|
|
|
|
|
|
|
||
Articles |
University of Colorado Health Science Center, Department of Immunology, Denver, Colorado 80220
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
light chain genes usually rearrange after 
genes. This allowed us to analyze loci in IgM+ cells to determine how frequently in-frame genes fail to suppress gene rearrangements. To do this, we analyzed recombined VJ genes inactivated by subsequent recombining sequence (RS) rearrangement. RS rearrangements delete portions of the locus by a V(D)J recombinase-dependent mechanism, suggesting that they play a role in receptor editing. We show that RS recombination is frequently induced by, and inactivates, functionally rearranged loci, as nearly half (47%) of the RS-inactivated VJ joins were in-frame. These findings suggest that receptor editing occurs at a surprisingly high frequency in normal B cells.
Key Words: receptor editing • recombining sequence recombination • immune tolerance • B lymphocytes • V(D)J rearrangements
Abbreviations used: FWR, framework region; JCD/+, heterozygous deficient germline genotype; RS, recombining sequence; Tg, transgenic.
The fact that virtually all B cells express a single H and L chain prompted many studies to elucidate the underlying mechanism. One process that clearly contributes to allelic exclusion is the imprecision of V(D)J rearrangement that generates a maximum of one in-frame rearrangement per three attempts (1), but more active feedback processes are also involved. Classic studies showing the ability of a H chain transgene (2, 3) or an L chain transgene (4, and for review see reference 5) to mediate feedback suppression of H and L chain rearrangements, respectively, established important paradigms that have been widely accepted. But in the case of L chain allelic exclusion, this paradigm was weakened by an increasing number of "exceptions", in which ongoing L chain rearrangement occurred despite expression of functional
The organization of the chain (6–9). Studies with autoantibody transgenic (Tg)1 mice suggested that many of the exceptions to the feedback regulation model of L chain allelic exclusion could be explained by postulating self-tolerance– induced receptor editing (10–15). In addition, recent in vitro studies (16–18) and analyses of autoantibody Ig knock-in mice (19, 20) have shown that L chain gene receptor editing can be an important mechanism of B cell tolerance. Despite these findings, it is unclear how frequently receptor editing is used for tolerance induction in normal, non-Ig Tg autoreactive B cells, in part because the extent of autoreactivity in the preselected B cell repertoire is unknown. locus, with arrangement of V genes in both sense and antisense transcriptional orientations, the absence of D region gene segments, and the presence of several J gene segments facilitates sequential, nested V-to-J rearrangement attempts (for review see reference 21). In developing B cells, these secondary rearrangements can both rescue receptor expression in cells that fail to assemble in-frame L chains (1, 22) and rescue autoreactive B cells from tolerance elimination by replacing rearranged genes with new ones that alter specificity (for review see reference 23). Another way that the organization of the locus promotes receptor editing is suggested by the existence of the conserved element known as recombining sequence (RS) in the mouse (or the homologous " deleting element" in humans; reference 24). RS is located 
25 kb downstream of the C exon (25) and has no coding function (26), but undergoes V(D)J recombinase-dependent rearrangement that inactivates the locus by deletional rearrangements in cis (26–28) (see Fig. 1). In an autoantibody knock-in model system, RS rearrangements can inactivate functional genes (20), but the extent of RS-mediated receptor editing in normal B cells remains unknown.
|
and L chain loci, gene rearrangement almost always occurs after rearrangement (for review see references 29, 30). Thus, if an appropriate gene is not assembled, rearrangement at the locus often follows. In + B cells, RS rearrangements usually have deleted the C loci (27, 28, 31) either by recombining to Vs, through the well characterized heptamer–nonamer recombination signal sequences (Fig. 1 B), or to heptamer sites in the J-C intron (Fig. 1 C) (27, 28, 32). Besides destroying the function of the locus, this latter mode of RS recombination has two important effects: first, unlike nested VJ recombinations, it eliminates the C-associated cis-acting enhancer elements that are critical for VJ expression and rearrangement (33–36), and second, it retains any VJ join that was previously adjacent to C. This physiological knockout of regulatory sequences required for gene rearrangement thus "freezes" the locus, allowing an analysis of the VJ gene that was assembled adjacent to the C exon just before RS and gene rearrangement.
In this study, we have isolated such VJ joins from a large number of individual IgM++ B cells and determined their nucleotide sequences in order to ascertain the extent to which RS inactivates functional genes in a normal, non-Ig Tg immune system. The results indicate that in normal IgM+ B cells RS-mediated receptor editing is induced by and frequently inactivates functionally rearranged genes, probably because of immune tolerance.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
– C locus (JCD/JCD; a gift from D. Huszar, GenPharm International, San Jose, CA; reference 33) were maintained under specific pathogen–free conditions in the animal care facility at National Jewish Medical and Research Center. JCD/JCD mice were bred with B10.D2nSn/J mice to generate B10.D2nSn/ J-JCD/+ mice (JCD/+), which were used at 6-8 wk of age.
Cell Sorting and Genomic DNA Isolation.
Splenic cells from JCD/+ mice were isolated and stained with goat anti–mouse IgM-PE (Caltag Labs., San Francisco, CA) and goat anti–mouse -FITC (Fisher Scientific Co., Pittsburgh, PA) and sorted on an ELITE flow cytometer (Coulter Corp., Miami, FL) to collect IgM++ B cells. Genomic DNA was isolated from cells by overnight proteinase K digestion in lysis buffer (100 mM NaCl, 10 mM Tris-Cl, pH 8, 25 mM EDTA, 0.5% SDS) at 55°C, followed by phenol/chloroform extraction and EtOH precipitation.
Analysis of Direct PCR Amplified Ig Rearrangements.
Genomic DNA from sorted cells was used as a template to amplify VJ-intron-RS rearrangements. As shown in Fig. 1, primers A (degenerate V framework region [FWR]3; reference 37) and B (RS -101, 5' ACATGGAAGTTTTCCCGGGAGAATATG 3') amplified a product of 1,450 bps (for J5) using an amplification profile of 1 min at 94°C, 1 min at 58°C and 1 min at 72°C for 30–35 cycles. The resulting VJ5-intron-RS products were gel isolated and cloned into the TA II vector (Invitrogen, Carlsbad, CA) and colonies were screened by hybridization using the IVS probe (1). PCR clones were sequenced by the dideoxy termination method (Sequenase; United States Biochemical Corp., Cleveland, OH) using vector-specific forward and reverse primers, as well as antisense J5-specific (5' CTAACATGAAAACCTGTGTCTTACACA 3') and RS-specific (5' AAAGCTACATTAGGGCTCAAATCTGA 3') primers. Both DNA strands from the PCR clones were sequenced over the VJ joins to verify the reading frame.
Production of + Hybridomas.
Splenocytes from B10.D2nSn/J-JCD/+ mice were cultured in DMEM supplemented with 10% fetal bovine sera plus 50 µg/ml LPS (E. coli LPS; Sigma Chemical Co., St. Louis, MO) for 3 d, then fused with NSO-bcl2 (38) myeloma cells for fusion 1 or SP2/0 (39) myeloma cells for fusions 2 through 5. Hybridoma supernatants were screened by ELISA for secretion of micrometer/liter Ig and the lack of Ig secretion.
Analysis of Hybridoma Ig Rearrangements.
Hybridoma genomic DNA was digested with EcoRI or BamHI, then fractionated on 0.8% agarose gels, blotted to nylon membrane, and hybridized with the RS 0.8 (27) or IVS probes (Fig. 1 A). V-RS rearrangements were identified by genomic Southern blot analysis using the RS probe and/or by PCR amplification using primer A and primer B to yield a PCR product of 255 bps. VJ-intron-RS rearrangements were identified by genomic Southern blot analysis using both the RS and IVS probes and/or by PCR amplification using primer C (J intron, 5' CTGACTGCAGGTAGCGTGGTCTTCTAG 3') and primer B, and amplified for isolation and sequencing using primers A and B. The resulting products were isolated from 1.8% low-melt agarose gels, cycle sequenced directly (Dye Terminator Cycle Sequencing Ready Reaction kit; PE Applied Biosystems, Norwalk, CT) and analyzed using an ABI 377 DNA Sequencer (PE Applied Biosystems). To obtain near full-length sequences of hybridoma 1-2A7, 1-2E11, 2-2H11, 3-15D6, 3-15C4 and 3-17B10 V genes, a consensus FWR1 oligo (amino acids –1 through 8; 5' GGTGACATTGTGCTGACCCAGTCTCCA 3') was used with antisense J-intron oligos for PCR amplification, followed by cycle sequencing of the products. For hybrids 1-3E8, 2-15E11, 3-7G5, 4-1D2, 1-10A11 and 1-11A4, V leader specific oligos (Ig Prime kit; Novagen, Madison, WI) were used for amplification.
Cloning and Expression of V(D)J Rearrangements for Analysis of H/L Chain Pairing.
The H chain V(D)J and the L chain VJ-RS rearrangements from hybridoma 2H11 were genomically cloned as previously described (40), with the modifications that Zap (Stratagene, La Jolla, CA) was the cloning vector and the RS and IVS probes were used to screen clones for the VJ-RS rearrangement. The 6.5-kb EcoRI fragment containing the V(D)J rearrangement and the 4.0-kb EcoRI–XbaI fragment containing the VJ rearrangement were gel isolated and ligated to pRµSal, a Cµ expression vector (41) and pSV2-neo-C, a C expression vector (42) respectively. The H chain from hybridoma 15E11 was cloned by PCR amplification using a leader intron oligo (5' GAACTGGCAGGACCTGAGGTGAAAATGACA 3') and an oligo that spanned the XbaI site downstream of JH4 (5' CAGGCTCCACCAGACCTCTCTAGA 3'). The resulting product was digested with EcoO109I and XbaI and ligated into EcoO109I and XbaI digested 8-1Cµ (40), a Cµ expression vector. The VJ-RS rearrangement from hybridoma 15E11 was also cloned by PCR using a leader intron oligo (5' TGGAATTCCAGGTTCTACTGGAGACATTGT-3') and an oligo which spanned the XbaI site downstream of J5 (5' ACGAATTCGTCTAGAAGACCACGCTACCT 3'). The resulting product was digested with EcoRI and subcloned into a shuttle vector containing V21C leader and promoter elements. An XbaI fragment that contained the promoter elements, leader, and the 15E11 VJ rearrangement was isolated and cloned into the XbaI site in pSV2-neo-C (42). The 2H11 and 15E11 H and L chain constructs were then cotransfected into SP2/0 myeloma cells and selected for expression of IgM as previously described (40).
IgM ELISA for Analysis of H/L Pairing.
Supernatants from 2H11 and 15E11 H and L chain transfectoma clones were assayed for IgM expression by ELISA. In brief, goat anti–mouse IgM (Southern Biotechnology Associates, Inc., Birmingham, AL) was diluted in PBS, coated onto 96-well Immulon 2HB plates (Dynex Technologies, Inc., Chantilly, VA) and incubated at room temperature for 3 h. Plates were washed five times with PBS/Tween 20, then incubated with blocking buffer (PBS, 0.5% BSA, 0.4% Tween 20) for 1 h at room temperature. Serial dilution of transfectoma and parental hybridoma supernatants were added and incubated at room temperature for 2 h. Plates were washed and horseradish peroxidase–conjugated goat anti–mouse (Southern Biotechnology Associates, Inc.) was added and incubated for 2 h. After a final wash, the chromogenic substrate 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (Sigma Chemical Co.) was added in McIlvain's buffer (84 mM Na2PO4/48 mM citrate, pH 4.6) with 0.005% H2O2 and OD 410 nm was read using an automated plate reader (Dynatech, Alexandria, VA). Transfectoma and hybridoma antibody concentrations were estimated by comparison to a TEPC 183 (µ) standard curve.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
J joins in the preimmune B cell repertoire, IgM++ splenic B cells were isolated by fluorescence activated cell sorting and their genomic DNA was analyzed by the PCR strategy outlined in Fig. 1 C. This cell sorting strategy should exclude from the template pool cells that are +, H chain isotype switched, surface (s)Ig–, or cells of a sIglo, germinal center phenotype. In a second series of experiments, IgM secreting hybridomas were isolated and their loci analyzed in detail. To simplify these analyses, all B cells analyzed were heterozygous for a targeted deletion of the J–C locus (JCD/+), in which only a single locus and RS allele could rearrange (33). The potential gene and RS element rearrangements are depicted in Fig. 1.
Analysis of IgM Cells Reveals Frequent Receptor Editing.
Genomic DNA from sorted IgM cells was used as template for a PCR using a panspecific V FWR 3 oligonucleotide primer, which recognizes 80% of V genes (37), together with an RS-specific primer to amplify VJ-intron-RS rearrangements (Fig. 1 C, primers A and B). VJ-intron-RS rearrangements containing V genes rearranged to each of the four functional J genes were detected by PCR amplification and Southern blotting (data not shown), but VJ5-intron-RS rearrangements were most abundant, in part because their smaller size promoted preferential amplification. Amplified VJ5-intron-RS rearrangements were gel-purified and cloned, and a total of 52 clones were sequenced across both the VJ and the J-intron-RS joins (Fig. 2). These two different recombination joins, present on each PCR product analyzed, provided markers for uniqueness. PCR products that were identical to one another, or that differed by just one nucleotide, were assumed to represent repeated isolates derived from the same initial template (i.e., derived from a single B cell clone). This represents an underestimate because the single base changes could have reflected real differences and because it was possible that some of the apparent repeats were independent events that happened to have identity in the portions of the genes studied, but not in upstream portions of the V genes. In this sample, at least 37 of the 52 clones represented independent events. Analysis of the VJ join sequences allowed an assessment of the potential prior functionality of the VJ5 joins just upstream of intron-RS rearrangements. Surprisingly, 15 of the 37 clones (41%) contained VJ joins that were in-frame (Fig. 2), and if the apparent repeats were not excluded 23 out of 52 (44%) were in-frame.
|
J-intron-RS rearrangements and to increase the sample size, an independent sampling of VJ-intron-RS rearrangements was derived from JCD/+ splenocytes in the form of B cell hybridomas. A total of 133 IgM-expressing hybrids were obtained from five separate fusions and their locus rearrangements were analyzed. Genomic Southern blot and PCR analysis revealed that at least 74% of the + hybrids (99 out of 133) had inactivated the wild-type locus by RS rearrangements (Table 1), a value in accord with previous estimates (31, 34). Two hybridomas apparently had undergone inversional V-RS rearrangements, as they had unique restriction fragments that retained the C locus as revealed by the intron (IVS) probe (data not shown), but scored positive in a V-RS PCR (Fig. 1 B). Approximately 25% (26 out of 99) of the hybridomas with RS rearrangements had J-intron-RS joins (Table 1), as detected with primers B and C (Fig. 1 C). Genomic Southern blot analysis of 18 out of 20 hybrids scoring PCR positive for J- intron-RS rearrangements demonstrated that the RS rearrangements colocalized with EcoRI restriction fragments hybridizing with the IVS probe (data not shown), thus independently confirming the VJ-intron-RS rearrangement phenotype. VJ-intron-RS rearrangements from individual hybridomas were PCR amplified and directly sequenced, rather than cloned, a procedure that diminishes potential Taq polymerase-generated mutations. Like the VJ-intron-RS PCR clones, most of the VJ-intron-RS loci from hybridomas used J5, although four hybridomas had rearrangements to upstream Js, including one to J2 and three to J4, suggesting that developing B cells do not frequently undergo RS rearrangement until all of the Js are rearranged. Sequence analysis over both the VJ and intron-RS joins clearly showed that each cell line had a unique sequence at the VJ join and that, remarkably, 12 of 20 (60%) of the VJ joins were in-frame (Fig. 3 A).
|
|
J-intron-RS rearrangements were clearly diverse because at least 32 different V genes representing 11 of the 19 V families were identified among the 57 independent VJ-intron-RS loci analyzed (data not shown). This value of V gene representation in the VJ-intron-RS loci analyzed is most likely an underestimate of the diversity because the 5' PCR primer lies in FWR3 and yields only a short stretch of V gene sequence for interclonal comparison. Despite this limitation, multiple genes were observed within particular V gene families. For example, within the V4/5 family, at least 11 different genes were represented among the 14 in-frame and 7 out-of-frame joins (data not shown). In addition, V genes were sometimes found repeatedly in independent VJ-intron-RS rearrangements and there was considerable overlap in usage among hybridoma and PCR clone sequences. 13 of the hybridomas used V genes that were observed in the direct PCR–derived clones, whereas 6 hybridomas expressed distinct V genes that were members of families observed in the PCR clone sample and 1 hybridoma expressed a V32 gene, a V family not seen in the PCR clone samples (Figs. 2 and 3 and data not shown).
Intron/RS Joins.
The sequences of the J-intron-RS joins in both the PCR clones (Fig. 2) and hybridomas (Fig. 3 B) were quite varied and were dominated by deletions at both sides of the joins, as up to nine nucleotides were missing from either the J-intron or RS heptamer-flanking sequences. There did appear to be a bias for a particular join (e.g., clone 4, Fig. 2 A), which was observed to be associated with 13 independent VJ rearrangements. Two of the intron-RS joins contained P nucleotides and one contained N-region addition nucleotides, consistent with findings described previously (7, 43).
Rebuilding IgM Antibodies for Analysis of H/L Pairing and Antigen Specificity.
To determine if the high frequency of in-frame VJ rearrangements silenced by intron-RS recombination was due to the inability of H chains to pair with their L chains, the V(D)J and VJ rearrangements from hybridomas 2H11 and 15E11 were cloned into Cµ and C expression vectors, respectively. These H and L chain constructs were cotransfected into SP2/0 myeloma cells to generate transfectoma clones. Analysis of transfectoma supernatants by IgM sandwich ELISA revealed that the in-frame L chains were able to pair with their hybridoma H chains (Fig. 4), suggesting that ongoing RS rearrangement was not due to the inability of H/L chain pairing. The specificity of the µ transfectoma antibodies remains unknown, however. Attempts in flow cytometry assays to detect recombinant antibody binding to the surfaces of bone marrow cells were unsuccessful (data not shown).
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
J joins located upstream of intronic-RS rearrangements in normal, non-Ig Tg B cells to determine the extent to which RS-mediated recombination silences functionally rearranged genes. Nearly half of all VJ joins inactivated by RS recombination were in-frame (27 out of 57). This high frequency is clearly incompatible with a strict feedback suppression model of L chain allelic exclusion, which predicts no in-frame VJ joins upstream of the RS rearrangements. More strikingly, this high frequency is also significantly higher than 33%, the percentage of in-frame joins expected from random VJ rearrangement, indicating that productive VJ rearrangements actively induce intron-RS rearrangements. The data also demonstrate a physiological role for the RS element in normal B cell development—the inactivation of functionally rearranged genes.
To understand why we conclude that the RS rearrangements were actively induced by functional L chains, consider the extreme hypothetical cases of mice in which all gene rearrangements result in either autoreactive B cell receptors or nonproductive chains (Table 2). If V-to-J and RS rearrangements proceed randomly, albeit with different relative frequencies, then in either case VJ joins located upstream of intronic-RS rearrangements should be in-frame at a maximum frequency of one out of three. To significantly exceed this frequency, in-frame VJ joins must stimulate the relative rate of (intronic) RS rearrangement. This argument applies to our data because the observed frequency of in-frame joins, 47.4%, is significantly higher than one out of three (P < 0.04, single sample test of a proportion based on a normal approximation). Since it is exceedingly unlikely that the stimulus for increased in-frame rearrangements is mediated by anything other than protein, and because chains can probably only be perceived by the signaling machinery of B cells through their association with H chains, we conclude that functional chains actively stimulate the rate of RS rearrangement based on B cell receptor antigenic specificity. These data also predict that in mice in which the C exon is inactivated, but surrounding cis-acting elements are left intact, VJ rearrangement should be extensive, whereas RS rearrangement should be reduced. This is in fact the experimental observation (44).
|
pseudogenes, L chains that fail to pair with H chains, or a role for positive selection is responsible for our results. Furthermore, complete sequencing of the coding regions from all the in-frame VJ rearrangements derived from + hybridomas revealed no stop codons or other obvious defects that would have precluded function (Fig. 3 A). It is also unlikely that frequent aberrant H/L chain pairing is responsible for the high frequency of in-frame VJ joins in the VJ-intron-RS rearrangements, as demonstrated by the ability of H/L chains from two hybridomas to pair (Fig. 4). Moreover, there are few examples of L chains that fail to pair with H chains and most experiments suggest that virtually all random H/L pairs can associate (40, 45–48). Finally, if a lack of positive selection of surface Ig was responsible for the high frequency of in-frame joins, this would predict that B cells should frequently express two chains, a result that has not been observed.
The receptor editing events documented in this study probably do not represent renewed V(D)J recombination in mature B cells, such as has recently been described in the germinal center (49–51), because the cells analyzed expressed high levels of IgM and chain and because they were isolated and, in the case of the hybridomas, stimulated in a manner that should not have induced V(D)J recombination. Another indication that receptor editing in mature B cells is unlikely to explain our results is that the fraction of + cells in newly formed and mature splenic B cells is nearly identical, suggesting that in unmanipulated mice mature + cells rarely give rise to + B cells (44). Overall, it would appear from our data that the RS rearrangements that we studied were actually stimulated, rather than inhibited, by productive gene rearrangements, probably as the result of immune tolerance-mediated receptor editing in immature B cells. To definitively test the prediction that the chains of the cells that we have analyzed generate autoantibodies in association with the same cell's heavy chain, it will be necessary to generate mice transgenic for these genes.
|
Acknowledgments |
|---|
D/JCD mice; B. Diamond (Albert Einstein College of Medicine, Bronx, NY) for providing the NSO-bcl2 myeloma; S. Sobus for cell sorting; D. Norsworthy for cycle sequence analyses; D. Iklé of the Biostatistics Department for statistical analyses; K. Karjalainen and L. Wysocki for discussions; and M. Hertz, D. Melamed, V. Kouskoff, and other members of the lab for critical reading of the manuscript. This work was supported by grants from the National Institutes of Health and the Arthritis Foundation.
Submitted: 20 February 1998
Revised: 22 July 1998
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
1 Coleclough C, Perry RP, Karjalainen K & Weigert M. Aberrant rearrangements contribute significantly to the allelic exclusion of immunoglobulin gene expression, Nature, 1981, 290, 372–378.[Medline]
2 Nussenzweig MC, Shaw AC, Sinn E, Danner DB, Holmes KL, Morse HC III & Leder P. Allelic exclusion in transgenic mice that express the membrane form of immunoglobulin µ, Science, 1987, 236, 816–819.
3 Manz J, Denis K, Witte O, Brinster R & Storb U. Feedback inhibition of immunoglobulin gene rearrangement by membrane µ but not by secreted µ heavy chains, J Exp Med, 1988, 168, 1363–1381.
4 Ritchie KA, Brinster RL & Storb U. Allelic exclusion and control of endogenous immunoglobulin gene rearrangement in transgenic mice, Nature, 1984, 312, 517–520.[Medline]
5 Storb, U. 1995. Ig gene expression and regulation in Ig transgenic mice. In Immunoglobulin Genes. Second Edition. T. Honjo and F.W. Alt, editors. Academic Press, San Diego, CA. 345–363.
6 Gollahon KA, Hagman J, Brinster RL & Storb U. Ig –producing B cells do not show feedback inhibition of gene rearrangement, J Immunol, 1988, 141, 2771–2780.[Abstract]
7 Harada K & Yamagishi H. Lack of feedback inhibition of V gene rearrangement by productively rearranged alleles, J Exp Med, 1991, 173, 409–415.
8 Doglio L, Kim JY, Bozek G & Storb U. Expression of and genes can occur in all B cells and is initiated around the same pre-B-cell developmental stage, Dev Immunol, 1994, 4, 13–26.[Medline]
9 Ghia P, Gratwohl A, Signer E, Winkler TH, Melchers F & Rolink AG. Immature B cells from human and mouse bone marrow can change their surface light chain expression, Eur J Immunol, 1995, 25, 3108–3114.[Medline]
10 Gay D, Saunders T, Camper S & Weigert M. Receptor editing: an approach by autoreactive B cells to escape tolerance, J Exp Med, 1993, 177, 999–1008.
11 Radic MZ, Erikson J, Litwin S & Weigert M. B lymphocytes may escape tolerance by revising their antigen receptors, J Exp Med, 1993, 177, 1165–1173.
12 Tiegs SL, Russell DM & Nemazee D. Receptor editing in self-reactive bone marrow B cells, J Exp Med, 1993, 177, 1009–1020.
13 Chen C, Radic MZ, Erikson J, Camper SA, Litwin S, Hardy RR & Weigert M. Deletion and editing of B cells that express antibodies to DNA, J Immunol, 1994, 152, 1970–1982.[Abstract]
14 Prak EL, Trounstine M, Huszar D & Weigert M. Light chain editing in -deficient animals: a potential mechanism of B cell tolerance, J Exp Med, 1994, 180, 1805–1815.
15 Lang J, Jackson M, Teyton L, Brunmark A, Kane K & Nemazee D. B cells are exquisitely sensitive to central tolerance and receptor editing induced by ultralow affinity, membrane-bound antigen, J Exp Med, 1996, 184, 1685–1697.
16 Hertz M & Nemazee D. BCR ligation induces receptor editing in IgM+IgD– bone marrow B cells in vitro, Immunity, 1997, 6, 429–436.[Medline]
17 Melamed D & Nemazee D. Self-antigen does not accelerate immature B cell apoptosis, but stimulates receptor editing as a consequence of developmental arrest, Proc Natl Acad Sci USA, 1997, 94, 9267–9272.
18 Melamed D, Benschop RJ, Cambier JC & Nemazee D. Developmental regulation of B lymphocyte immune tolerance compartmentalizes clonal selection from receptor editing, Cell, 1998, 92, 173–182.[Medline]
19 Chen C, Prak EL & Weigert M. Editing disease-associated autoantibodies, Immunity, 1997, 6, 97–105.[Medline]
20 Pelanda R, Schwers S, Sonoda E, Torres RM, Nemazee D & Rajewsky K. Receptor editing in a transgenic mouse model: site, efficiency, and role in B cell tolerance and antibody diversification, Immunity, 1997, 7, 765–775.[Medline]
21 Nemazee, D. 1995. B lymphocyte tolerance in the mouse. In Immunoglobulin Genes. Second Edition. T. Honjo and F.W. Alt, editors. Academic Press, Inc., San Diego, CA. 365–378.
22 Feddersen RM & Van Ness BG. Corrective recombination of mouse immunoglobulin kappa alleles in Abelson murine leukemia virus-transformed pre-B cells, Mol Cell Biol, 1990, 10, 569–576.
23 Hertz M & Nemazee D. Receptor editing and commitment in B lymphocytes, Curr Opin Immunol, 1998, 10, 208–213.[Medline]
24 Siminovitch KA, Bakhshi A, Goldman P & Korsmeyer SJ. A uniform deleting element mediates the loss of genes in human B cells, Nature, 1985, 316, 260–262.[Medline]
25 Muller B, Stappert H & Reth M. A physical map and analysis of the murine C-RS region show the presence of a conserved element, Eur J Immunol, 1990, 20, 1409–1411.[Medline]
26 Daitch LE, Moore MW, Persiani DM, Durdik JM & Selsing E. Transcription and recombination of the murine RS element, J Immunol, 1992, 149, 832–840.[Abstract]
27 Durdik J, Moore MW & Selsing E. Novel light-chain gene rearrangements in mouse light chain-producing B lymphocytes, Nature, 1984, 307, 749–752.[Medline]
28 Moore MW, Durdik J, Persiani DM & Selsing E. Deletions of chain constant region genes in mouse chain–producing B cells involve intrachromosomal DNA recombinations similar to V-J joining, Proc Natl Acad Sci USA, 1985, 82, 6211–6215.
29 Selsing, E., and L.E. Daitch. 1995. Immunoglobulin genes. In Immunoglobulin Genes. Second Edition. T. Honjo and F.W. Alt, editors. Academic Press, San Diego, CA. 193–203.
30 Arakawa H, Shimizu T & Takeda S. Re-evaluation of the probabilities for productive arrangements on the and loci, Int Immunol, 1996, 8, 91–99.
31 Nadel B, Cazenave PA & Sanchez P. Murine lambda gene rearrangements: the stochastic model prevails over the ordered model, EMBO (Eur Mol Biol Org) J, 1990, 9, 435–440.[Medline]
32 Shimizu T, Iwasato T & Yamagishi H. Deletions of immunoglobulin C region characterized by the circular excision products in mouse splenocytes, J Exp Med, 1991, 173, 1065–1072.
33 Chen J, Trounstine M, Kurahara C, Young F, Kuo CC, Xu Y, Loring JF, Alt FW & Huszar D. B cell development in mice that lack one or both immunoglobulin light chain genes, EMBO (Eur Mol Biol Organ) J, 1993, 12, 821–830.[Medline]
34 Takeda S, Zou YR, Bluethmann H, Kitamura D, Muller U & Rajewsky K. Deletion of the immunoglobulin chain intron enhancer abolishes chain gene rearrangement in cis but not chain gene rearrangement in trans, EMBO (Eur Mol Biol Organ) J, 1993, 12, 2329–2336.[Medline]
35 Xu Y, Davidson L, Alt FW & Baltimore D. Deletion of the Ig light chain intronic enhancer/matrix attachment region impairs but does not abolish VJ rearrangement, Immunity, 1996, 4, 377–385.[Medline]
36 Gorman JR, van der Stoep N, Monroe R, Cogne M, Davidson L & Alt FW. The Ig 3' enhancer influences the ratio of Ig versus Ig B lymphocytes, Immunity, 1996, 5, 241–252.[Medline]
37 Schlissel MS & Baltimore D. Activation of immunoglobulin kappa gene rearrangement correlates with induction of germline kappa gene transcription, Cell, 1989, 58, 1001–1007.[Medline]
38 Ray S & Diamond B. Generation of a fusion partner to sample the repertoire of splenic B cells destined for apoptosis, Proc Natl Acad Sci USA, 1994, 91, 5548–5551.
39 Kearney JF, Radbruch A, Liesegang B & Rajewsky K. A new mouse myeloma cell line that has lost immunoglobulin expression but permits the construction of antibody-secreting hybrid cell lines, J Immunol, 1979, 123, 1548–1550.
40 Retter MW, Eisenberg RA, Cohen PL & Clarke SH. Sm and DNA binding by dual reactive B cells requires distinct VH, V, and VHCDR3 structures, J Immunol, 1995, 155, 2248–2257.[Abstract]
41 Nemazee DA & Burki K. Clonal deletion of B lymphocytes in a transgenic mouse bearing anti-MHC class I antibody genes, Nature, 1989, 337, 562–566.[Medline]
42 Retter MW, Cohen PL, Eisenberg RA & Clarke SH. Both Sm and DNA are selecting antigens in the anti-Sm B cell response in autoimmune MRL/lprmice, J Immunol, 1996, 156, 1296–1306.[Abstract]
43 Graninger WB, Goldman PL, Morton CC, O'Brien SJ & Korsmeyer SJ. The -deleting element. Germline and rearranged, duplicated and dispersed forms, J Exp Med, 1988, 167, 488–501.
44 Zou YR, Takeda S & Rajewsky K. Gene targeting in the Ig locus: efficient generation of chain-expressing B cells, independent of gene rearrangements in Ig, EMBO (Eur Mol Biol Organ) J, 1993, 12, 811–820.[Medline]
45 Hamel PA, Klein MH, Smith-Gill SJ & Dorrington KJ. Relative noncovalent association constant between immunoglobulin H and L chains is unrelated to their expression or antigen-binding activity, J Immunol, 1987, 139, 3012–3020.[Abstract]
46 Kaushik A, Schulze DH, Bonilla FA, Bona C & Kelsoe G. Stochastic pairing of heavy-chain and light-chain variable gene families occurs in polyclonally activated B cells, Proc Natl Acad Sci USA, 1990, 87, 4932–4936.
47 De Lau WB, Heije K, Neefjes JJ, Oosterwegel M, Rozemuller E & Bast BJ. Absence of preferential homologous H/L chain association in hybrid hybridomas, J Immunol, 1991, 146, 906–914.[Abstract]
48 Radic MZ, Mascelli MA, Erikson J, Shan H & Weigert M. Ig H and L chain contributions to autoimmune specificities, J Immunol, 1991, 146, 176–182.[Abstract]
49 Papavasiliou F, Casellas R, Suh H, Qin XF, Besmer E, Pelanda R, Nemazee D, Rajewsky K & Nussenzweig MC. V(D)J recombination in mature B cells: a mechanism for altering antibody responses, Science, 1997, 278, 298–301.
50 Han S, Dillon SR, Zheng B, Shimoda M, Schlissel MS & Kelsoe G. V(D)J recombinase activity in a subset of germinal center B lymphocytes, Science, 1997, 278, 301–305.
51 Hikida M & Ohmori H. Rearrangement of -light chain genes in mature B cells in vitro and in vivo. Function of reexpressed RAG gene products, J Exp Med, 1998, 187, 795–799.
52 Strohal R, Helmberg A, Kroemer G & Kofler R. Mouse V gene classification by nucleic acid sequence similarity, Immunogenetics, 1989, 30, 475–493.[Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Facebook 
Reddit 
Technorati 
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|
symbol) are shown above the sequences of the IRS1-RS joins present in each PCR clone. The RS join sequence for clone 17 was not determined. Underlined nucleotides could have been donated by either the IRS1 or the RS sequence, and N region addition (bold) and P-encoded nucleotides are shown between the joins. Repeats denote the number of times a particular sequence was observed.
