction as described (27). Whole cells were lysed and extracted
with RIPA (PBS, 1% NP-40, 0.5% deoxycholate) with 30 µl/ml
aprotinin and 1 mM sodium orthovanadate for 30 min, and disrupted by passage through a 21 gauge needle; 1 mM PMSF was
then added. Protein extracts for chloramphenicol acetyltransferase (CAT) ELISA or luciferase assays (both from Boehringer Mannheim) were made according to the manufacturer's instructions.
Reporter activity was corrected for cell viability as measured by
trypan blue exclusion.
Immunoblots.
100 µg of protein was added to a 10-20% linear gradient SDS-polyacrylamide gel. After electrophoresis, protein was electrotransferred to a nylon membrane and probed with 3 µg of polyclonal C/EBP
antibody (Santa Cruz Biotechnology,
Inc., Santa Cruz, CA) in 50 ml blotto and visualized with 1.2 µg
anti-rabbit horseradish peroxidase and ECL (Amersham Pharmacia Biotech, Piscataway, NJ). Blots were then reprobed with antibody to nuclear factor (NF)-
B p65 Rel (Santa Cruz Biotechnology, Inc.).
Electromobility Shift Assay.
DNA probe was labeled with [
-
32P]dCTP using Klenow DNA polymerase in a fill-in reaction.
The overlapping oligonucleotides used for wild-type NRE probe
were
184 5'AGCAAACTAGCATTTCATC3'-166 and
160
5'CCATGTGATGAAATGC3'-175, with bold letters denoting the C/EBP binding domain. The mutant sequences were
184 5'AGCAAACTAGCAGGGG3'-163 and
160 5'CCATGTCCCCTGCAGC3'-175, with bold letters denoting mutation from wild-type. Full-length 25-bp reaction products were isolated on a 20% acrylamide gel, and 2 × 105 cpm labeled DNA
was mixed with 10 µg of protein extract, 2.5 µg poly dI/dC,
and gel mobility shift buffer. The ISRE probe was 5'CTCGGGAAAGGGAAACCGAAACTGAAGCC3', with the ISRE
homology in bold (28). The nonspecific competitor on the ISRE
electromobility shift assay (EMSA) was 5'CTCTCTGCAAGGGTCATCAGTAC3'. For supershift experiments, 1 µg of antibody was added to the reaction (C/EBP antibodies from Santa
Cruz Biotechnology, Inc.; Stat-1 and Stat-2 antibodies were a gift
from Chris Schindler). The DNA-protein complexes were electrophoresed on a 6% polyacrylamide gel at 4°C and analyzed by
autoradiography. Films of immunoblots and EMSA were scanned
with a Personal densitometer (Molecular Dynamics, Sunnyvale,
CA). Results are presented as the mean ± SEM.
| |
Results |
|---|
|
|
|---|
THP-1 cell-derived macrophages support high levels of HIV-1 replication, producing between 1 and 3 ng/ml of p24 antigen 7 d after infection (Fig. 1, A, moi 0). M. tuberculosis suppressed HIV-1 replication in a dose-dependent manner. At an moi of 1, there was at least a 50% reduction of HIV-1 p24 in both viral strains without reduced cell viability. At an moi of 10, there was a 70-90% reduction in viral production. M. tuberculosis suppressed replication of HIV-1 BaL (macrophage trophic) and HIV-1 NL4-3 (lymphocyte trophic). Similar results were obtained from blood monocytes differentiated with M-CSF and infected with Mycobacterium bovis (data not shown).
|
To test if the reduction in viral replication was due to reduced LTR-driven transcription, these experiments were repeated on BF-24 cells (THP-1 cells with a stable HIV-1 LTR reporter construct). M. tuberculosis suppressed HIV-1 LTR-driven CAT production in PMA-differentiated BF-24 cells (Fig. 1 B). Similar to the decrease in HIV-1 p24, CAT concentration declined by 33% at an moi of 1 and 66% at an moi of 10.
M. tuberculosis Infection of Macrophages Induces an IFN Response.Since other proinflammatory stimuli such as LPS inhibit viral replication by a type 1 interferon response (12), we tested if M. tuberculosis infection also induced an interferon response. We assayed cell extracts for activation of a type I IFN specific transcription factor in cells infected with M. tuberculosis. Extracts of differentiated THP-1 cells were used in EMSA with an ISRE-containing DNA probe.
Stimulation of THP-1 macrophages with IFN-
or infection with M. tuberculosis at an moi of 1 induced an
ISRE-protein complex that was not present in unstimulated THP-1 macrophages (Fig. 2, lanes 1 and 2). Both
stimuli induced the same complex, although M. tuberculosis
produced less ISRE-protein complex than 500 U/ml of
IFN-
(Fig. 2, lane 3). The complex specifically bound
ISRE sequences and contained Stat-1 and Stat-2 but not
IFN regulatory factor 1 (IRF-1). Excess unlabeled ISRE
oligonucleotide disrupted the DNA-protein complex (Fig.
2, lanes 4-6), but excess nonspecific oligonucleotide did
not (Fig. 2, lanes 7-9). Antibodies against Stat-1 (Fig. 2,
lanes 10-12) and Stat-2 (Fig. 2, lanes 13-15) disrupted the
DNA-protein complex, whereas antibodies to IRF-1 did
not (Fig. 2, lanes 16-18). Therefore, the DNA-protein
complex induced by infection with M. tuberculosis had the
characteristics of ISGF-3, a type I IFN-specific transcription factor.
|
The NRE of the HIV-1 LTR is required for repression of the HIV-1 LTR after stimulation of macrophages with LPS (8), and the NRE contains C/EBP transcription factor binding sites (19). To test if C/EBP binding factors contributed to promoter repression in macrophages after infection with M. tuberculosis, HIV-1 LTR reporter constructs carrying three C/EBP binding site mutations were generated (Fig. 3). Wild-type and C/EBP mutant LTR reporter constructs were stably transfected into THP-1 cells. In time course experiments, M. tuberculosis infection inhibited wild-type LTR reporter activity 38% from 24 to 48 h after infection, and LPS stimulation inhibited wild-type LTR reporter activity by 40% from 48 to 72 h after stimulation (Fig. 4 A). HIV-1 LTR CAT and HIV-1 LTR luciferase produced similar results.
|
Mutation of the C/EBP sites in the HIV-1 LTR abolished repression of LTR reporter activity in macrophages after infection with M. tuberculosis or stimulation with LPS (Fig. 4 B). Reporter activity increased 20% after infection with M. tuberculosis and 40% after stimulation with LPS when C/EBP sites were mutated. Consistent with previous reports demonstrating the importance of C/EBP sites in transcriptional activity of the LTR (22), the C/EBP mutant had reduced total activity compared with the wild-type HIV-1 LTR.
An Inhibitory 16-kD C/EBP
Isoform Is Induced by Proinflammatory Stimuli and IFN-
.
Since C/EBP binding sites
are required for HIV-1 LTR-mediated transcription in
macrophages (22, 23) and the C/EBP
gene can produce a
16-kD dominant negative transcription factor (20, 21), we
investigated whether changes in C/EBP
expression could account for repression of the HIV-1 LTR. Initial experiments were conducted with M. tuberculosis infection and
repeated with LPS, another proinflammatory stimulus that
inhibits LTR reporter activity and HIV-1 replication in
macrophages (8, 9).
THP-1 cell-derived macrophages produced a 16-kD inhibitory C/EBP
in nuclear extracts 48-72 h after stimulation with LPS (Fig. 5 A) or 24-48 h after infection with M. tuberculosis (data not shown). A stimulatory 37-kD C/EBP
was also induced over the same time course. The ratio of
inhibitory to stimulatory C/EBP
was 0.8 after 72 h of
LPS stimulation (Table 1). Inhibition predominates at
stoichiometric ratios >0.2 (20, 21). A cross-reacting 40-kD protein was detected in the immunoblots. This band is
nonspecific since it is expressed in unstimulated THP-1
cells that have negligible C/EBP DNA binding activity.
|
|
IFN-
also induced the inhibitory 16-kD C/EBP
in
THP-1 macrophages (Fig. 5 B). In time course experiments, induction of inhibitory C/EBP
started 3 h after
addition of IFN-
and achieved its maximum at 48 h. The
amount of inhibitory C/EBP
induced with IFN-
and LPS were the same (Fig. 5 B, last two lanes), but induction
of the inhibitory transcription factor by IFN is more rapid
than with LPS stimulation, and the ratio of inhibitory to
stimulatory C/EBP
was 3.6 (Table 1). In dose-response
experiments, 1 U/ml of IFN-
maximally induced the 16-kD C/EBP
(data not shown).
1 U/ml of IFN-
reduced HIV-1 LTR CAT expression
by 50% within 3 h in BF-24 cells differentiated with PMA
(Fig. 5 C). The reduction of LTR activity was coincident
with induction of inhibitory 16-kD C/EBP
. There was
>95% inhibition of transcription by IFN-
72 h after
treatment. This was greater than the inhibition produced by LPS stimulation or infection with M. tuberculosis (compare Figs. 1 and 2 with Fig. 5 C).
Is the Predominant Transcription Factor Binding the
HIV-1 NRE in THP-1 Cell-derived Macrophages.
EMSA
with an HIV-1 NRE probe was used to investigate which
C/EBP transcription factors bound to the HIV-1 LTR.
THP-1 macrophages stimulated with LPS increased NRE
binding 10-fold (Fig. 6 A, lanes 1 and 2). This binding is
specific to the C/EBP site of the NRE, since cold NRE
competed effectively with the DNA-protein complex (Fig.
6 A, lane 3), whereas an oligonucleotide with point mutations in the C/EBP domain did not (Fig. 6 A, lane 4).
Over 95% of the C/EBP-specific NRE-protein complex
was supershifted with C/EBP
antibody (Fig. 6 A, lane 5).
|
The major NRE-protein complex observed with LPS
stimulation is also induced by infection of THP-1 macrophages with M. tuberculosis (Fig. 6 B, lane 2, arrow). This
NRE-protein complex competed with cold wild-type
NRE oligonucleotide, but not C/EBP mutant oligonucleotide and supershifted with C/EBP
antibody (data not
shown). In these extracts, another rapidly migrating band
was observed (Fig. 6 B, double arrow). This band bound to
non-C/EBP sequences of the NRE, since EMSA using the
C/EBP-mutated NRE as a probe produced a single comigrating band (Fig. 6 B, lane 4). Wild-type or C/EBP- mutated NRE probes by themselves did not produce these
bands (Fig. 6 B, lanes 1 and 3). The non-C/EBP NRE-
protein complex was heat labile, whereas the NRE-C/
EBP
complex reformed after heating extracts at 95°C for
5 min (data not shown).
Is Strongly Expressed in Alveolar Macrophages from Lung Segments with Low Viral Replication and Is
Downregulated in Inflamed Lung Segments with High Viral Replication.
We investigated C/EBP
expression in the lung
to test if cells that suppress HIV-1 replication in vivo also
express the inhibitory 16-kD C/EBP
. The C/EBP
immunoblot pattern of BAL cells from a normal control (Fig.
7 A, lane 1) was similar to the pattern in macrophages stimulated with LPS. Expression of the 16-kD C/EBP
was
striking. The ratio of inhibitory to stimulatory C/EBP
was 1.8 (Table 1). To define which cell population expressed the C/EBP
, adherence was used to separate macrophages from lymphocytes in the BAL. This procedure
works well in BAL cells from uninvolved lung; adherent
cells were 90-95% alveolar macrophages by morphology and nonspecific esterase staining. The nonadherent cells
were 80-90% lymphocytes by morphology. Protein extracts were made from adherent (AD) and nonadherent
(Non) BAL cells from an uninvolved lobe of an AIDS patient with pulmonary tuberculosis. The adherent fraction
expressed at least sixfold more 16-kD C/EBP
(Fig. 7 A,
lanes 2 and 3), demonstrating that the 16-kD C/EBP
is
strongly expressed in the alveolar macrophages.
|
BAL cells from radiographically uninvolved lung segments
of six patients with pulmonary tuberculosis were similar to
the immunoblots of the normal control (Fig. 7 A, lanes 2, 4,
6, 8, 10, and 12). The ratio of inhibitory to stimulatory C/
EBP
was 1.0 (Table 1). Lung segments involved with tuberculosis had expressed 14 ± 13% the level of 16-kD inhibitory
C/EBP
observed in uninvolved segments (Fig. 7 A, lanes 5,
7, 9, 11, and 13). Immunocompetent patients had the same
expression pattern as AIDS patients. Expression of 16-kD C/
EBP
increased in the involved lung segment after antituberculous chemotherapy (Fig. 6 B, lanes 13 and 14).
Reprobing of the blots with antibody to NF-
B p65 Rel
A demonstrated that adherent and nonadherent fractions
had similar amounts of NF-
B (Fig. 7 B, lanes 1 and 2).
NF-
B was equally or more strongly expressed in the involved lung segment than in the uninvolved lung segment
(Fig. 7 B, lanes 3-10). This demonstrated that changes in
C/EBP
expression were not due to nonspecific protein
degradation or unequal loading of samples.
The BAL cellular differentials are shown in Table 2.
These results are similar to larger series of BAL differentials
in tuberculosis patients and normal controls (29). The lung
segment involved with tuberculosis has increased percentages of lymphocytes and neutrophils compared with uninvolved lung segments or normal controls. Involved lung
segments have a bimodal distribution of inflammatory cells,
with three of the patients having <2% neutrophils, while the other patients had 34 ± 21% neutrophils. The 1.5-fold
enrichment of alveolar macrophages in the uninvolved
lobes does not account for the 6.6-fold enrichment of total
C/EBP
observed in the uninvolved BAL (Table 3).
|
|
BAL cell extracts from uninvolved lobes have the
same EMSA pattern as THP-1 macrophages infected with M. tuberculosis (Fig. 8, lanes 1 and 2). The uninvolved lobe from
five patients with pulmonary tuberculosis strongly binds the
HIV-1 LTR NRE (Fig. 8, lanes 2, 10, 18, 20, and 22). This
binding is specific for the C/EBP site, since binding could be
competed away by excess wild-type oligonucleotide (Fig. 8,
lanes 3 and 11) but not by mutant NRE (Fig. 8, lanes 4 and
12). Over 90% of the NRE-protein complexes supershifted
with antibody to C/EBP
(Fig. 8, lanes 5 and 13). The non-C/EBP NRE-protein (nonspecific) complex observed in
THP-1 macrophages infected with M. tuberculosis was also
observed in BAL cell extracts from uninvolved and involved
lung segments (Fig. 8, double arrow).
|
EMSA confirmed the immunoblot observations. Uninvolved lung segments had a marked increase in NRE binding compared with involved lobes from the same patient
(in Fig. 8, compare lanes 2, 10, 18, 20, and 22 with lanes 6,
14, 19, 21, and 23). Supershift with antibody to C/EBP
demonstrated 6.6-fold greater C/EBP
expression in the
uninvolved lung segment (Table 3). In contrast, expression of the nonspecific complex was increased 1.1-fold in the
uninvolved lung segment (Table 3). This nonspecific band
is an internal standard for DNA binding activity in uninvolved and involved BAL extracts. The similar level of expression of the nonspecific NRE-protein complex in extracts from different sources demonstrated that changes in
C/EBP
expression were not due to protein degradation
in the involved segment or to unequal loading of samples.
A new rapidly migrating band was observed in extracts
of BAL cells from the involved segment of five patients
(Fig. 8, lanes 5-8, arrow, 14-17, 19, 21, and 24). The induced NRE-protein complex is specific for the C/EBP
site, since binding could be competed by excess wild-type
oligonucleotide (Fig. 8, lanes 7 and 15) but not by mutant
NRE (Fig. 8, lanes 8 and 16). Full data are shown from
two patients, but similar results were obtained from all five.
The rapidly migrating C/EBP-specific band expressed in
involved lung segments was observed in patients with and
without neutrophil-predominant BAL differentials. In addition, it did not supershift with antibody to C/EBP
(Fig.
8, lanes 9 and 17) or with antibodies to C/EBP
, C/EBP
,
C/EBP
, or C/EBP-homologous protein (CHOP) (data
not shown). Adherence was used to separate macrophages
from other cells in the involved BAL. Both the C/EBP-specific and C/EBP-nonspecific NRE binding activity
were enriched in the adherent cell fraction (Fig. 8, lanes 24 and 25). Another slowly migrating NRE-protein complex
was expressed in nonadherent BAL cells. This complex did not supershift with C/EBP
antibodies (data not shown).
| |
Discussion |
|---|
|
|
|---|
M. tuberculosis and other opportunistic infections including Pneumocystis carinii, cryptococcus, CMV, and bacterial
infections enhance HIV-1 replication in vivo (2, 3, 30).
We previously reported significantly increased HIV-1
RNA and p24 levels in radiographically involved lobes in
tuberculosis/HIV-1 coinfected patients compared with uninvolved lobes or HIV-1-infected patients with no lung disease (2). We also demonstrated that M. tuberculosis stimulated HIV-1 replication in vitro as measured by increased
p24 in cell supernatants of undifferentiated U937 and
THP-1 cells over 4 d (30). We correlated these increases
with transcriptional activation at the tandem NF-
B sites
and the C/EBP sites on the HIV-1 LTR using CAT reporter constructs (30). Studies with the promonocyte U937
and monocytic THP-1 cell lines have shown that LPS and
TNF-
also enhance HIV-1 replication through activation
of NF-
B (35). Surprisingly, when monocytes are differentiated to macrophages, LPS or other proinflammatory
stimuli suppress HIV-1 replication (8, 9). Inhibition of viral
replication in macrophages after proinflammatory stimuli is
a type I IFN effect (11, 12). We now demonstrate a novel
mechanism of transcriptional control by type I IFNs that alter expression of C/EBP
, producing a dominant negative
transcription factor and repressing the HIV-1 LTR. In vivo, alveolar macrophages from uninflamed lung behave
like IFN-
-treated macrophages, expressing the inhibitory
16-kDa C/EBP
and inhibiting HIV-1 replication. This
may contribute to viral latency in the uninflamed lung.
We showed that M. tuberculosis suppressed HIV-1 replication, repressed LTR activity, and induced ISGF-3, a type
I IFN-specific transcription factor, in THP-1 macrophages.
Two separate strains of HIV-1 were suppressed, demonstrating that the effect was not strain specific. The formation of a type I IFN-specific transcription factor complex is
early in the IFN signaling cascade, induced by receptor-
directed protein phosphorylation. Since type I IFN mediates
strong antiviral activity, it is likely that the reduction of viral replication after M. tuberculosis infection is an IFN effect.
The suppression of HIV-1 replication correlated with repression of LTR activity, suggesting that transcriptional
downregulation is one mechanism of inhibition of viral
replication in this system. The HIV-1 LTR has an NRE
with three C/EBP sites located 5' to a tandem NF-
B site
(19, 38, 39). The NRE is the sequence that mediates HIV-1
LTR repression after an inflammatory stimulus (8).
Productive infection of macrophages by HIV-1 occurs
predominantly in alveolar macrophages and macrophage-lineage cells, e.g., in the brain, although monocyte-derived
macrophages are highly susceptible (6, 30, 40, 41). Differentiated monocytic U1 cells suppress HIV-1 expression after treatment with IFN-
, IL-6, or GM-CSF (42). These
cytokines act transcriptionally on the stably integrated
HIV-1 LTR in U1 cells. Macrophage differentiation upregulates NF-IL6 (C/EBP
), and NF-IL6 is responsible for
regulating gene expression in mature macrophages (43). M. tuberculosis stimulates production of macrophage cytokines IL-1
, IL-6, and TNF-
, and C/EBP binding sites are involved in the transcriptional regulation of these genes (44,
45). HIV-1 transcriptional regulation occurred independent
of NF-
B after U1 cells were treated with proinflammatory cytokines (39). Positive regulation can also occur
through interactions of C/EBP transcription factors with
the adjacent NF-
B (30). C/EBP
-NF-
B heterodimers
are more potent activators of the HIV-1 LTR than p50-
p65 complexes (46, 47). HIV-1 replication requires intact
C/EBP sites in monocytes but not lymphocytes, demonstrating a requirement for C/EBP activators by HIV-1 only
in monocytes and macrophages (24). Thus, we evaluated
the C/EBP family of transcription factors to clarify the
mechanism of activation and suppression of the HIV-1 LTR in differentiated and activated macrophages.
Point mutations in the C/EBP sites of the HIV-1 LTR NRE abolished promoter repression after stimulation with LPS or infection with M. tuberculosis. The continued increase in C/EBP-mutated HIV-1 LTR reporter activity over the course of the experiments demonstrates that these macrophages could sustain high levels of transcription after inflammatory stimuli. Therefore, the decline in the wild-type HIV-1 LTR after M. tuberculosis or LPS was not due to a nonspecific toxicity produced by the inflammatory stimuli. These results were obtained with stably integrated LTR CAT and LTR luciferase reporter constructs, demonstrating that the level of stimulation is not critically dependent on the site of integration or the reporter used. Repression of the wild-type HIV-1 LTR was caused by a specific interaction of a transcriptional repressor(s) with the C/EBP sites in the HIV-1 LTR.
Descombes and Schibler described two rat C/EBP
proteins which either activated the albumin promoter (liver-activating protein [LAP]) or repressed the albumin promoter
(liver-enriched inhibitory protein [LIP]) (20). Both were
transcribed from the same mRNA by using in-frame AUGs.
Both proteins share the 145 COOH-terminal amino acids
that contain the basic DNA-binding domain and the leucine
zipper dimerization helix. LAP uses the first and second AUG
start site and LIP the third, resulting in only LAP having the transcriptional activation domain (20). Consequently,
LAP is a longer protein (~39 kD) than LIP (~16 kD). However, LIP has higher binding affinity for its DNA cognate sequences, resulting in its ability to attenuate the transcriptional
stimulation of LAP in substoichiometric amounts. Small
changes in the LIP to LAP ratio resulted in large differences
in transcription, with promoter repression occurring at ratios
>0.2 (20, 21). LIP is also induced in mouse liver by LPS
(48). Our data suggest that Kupffer cells may contribute to
the increase in LIP observed in the liver after LPS treatment.
In vitro, expression of the inhibitory 16-kD C/EBP
represses promoters containing C/EBP sites in monocytes and
macrophages. When the 16-kD C/EBP
is cotransfected
with the HIV-1 LTR, transcription is strongly inhibited
(22), and cell lines with engineered expression of the
C/EBP
dominant negative isoform suppress induction of provirus and HIV-1 replication (23). Cytokine genes such
as TNF-
also have C/EBP binding sites, and transfection
of inhibitory C/EBP
represses TNF-
promoter activity
(26). The relevance of these in vitro studies is undefined,
since endogenous expression of inhibitory 16-kD C/EBP
in monocytes and macrophages has not been studied.
We demonstrate here that macrophages induce a dominant negative 16-kD C/EBP
transcription factor after stimulation with LPS or infection with M. tuberculosis. C/EBP
is the predominant C/EBP family member in these cells.
EMSA demonstrates that C/EBP
is in >95% of NRE-
protein complexes induced by these inflammatory stimuli.
The induction of this transcriptional repressor in our model
is coincident with repression of the HIV-1 LTR. Both stimulatory and inhibitory C/EBP
isoforms are expressed, but
repression would be expected because the 16-kD C/EBP
is dominant negative, inhibiting transcription when expressed at 20% the level of the 37-kD isoform (20, 21). All
cells that inhibited HIV-1 replication or LTR promoter
function had a higher ratio of inhibitory to stimulatory isoforms (Table 1). Since C/EBP
is the predominant transcription factor induced by inflammatory stimuli and intact
C/EBP sites are required for LTR repression, induction of
endogenous inhibitory 16-kD C/EBP
is most likely
responsible for LTR repression after inflammatory stimulation. This conclusion is strongly supported by the observation that engineered expression of 16-kD C/EBP
represses the LTR and inhibits HIV-1 replication (22, 23).
Treatment of macrophages with IFN-
induces a dominant negative C/EBP
transcription factor and represses
HIV-1 LTR promoter within 3 h. Given the rapid effect of
IFN-
on 16-kD C/EBP
induction and LTR repression,
it is likely that these are direct IFN effects. These effects
occur at low doses. 1 U/ml of IFN-
maximally induces inhibitory C/EBP
and maximally represses the HIV-1
LTR. Therefore, one mechanism of inhibition of viral replication by type I IFN is transcriptional repression. The ratio of inhibitory to stimulatory C/EBP
is 3.6 after treatment with IFN-
compared with a ratio of 0.8 after
treatment with LPS. This may account for the greater LTR
repression produced by IFN-
. Taken together with the
induction of ISGF-3 by M. tuberculosis, these data suggest
that M. tuberculosis and LPS repress the LTR by producing
an IFN response in macrophages.
Induction of a dominant negative C/EBP
transcription
factor by type I IFN reveals a highly unusual form of regulation. The C/EBP
gene has no introns, so the change in
coding potential of the mRNA is regulated by a ribosome
scanning mechanism (20, 48). After IFN-
stimulation,
the ribosome selects an internal ribosome entry site in the
C/EBP
mRNA, producing dominant negative transcription factors 16-20-kD in size. In the absence of IFN stimulation, the ribosome selects the 5' translation start sites, producing stimulatory transcription factors 35-37-kD in
size. IFN stimulation can produce a rapid switch from transcriptional stimulation to transcriptional repression without
changes in levels of C/EBP
mRNA. It is possible that
phosphorylation of translation initiation factors by double-stranded protein kinase alters ribosome function, producing
altered translation start site usage. IFN-
-treated macrophages are the first in vitro system to regulate inhibitory C/EBP
production, and this model will be useful to investigate translation start site switching in the C/EBP
mRNA.
Alveolar macrophages from normal lung are primed by
type I IFN even in the absence of viral infection (13). Expression of innate immunity in the uninflamed lung may
contribute to viral latency. In vivo, resting alveolar macrophages from AIDS patients with no detectable viral replication strongly express the inhibitory 16-kD C/EBP
. The
ratio of inhibitory to stimulatory C/EBP
is 1.0 in these
lung segments. The inhibition of viral replication in uninflamed lung is similar to IFN-
-treated macrophages in vitro (9). Therefore, IFN-treated macrophages are a good
model for resting alveolar macrophages. AIDS does not alter regulation of C/EBP
, since the ratio of inhibitory to
stimulatory C/EBP
is similar in HIV-1-infected and
HIV-1-negative patients. HIV-1 latency in alveolar macrophages in uninflamed lung is encouraged by increased
expression of this C/EBP
16-kD inhibitory isoform, and
our in vitro experiments with differentiated and stimulated macrophages support this novel concept.
Our data demonstrate that M. tuberculosis infection in
vivo suppresses C/EBP
proteins, particularly the 16-kD
inhibitory isoform. There is 6.6-fold greater C/EBP
-
mediated NRE binding in the uninvolved lobes than in the
involved lobes (Table 3). NF-
B expression is equal or
higher in the involved segment on the immunoblot. Furthermore, nonspecific NRE binding activity is similar in
uninvolved and involved lung segments (only 1.1-fold increased) in EMSA from five patients. Therefore, it is unlikely that the diminished C/EBP
expression in involved
lobes is due to nonspecific protein degradation. We propose that loss of the inhibitory C/EBP
expression observed in pulmonary tuberculosis derepresses the HIV-1
LTR. Derepression may be one mechanism for enhanced
HIV-1 replication observed in pulmonary tuberculosis.
A C/EBP DNA binding protein is induced in BAL cells
during pulmonary tuberculosis. This NRE-protein complex is not supershifted by antibodies to C/EBP
, C/EBP
,
C/EBP
, C/EBP
, or CHOP, raising the possibility that
the NRE binding protein is a novel member of the C/EBP
transcription factor family. This NRE binding activity is
enriched in adherent BAL cells, suggesting that it is expressed in alveolar macrophages. Since C/EBP binding
sites of the LTR are required for HIV-1 replication in
macrophages (24), it is possible that the novel C/EBP
binding protein is important in the high level of replication
observed in pulmonary tuberculosis (2, 6). This transcription factor is a candidate to stimulate C/EBP-containing
promoters during pulmonary tuberculosis and possibly other diseases associated with macrophage activation. Further experiments defining the modulation of these nuclear
proteins may improve the understanding of HIV-1 latency
in tissue macrophages and provide novel approaches to
pursuing elimination of this clever pathogen.
| |
Footnotes |
|---|
Address correspondence to Michael Weiden, Division of Pulmonary and Critical Care Medicine and Bellevue Chest Service, NYU Medical Center, 550 First Ave., New York, NY 10016. Phone: 212-263-7889; Fax: 212-263-8501; E-mail: weidem01{at}gcrc.med.nyu.edu
Received for publication 22 May 1998 and in revised form 6 July 1998.
Y. Honda's current address is Department of Medicine, Sendai Kosei Hospital, Sendai 980, Japan.This work was supported by National Institutes of Health grants MO1 RR00096, HL-51470, and HL-51494, and AI-37877, by the American Lung Association, and by Fred Friedman.
Abbreviations used in this paper BAL, bronchoalveolar lavage; CAT, chloramphenicol acetyltransferase; C/EBP, CCAAT/enhancer binding protein; EMSA, electromobility shift assay; IRF-1, IFN regulatory factor 1; ISGF-3, IFN-stimulated gene factor 3; ISRE, IFN-stimulated response element(s); LAP, liver-activating protein; LIP, liver-enriched inhibitory protein; moi, multiplicity of infection; NF, nuclear factor; NRE, negative regulatory element; Stat, signal transducer and activator of transcription.
| |
References |
|---|
|
|
|---|
| 1. | Nakata, K., M. Weiden, T. Harkin, D. Ho, and W.N. Rom. 1995. Low copy number and limited variability of proviral DNA in alveolar macrophages from HIV-1 infected patients: evidence for genetic differences in HIV-1 between lung and blood macrophage populations. Mol. Med. 1: 744-757 [Medline]. |
| 2. | Nakata, K., W.N. Rom, Y. Honda, R. Condos, S. Kanegasaki, Y. Cao, and M. Weiden. 1997. M. tuberculosis enhances human immunodeficiency virus-1 replication in the lung. Am. J. Respir. Crit. Care Med. 155: 996-1003 [Abstract]. |
| 3. |
Itescu, S.,
P.F. Simonelli,
R.J. Winchester, and
H.S. Ginsberg.
1994.
Human immunodeficiency virus type 1 strains in
the lungs of infected individuals evolve independently from
those in the peripheral blood and are highly conserved in the
C-terminal region of the envelope V3 loop.
Proc. Natl. Acad.
Sci. USA.
91:
11378-11382
|
| 4. | Israel-Biet, D., J. Cadranel, K. Beldjord, J. Andrieu, A. Jeffrey, and P. Even. 1991. Tumor necrosis factor production in HIV-seropositive subjects: relationship with lung opportunistic infections and HIV expression in alveolar macrophages. J. Immunol. 147: 490-494 [Abstract]. |
| 5. | Sierra-Madero, J., Z. Toossi, D. Hom, C. Finegan, E. Hoenig, and E. Rich. 1994. Relationship between load of virus in alveolar macrophages from human immunodeficiency virus type 1-infected persons, production of cytokines, and clinical status. J. Infect. Dis. 169: 18-27 [Medline]. |
| 6. |
Orenstein, J.M.,
C. Fox, and
S.M. Whal.
1997.
Macrophages
as a source of HIV during opportunistic infections.
Science.
276:
1857-1861
|
| 7. | Whalen, C., C.R. Horsburgh, D. Hom, C. Lahart, M. Simberkoff, and J. Ellner. 1995. Accelerated course of human immunodeficiency virus infection after tuberculosis. Am. J. Respir. Crit. Care Med. 151: 129-135 [Abstract]. |
| 8. | Bernstein, M.S., S.E. Tong-Starksen, and R.M. Locksley. 1991. Activation of human monocyte-derived macrophages with lipopolysaccharide decreases human immunodeficiency virus replication at the level of gene expression. J. Clin. Invest. 88: 540-545 . |
| 9. |
Kornbluth, R.S.,
P.S. Oh,
J.R. Munis,
P.H. Cleveland, and
D.D. Richman.
1989.
Interferons and bacterial lipopolysaccharide protect macrophages from productive infection by
human immunodeficiency virus in vitro.
J. Exp. Med.
169:
1137-1151
|
| 10. | Herbein, G., and S. Gordon. 1997. 55- and 75-kilodalton tumor necrosis factor receptors mediate distinct actions in regard to human immunodeficiency virus type 1 replication in primary human macrophages. J. Virol. 71: 4150-4156 [Abstract]. |
| 11. | Gessani, S., U. Testa, B. Varano, P. Di Marzio, P. Borghi, L. Conti, T. Barberi, E. Tritarelli, R. Martucci, D. Seripa, et al . 1993. Enhanced production of LPS-induced cytokines during differentiation of human monocytes to macrophages: role of LPS receptors. J. Immunol. 151: 3758-3766 [Abstract]. |
| 12. |
Hamilton, J.A.,
W.A. Genevieve,
I. Kola, and
P.J. Hertzog.
1996.
Endogenous Interferon- / suppresses colony-stimulating factor (CSF-1) stimulated macrophage DNA synthesis
and mediates inhibitory effects of LPS and TNF- .
J. Immunol.
156:
2553-2557
[Abstract].
|
| 13. |
Hwang, S.,
P.J. Herzog,
K. Holland,
S. Sumarsono,
M.J. Tymms,
J.A. Hamilton,
G. Whitty,
I. Bertoncello, and
I. Kola.
1995.
A null mutation in the gene encoding a type I interferon receptor component eliminates antiproliferative and
antiviral responses to interferon and and alters macrophage responses.
Proc. Natl. Acad. Sci. USA.
92:
11284-11288
|
| 14. | van der Broek, M., U. Muller, S. Huang, R. Zinkernagel, and M. Aguet. 1995. Immune defense in mice lacking type I and/or type II interferon receptors. Immunol. Rev. 148: 5-18 [Medline]. |
| 15. | Khan, N., A. Pulford, M. Farquharson, A. Howatson, C. Stewart, R. Jackson, A. McNicol, and A. Foulis. 1989. The distribution of immunoreactive interferon-alpha in normal human tissues. Immunology. 66: 201-206 [Medline]. |
| 16. |
Novic, D.,
B. Cohen, and
M. Rubenstein.
1994.
The human
interferon / receptor: characterization and molecular cloning.
Cell.
77:
391-400
[Medline].
|
| 17. |
Muller, U.,
U. Steinhoff,
L. Reis,
S. Hemmi,
J. Povlovic,
R. Zinkernagel, and
M. Aguet.
1994.
Functional role of type I
and type II interferons in antiviral defense.
Science.
264:
1918-1921
|
| 18. |
Bluyssen, H.,
J. Durbin, and
D. Levy.
1996.
ISGF3 p48, a
specificity switch for interferon-activated transcription factors.
Cytokine Growth Factor Rev.
7:
11-17
.
[Medline] |
| 19. |
Tesmer, V.M.,
A. Rajadhyaksha,
J. Babin, and
M. Bina.
1993.
NF-IL6-mediated transcriptional activation of the long
terminal repeat of the human immunodeficiency virus type 1.
Proc. Natl. Acad. Sci. USA.
90:
7298-7303
|
| 20. | Descombes, P., and U. Schibler. 1991. A liver-enriched transcriptional activator protein, LAP, and a transcriptional inhibitory protein, LIP, are translated from the same mRNA. Cell. 67: 569-579 [Medline]. |
| 21. |
Ossipow, V.,
P. Descombes, and
U. Schibler.
1993.
CCAAT/enhancer-binding protein mRNA is translated into
multiple proteins with different transcription activation potentials.
Proc. Natl. Acad. Sci. USA.
90:
8219-8223
|
| 22. | Henderson, A.J., X. Zou, and K. Calame. 1995. C/EBP proteins activate transcription from human immunodeficiency virus type 1 long terminal repeat in macrophages/monocytes. J. Virol. 69: 5337-5344 [Abstract]. |
| 23. | Henderson, A.J., R.I. Connor, and K.L. Calame. 1996. C/EBP activators are required for HIV-1 replication and proviral induction in monocytic cell lines. Immunity. 5: 91-101 [Medline]. |
| 24. |
Henderson, A.J., and
K.L. Calame.
1997.
CCAAT/enhancer
binding protein (C/EBP) sites are required for HIV-1 replication in primary macrophages but not CD4+ T cells.
Proc.
Natl. Acad. Sci. USA.
94:
8714-8719
|
| 25. |
Sears, R., and
L. Sealy.
1994.
Multiple forms of C/EBP
bind the EFII enhancer sequence in Rous sarcoma virus long
terminal repeat.
Mol. Cell. Biol.
14:
4855-4871
|
| 26. |
Pope, R.M.,
A. Lentz, and
S.A. Ness.
1995.
C/EBP regulation of the tumor necrosis factor gene.
J. Clin. Invest.
94:
1449-1455
.
|
| 27. | Dyer, R.B., and N.K. Herzog. 1995. Isolation of intact nuclei for nuclear extract preparation from a fragile B-lymphocyte cell line. Biotechniques. 19: 192-195 [Medline]. |
| 28. |
Pine, R..
1997.
Convergence of TNF and IFN signaling
pathways through synergistic induction of IRF-1/ISGF-1 is
mediated by a composite GAS/ B promoter element.
Nucleic
Acids Res.
25:
4346-4354
|
| 29. | Law, K.F., J. Jagirdar, M. Weiden, M. Bodkin, and W.N. Rom. 1996. Tuberculosis in HIV-positive patients: cellular response and immune activation in the lung. Am. J. Respir. Crit. Care Med. 153: 1377-1384 [Abstract]. |
| 30. | Zhang, Y., K. Nakata, M. Weiden, and W.N. Rom. 1995. Mycobacterium tuberculosis enhances HIV-1 replication by transcriptional activation at the long terminal repeat. J. Clin. Invest. 95: 2324-2331 . |
| 31. | Orendi, J.M., H.S.L.M. Nottet, M.R. Visser, A.F.M. Verheul, H. Snippe, and J. Verhoef. 1994. Enhancement of HIV-1 replication in peripheral blood mononuclear cells by Cryptococcus neoformans is monocyte-dependent but tumor necrosis factor-independent. AIDS (Lond.). 8: 423-429 [Medline]. |
| 32. |
Peterson, P.K.,
G. Gekker,
C.C. Chao,
S. Hu,
C. Edelman,
H.H. Balfour, and
J. Verhoef.
1992.
Human cytomegalovirus-stimulated peripheral blood mononuclear cells induce
HIV-1 replication via a tumor necrosis factor- -mediated
mechanism.
J. Clin. Invest.
89:
574-580
.
|
| 33. | Donovan, R.M., C.E. Bush, N.P. Markowitz, D.M. Baxa, and L.D. Saravolatz. 1996. Changes in virus load markers during AIDS-associated opportunistic diseases in human immunodeficiency virus-infected persons. J. Infect. Dis. 174: 401-403 [Medline]. |
| 34. | Goletti, D., D. Weissman, R.W. Jackson, N.M.H. Graham, D. Vlahov, R.S. Klein, S.S. Munsiff, L. Ortona, R. Cauda, and A.S. Fauci. 1996. Effect of Mycobacterium tuberculosis on HIV replication. Role of immune activation. J. Immunol. 157: 1271-1278 [Abstract]. |
| 35. |
Poli, G.,
A.L. Kinter,
E. Vicenzi, and
A.S. Fauci.
1994.
Interleukin-1 induces expression of the human immunodeficiency
virus alone and in synergy with interleukin-6 in chronically
infected U1 cells: inhibition of inductive effects by the interleukin-1 receptor antagonist.
Proc. Natl. Acad. Sci. USA.
91:
108-112
|
| 36. |
Pomerantz, R.J.,
M.B. Feinberg,
D. Trono, and
D. Baltimore.
1990.
Lipopolysaccharide is a potent monocyte/macrophage-specific stimulator of human immunodeficient virus
type 1 expression.
J. Exp. Med.
172:
253-261
|
| 37. |
Tadmori, W.,
D. Mondal,
I. Tadmori, and
O. Prakash.
1991.
Transactivation of human immunodeficiency virus type 1 long terminal repeats by cell surface tumor necrosis factor .
J. Virol.
65:
6425-6429
|
| 38. |
Lu, Y.,
M. Stenzel,
J. Sodroski, and
W. Haseltine.
1989.
Effects of long terminal repeat mutations on human immunodeficiency virus type 1 replication.
J. Virol.
63:
4115-4119
|
| 39. |
Lu, Y.,
N. Touzjian,
M. Stenzel,
T. Dorfman,
J. Sodroski, and
W. Haseltine.
1990.
Identification of cis-acting repressive
sequences within the negative regulatory element of HIV-1.
J. Virol.
64:
5226-5229
|
| 40. | Rich, E., I. Chen, J. Zack, M. Leonard, and W. O'Brien. 1992. Increased susceptibility of differentiated mononuclear phagocytes to productive infection with human immunodeficiency virus-1. J. Clin. Invest. 89: 176-183 . |
| 41. | Schuitemaker, H., N.A. Kootstra, M.H.G.M. Koppelman, S.M. Bruistein, H.G. Huisman, M. Tersmette, and F. Miedema. 1992. Proliferation-dependent HIV-1 infection of monocytes occurs during differentiation into macrophages. J. Clin. Invest. 89: 1154-1160 . |
| 42. | Goletti, D., A. Kinter, P. Biswas, S. Bende, G. Poli, and A. Fauci. 1995. Effects of cellular differentiation on cytokine- induced expression of human immunodeficiency virus in chronically infected promonocytic cells: dissociation of cellular differentiation and viral expression. J. Virol. 69: 2540-2546 [Abstract]. |
| 43. |
Natsuka, S., and
S. Akira.
1992.
Macrophage differentiation-specific expression of NF-IL6, a transcription factor for interleukin 6.
Blood.
79:
460-466
|
| 44. |
Zhang, Y.,
M. Broser, and
W.N. Rom.
1994.
Activation of
the interleukin-6 gene by Mycobacterium tuberculosis or lipopolysaccharide is mediated by NF-IL6 and NF- B.
Proc.
Natl. Acad. Sci. USA.
91:
2225-2229
|
| 45. |
Zhang, Y., and
W.N. Rom.
1993.
Regulation of the interleukin-1 gene by mycobacterial components and lipopolysaccharide is mediated by two NF-IL6-like motifs.
Mol. Cell.
Biol.
13:
3831-3837
|
| 46. |
Vietor, I.,
I.C. Oliveira, and
J. Vilcek.
1996.
CCAAT box
enhancer binding protein (C/EBP- ) stimulates B element-mediated transcription in transfected cells.
J. Biol.
Chem.
271:
5595-5602
|
| 47. |
Ruocco, M.R.,
X. Chen,
C. Ambrosino,
E. Dragonetti,
W. Liu,
M. Mallardo,
G. De Falco,
C. Palmieri,
G. Franzoso,
I. Quinto, et al
.
1996.
Regulation of HIV-1 long terminal repeats by interaction of C/EBP (NF-IL6) and NF- B/rel
transcription factors.
J. Biol. Chem.
247:
22479-22486
.
|
| 48. |
An, M.R.,
C.C. Hsieh,
P.D. Reisner,
J.P. Rabek,
S.G. Scott,
D.T. Kuninger, and
J. Papaconstantinou.
1996.
Evidence for
posttranscriptional regulation of C/EBP and C/EBP isoform expression during lipopolysaccharide-mediated acute-phase response.
Mol. Cell. Biol.
16:
2295-2306
[Abstract].
|
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|